help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2006-0056
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, H.
Right arrow Articles by Gannon, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, H.
Right arrow Articles by Gannon, M.
Molecular Endocrinology 20 (8): 1853-1866
Copyright © 2006 by The Endocrine Society

The FoxM1 Transcription Factor Is Required to Maintain Pancreatic ß-Cell Mass

Hongjie Zhang, Amanda M. Ackermann, Galina A. Gusarova, David Lowe, Xue Feng, Usa G. Kopsombut, Robert H. Costa and Maureen Gannon

Departments of Medicine (H.Z., D.L., X.F., U.G.K., M.G.) and Molecular Physiology and Biophysics (A.M.A., M.G.), and Program in Developmental Biology (M.G.), Vanderbilt University Medical Center, Nashville, Tennessee 37232; and Department of Biochemistry and Molecular Genetics (G.A.G., R.H.C.), University of Illinois at Chicago, Chicago, Illinois 60607

Address all correspondence and requests for reprints to: Maureen Gannon, Ph.D., Vanderbilt University Medical Center, Division of Diabetes, Endocrinology and Metabolism, 2220 Pierce Avenue, 746 PRB, Nashville, Tennessee 37232. E-mail: Maureen.gannon{at}vanderbilt.edu.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The FoxM1 transcription factor is highly expressed in proliferating cells and activates several cell cycle genes, although its requirement appears to be limited to certain tissue types. Embryonic hepatoblast-specific inactivation of Foxm1 results in a dramatic reduction in liver outgrowth and subsequent late gestation lethality, whereas inactivation of Foxm1 in adult liver impairs regeneration after partial hepatectomy. These results prompted us to examine whether FoxM1 functions similarly in embryonic outgrowth of the pancreas and ß-cell proliferation in the adult. We found that FoxM1 is highly expressed in embryonic and neonatal endocrine cells, when many of these cells are proliferating. Using a Cre-lox strategy, we generated mice in which Foxm1 was inactivated throughout the developing pancreatic endoderm by embryonic d 15.5 (Foxm1{Delta}panc). Mice lacking Foxm1 in their entire pancreas were born with normal pancreatic and ß-cell mass; however, they displayed a gradual decline in ß-cell mass with age. Failure of postnatal ß-cell mass expansion resulted in impaired islet function by 6 wk of age and overt diabetes by 9 wk. The decline in ß-cell mass in Foxm1{Delta}panc animals is due to a dramatic decrease in postnatal ß-cell replication and a corresponding increase in nuclear localization of the cyclin-dependent kinase inhibitor, p27Kip1, a known target of FoxM1 inhibition. We conclude that Foxm1 is essential to maintain normal ß-cell mass and regulate postnatal ß-cell turnover. These results suggest that mechanisms regulating embryonic ß-cell proliferation differ from those used postnatally to maintain the differentiated cell population.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE MAJORITY OF the vertebrate pancreas is composed of exocrine tissue and associated ducts, which produce and secrete digestive enzymes. Scattered throughout the exocrine tissue are the endocrine islets of Langerhans. These clusters contain at least five different hormone-producing cell types: insulin (ß), glucagon ({alpha}), somatostatin ({delta}), ghrelin ({epsilon}), and pancreatic polypeptide (PP). Insulin and glucagon are critical participants in maintaining glucose homeostasis. A lack of insulin, or a failure of insulin to work properly, leads to diabetes mellitus.

ß-Cell mass plays an essential role in determining the amount of insulin that is secreted to maintain the body’s glucose levels within a narrow range. ß-Cell mass is dynamic, changing throughout the life of the organism (1, 2, 3). During embryogenesis, the endocrine cell population undergoes a dramatic expansion beginning at embryonic d 14.5 (E14.5). This is followed by substantial remodeling of the endocrine pancreas in the neonatal period, during which there is increased ß-cell apoptosis and neogenesis and a progressive decrease in ß-cell replication (2, 3). The adult ß-cell population has a slow turnover rate (1–4% per day) (4); the steady-state mass of ß-cells is governed by balancing ß-cell growth (neogenesis, replication, and hypertrophy) and ß-cell death (apoptosis). In most situations, ß-cell mass increases or decreases in accordance with metabolic demands. For example, ß-cell mass increases during pregnancy and in response to the insulin resistance associated with obesity, whereas it decreases after parturition (5, 6, 7).

Recent gene inactivation studies show that cell cycle regulators play an essential role in regulating ß-cell mass in the postnatal period. D- and E-type cyclins bind to their cyclin-dependent kinase (CDK) partners and play a critical role in cell cycle progression from G1 to S. Functional activity of cyclin/CDK complexes is regulated by cyclin-dependent kinase inhibitors (CDKIs) including p27Kip1 and p21Cip1, which bind to and inactivate cyclin/CDK complexes, thereby inhibiting progression from G1 to S. In cyclin D2–/– mice (8, 9), there is no significant difference in islet structure, composition, or mass at late gestation (E17.5) or at birth compared with wild-type littermates. However, 14-d-old cyclin D2–/– mice displayed dramatically smaller islets, a 4-fold reduction in ß-cell mass and glucose intolerance due to a marked defect in ß-cell replication; exocrine and ductal cells replicated normally. Thus, the absence of cyclin D2 leads to a narrow and highly selective consequence in the formation of the endocrine pancreas during postnatal development. Likewise, CDK4 deficiency specifically affects the islet ß-cell population in the pancreas. ß-Cell mass in neonatal CDK4–/– islets is also similar to wild type; however, adult CDK4–/– mice develop insulin-deficient diabetes due to a dramatic reduction in ß-cell mass (10). In a converse series of experiments, overexpression of the CDKI p27Kip1 in ß-cells results in severe diabetes as a result of decreased ß-cell proliferation and ß-cell mass (11). Additionally, p27Kip1 accumulates in ß-cell nuclei in some mouse models of type 2 diabetes (11). Deletion of p27kip1 in these models prevents the development of overt hyperglycemia and increases both islet mass and serum insulin concentration by stimulating ß-cell proliferation. Thus, manipulation of cell cycle regulatory factors, such as p27kip1, has the potential to restore islet mass during development of type 2 diabetes.

The Forkhead Box (Fox) family of transcription factors consists of more than 50 mammalian proteins (12) that share homology in the winged helix DNA binding domain. The FoxM1b protein (or FoxM1, previously known as HFH-11B, Trident, WIN, or MPP2) is a proliferation-specific member of the Fox family of transcription factors (13, 14, 15, 16). In the mouse embryo, FoxM1 is expressed in all proliferating tissues (14), whereas expression decreases after differentiation. In the adult, expression is largely restricted to the testis, thymus, lung, and intestinal crypts (16). During mouse liver regeneration, expression of FoxM1 is induced in mid-G1 phase of the cell cycle, and its expression continues during S phase and mitosis (16).

FoxM1 protein has been established as a key cell-cycle regulator of both the G1/S progression and G2/M transition (17, 18, 19). FoxM1 target genes include cyclin B1 and Cdc25B phosphatase (19), Aurora B and Polo-like kinases (18, 20), nuclear protein centromere-associated protein A (CENP-A) and CENP-B (21, 22). In addition, FoxM1 prevents nuclear accumulation of the CDKI, p27Kip1, by directly activating transcription of the Skp1-Cullin1-Fbox (SCF) ubiquitin ligase complex that targets p27 for degradation (21, 23, 24).

Foxm1 has been globally inactivated using different strategies. In one study, homozygous null mutant Foxm1 animals died in the perinatal period due to cardiac defects (25). The hearts of these mice were dilated with a dramatic reduction in the compact myocardium. Nuclei of cardiomyocytes were enlarged and polyploid, with increased DNA content up to 50-fold. In another study, loss of Foxm1 resulted in embryonic lethality in utero by E18.5 (18). Embryonic Foxm1–/– livers displayed a 75% reduction in the number of hepatoblasts, resulting from diminished DNA replication and a failure to enter mitosis, causing a polyploid phenotype. Furthermore, embryonic Foxm1–/– livers did not develop intrahepatic bile ducts. Liver-specific inactivation of Foxm1 in adult animals resulted in a significant reduction in hepatocyte DNA replication and inhibition of mitosis after partial hepatectomy (19). A pancreatic phenotype was not reported in any of these studies.

Based on the results described above, and the fact that the liver and pancreas share a common embryological origin and many common regulatory factors, we predicted that FoxM1 would be involved in pancreatic endocrine and exocrine proliferation. We hypothesized that loss of Foxm1 might result in pancreatic hypoplasia and that ß-cells might be more severely affected based on the sensitivity of these cells to loss of other cell cycle regulators. To assay the requirement for Foxm1 in pancreas outgrowth and differentiation, Cre-lox technology was used to inactivate floxed alleles of Foxm1 in a pancreas-specific manner (Foxm1{Delta}panc). Loss of Foxm1 early in pancreatic bud formation did not result in a lethal pancreatic phenotype. Foxm1{Delta}panc animals were born with normal pancreatic mass and the appropriate number of ß-cells; however, Foxm1{Delta}panc mice showed a progressive decline in ß-cell mass after birth that correlated with the onset of diabetes. These abnormalities are most likely due to decreased ß-cell proliferation and increased necrosis. Our study suggests that FoxM1 is a critical regulator of postnatal ß-cell mass and that proliferation of embryonic ß-cells uses mechanisms distinct from FoxM1.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
FoxM1 Is Expressed in Developing Endocrine Pancreas
Although Foxm1 mRNA had previously been detected in the pancreas at E16.0 (16), a complete analysis of FoxM1 expression during pancreatic development, and development of the islets in particular, had not yet been performed. We used an antibody generated against the N-terminal 138 amino acids of FoxM1 (26) to determine when and where FoxM1 protein is expressed during pancreas development and in the adult. We began our analyses at E15.5 during the secondary transition, because the endocrine cells formed during and after this time contribute to the mature islets (27). FoxM1 protein was detected at high levels in endocrine clusters as early as E15.5 (Fig. 1AGo), and continued to be expressed through late gestation (Fig. 1BGo) and postnatal islet formation (data not shown). In adult islets, FoxM1 was highly expressed in subpopulations of endocrine cells (Fig. 1CGo). Thus, FoxM1 is expressed in endocrine cells as their population expands during the second wave of endocrine development (E15.5 and E18.5), and during the period when endocrine proliferation is highest (early postnatal stages). Decreased islet expression of FoxM1 occurred with age, but FoxM1-expressing endocrine cells were still detected out to 9 wk of age. Low levels of FoxM1 were observed in developing exocrine cells and in some lobes of adult acinar tissue (data not shown). This expression pattern in acinar cells correlates with the pattern of 5-bromo-2'-deoxyuridine (BrdU) incorporation previously observed in adult pancreas (4). FoxM1 protein was also detected in scattered ductal cells at E18.5 (Fig. 1BGo, arrow).


Figure 1
View larger version (41K):
[in this window]
[in a new window]
  		Fig. 1. Expression of FoxM1 in Pancreas

FoxM1 protein is highly expressed in endocrine cells of developing islets at E15.5 (A) and E18.5 (B). Expression is detected in subpopulations of endocrine cells in adult islets (C, dotted lines). Occasionally, ductal cells were observed expressing FoxM1 (B, arrow). The arrowheads in A point to endocrine clusters. a, Acinar tissue. Scale bars, 100 µm.

 
Pdx1-Cre Mediates Early, Pancreas-Specific Deletion of a Floxed Foxm1 Allele
To remove Foxm1 specifically from the developing pancreas, Foxm1fl/fl mice were crossed with transgenic mice in which Cre recombinase is driven by 4.3 kb of promoter/enhancer sequence from the pdx1 gene (28). This promoter/enhancer fragment drives expression of a lacZ reporter transgene to the endogenous pdx1 domain, i.e. throughout the pancreatic buds as early as E9.5 and later becoming restricted mainly to ß-cells, with lower levels present in acinar cells (29, 30). Thus, pdx1-Cre should be expressed throughout the pdx1 domain beginning early in pancreas development. To assess Cre activity from the pdx1-Cre transgene, pdx1-Cre transgenic mice were crossed with R26R mice in which lacZ expression is dependent on Cre-mediated excision of an upstream stop codon (31). As expected, Cre-mediated R26R recombination (and thus ß-gal activity) was observed in pdx1-Cre; R26R mice throughout the pancreatic buds at E9.5 and E11.5 (supplemental Fig. 1A, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org) (data not shown), and in all pancreatic cell types (ducts, endocrine, and exocrine) at postnatal day 1 (P1) (supplemental Fig. 1, B and C). At P1, we also observed ß-gal activity in antral stomach and rostral duodenum, in agreement with endogenous pdx1 expression.

Cre-mediated recombination of the floxed Foxm1 allele can be assayed by using specific primers that amplify a 510-bp genomic DNA PCR product only from the deleted allele. Using this method, we were able to detect Foxm1fl/fl recombination as early as E15.5 (Fig. 2CGo). At this age, the recombined allele represents approximately 75% (based on densitometry measurements not shown) of the total Foxm1 DNA in the pancreas. It should be kept in mind, however, that the floxed Foxm1 allele will not be recombined in cell types within the pancreas that never express pdx1, e.g. endothelial cells and mesenchymal cells. Thus, the percentage of endodermally derived, pdx1-expressing cells within the pancreas that have undergone recombination and are mutant for Foxm1 is likely to be higher than 75%. Additionally, we assessed for loss of FoxM1 protein in Foxm1fl/fl;pdx1-Cre animals (Fig. 3Go). Immunohistochemistry at E15.5 revealed a dramatic decrease in FoxM1 protein in mutant pancreata compared with control animals (Fig. 3Go, compare D with B), whereas expression in the liver of Foxm1fl/fl;pdx1-Cre animals remained normal (Fig. 3CGo). Taken together, these results demonstrate that recombination of Foxm1 is restricted to pdx1-expressing cells, occurs before E15.5, and occurs in the majority of pancreatic cells.


Figure 2
View larger version (32K):
[in this window]
[in a new window]
  		Fig. 2. Detection of Floxed and Recombined Foxm1 Alleles

The structure of the floxed Foxm1 allele is shown in A. Pdx1-Cre-mediated recombination results in the deletion of exons 4–7, generating a null allele. B, PCR amplification of the region surrounding the upstream loxP site using primers 1 and 2 allows for detection of the floxed allele in genomic tail DNA (230-bp band). C, PCR amplification of pancreatic genomic DNA using primers 1 and 3 allows for detection of a 510-bp band specific to the recombined allele.

 

Figure 3
View larger version (126K):
[in this window]
[in a new window]
  		Fig. 3. Loss of FoxM1 Protein in Pancreas at E15.5

Antibodies detect FoxM1 protein in nuclei of epithelial structures (acini, ducts, endocrine cells) as well as surrounding mesenchyme in wild-type pancreata at E15.5 (B), but only in mesenchyme of Foxm1fl/fl;pdx1-Cre animals at the same time point (D). In contrast, FoxM1 is highly expressed in hepatocyte nuclei of both wild-type (A) and mutant animals (C) at E15.5. Scale bars, 50 µm.

 
Foxm1{Delta}panc Mice Display Impaired Glucose Tolerance (IGT)
Foxm1{Delta}panc mice were born at the expected frequency and survived past weaning. Body weights were not different from control mice at 4, 6, and 9 wk, suggesting that Foxm1 is not required for gross pancreas development and that loss of Foxm1 does not severely impair pancreatic function, preventing normal growth.

We next decided to measure blood glucose levels in Foxm1{Delta}panc mice to determine whether loss of FoxM1 had an effect on mature islet ß-cell function. Intraperitoneal glucose tolerance tests (IPGTTs) were performed at 4, 6, and 9 wk. At 4 wk, the results from Foxm1{Delta}panc animals were indistinguishable from those of control mice (Fig. 4AGo). At 6 wk, however, 29% of Foxm1{Delta}panc male mice had developed IGT (Table 1Go; see Materials and Methods for criteria used), as indicated by the elevated blood glucose levels at 30, 60, 90, and 120 min (Fig. 4BGo). By 9 wk, 53% of Foxm1{Delta}panc male mice were glucose intolerant, whereas an additional 13% were diabetic (Table 1Go). The average 120-min glucose level was 260 mg/dl in Foxm1{Delta}panc male mice at 9 wk compared with 133.8 mg/dl in controls (Fig. 4CGo). Most of the animals that had developed diabetes by 9 wk of age, showed IGT at 6 wk. Thus, it appears that the phenotype is progressive with age. IPGTTs were also performed on female mice at all time points examined. Female Foxm1{Delta}panc mice even at 20 wk of age (four controls and four Foxm1{Delta}panc) exhibited a normal IPGTT despite a slight reduction in total pancreatic insulin content at 9 wk of age (data not shown). Most of the following studies were therefore performed using male mice, except where specifically indicated.


Figure 4
View larger version (26K):
[in this window]
[in a new window]
  		Fig. 4. IGT in Foxm1{Delta}panc Males

IPGTTs were performed on male mice at 4 (A), 6 (B), and 9 (C) wk of age. At 6 wk, some of the mice were glucose intolerant, whereas at 9 wk some of the mice had progressed to diabetes. Asterisks indicate time points at which blood glucose levels were significantly elevated in Foxm1{Delta}panc males compared with controls. *, P < 0.05; **, P < 0.01.

 

View this table:
[in this window]
[in a new window]
  		Table 1. Frequency of IGT in Foxm1{Delta}panc Mice

 
As an initial assessment of the effect of loss of Foxm1 on pancreatic growth, we measured pancreatic wet weight. There were no differences in whole pancreatic wet weight between control and Foxm1{Delta}panc animals at 4 or 6 wk. At 9 wk, however, whole pancreatic wet weights in Foxm1{Delta}panc mice (198.88 ± 40.88 mg; n = 17) were slightly but significantly lower than control mice (233.51 ± 47.49 mg; n = 16). Thus, loss of Foxm1 results in a smaller pancreas in males as the animals age.

Endocrine and Exocrine Architecture Are Abnormal in Foxm1{Delta}panc Mice
To determine the cause of the glucose intolerance and diabetes in Foxm1{Delta}panc mice, we began by examining the islets at P1, and 4, 6, and 9 wk of age, assaying for both insulin and glucagon expression by immunofluorescence. At P1, and 4 and 6 wk of age, mutant islets showed a normal architecture and were indistinguishable from controls (Fig. 5Go). In some mutant islets from 6-wk-old mice with IGT, several insulin-producing cells labeled weakly for the hormone and were slightly irregular in shape (Fig. 5FGo). At 9 wk of age, diabetic Foxm1{Delta}panc mutant pancreata showed a dramatic alteration in islet architecture and insulin and glucagon expression (Fig. 5HGo). The number of insulin-producing cells was significantly decreased, there was an apparent increase in {alpha}-cells, and these were scattered throughout the islets rather than located at the periphery. Histological analyses on serial sections suggest that there is not an actual increase in the number of glucagon-producing cells but that the islets themselves have collapsed (data not shown). This conclusion is further supported by a lack of increase in total pancreatic glucagon content in mutant pancreata (data not shown). In addition, islets from animals with IGT or diabetes showed an increase in intra-islet keratin-positive cells, suggesting that mutant islets contain cells with a ductal phenotype (data not shown). This phenotype was not observed in control islets at the same age.


Figure 5
View larger version (26K):
[in this window]
[in a new window]
  		Fig. 5. Foxm1{Delta}panc Islets Show Fewer Insulin-Producing Cells with Age

Insulin (green) and glucagon (red) expression appear normal in Foxm1{Delta}panc islets at P1 (A and B) and 4 wk (C and D), compared with controls. At 6 wk, some islets in Foxm1{Delta}panc animals (F) show patchy insulin expression (arrow) not seen in controls (E). At 9 wk, islets in Foxm1{Delta}panc diabetic animals show a dramatic loss of insulin expression (H) compared with control islets (G). In addition, glucagon-expressing cells are scattered throughout the islet. Scale bars, 50 µm.

 
Because pdx-Cre is expected to mediate pancreas-wide inactivation of Foxm1, we also examined whether there were defects in exocrine tissue. Hematoxylin and eosin (H&E) staining of whole pancreas sections revealed that in some glucose intolerant Foxm1{Delta}panc animals at 6 wk, the exocrine nuclei were enlarged, and the islets looked smaller (data not shown). In 9-wk-old diabetic Foxm1{Delta}panc pancreata, there were cysts present in the exocrine tissue (Fig. 6Go, B, D, and E). Oil red O staining for these cysts was negative (data not shown), suggesting these cysts were not accumulations of adipose tissue. The orientation of the exocrine cells was highly irregular, and the nuclei of these disorganized exocrine cells were clearly enlarged, suggesting polyploidy (Fig. 6EGo). These results are consistent with the phenotype of cardiomyocytes and hepatocytes in the Foxm1 global knockout (18, 25). H&E staining also revealed many acellular areas in islets from diabetic Foxm1{Delta}panc pancreata (Fig. 6DGo), indicating that loss of insulin reactivity (Fig. 5HGo) was due to an actual loss of cells, rather than simply loss of insulin gene expression.


Figure 6
View larger version (109K):
[in this window]
[in a new window]
  		Fig. 6. Histological Analysis of Foxm1{Delta}panc Pancreata

Compared with control pancreata at 9 wk of age (A and C), Foxm1{Delta}panc pancreata (B, D, and E) show disrupted acinar organization, the presence of multiple cystic structures (asterisks), enlarged cells with polyploid nuclei (E, arrow), binucleate cells, and loss of cellular integrity. In addition, islets have large acellular spaces containing macrophages (D, arrowheads). Neither acellular regions nor macrophages were detected in control islets (C). Scale bars, 50 µm.

 
Total Pancreatic Insulin Content Is Decreased in Foxm1{Delta}panc Mice
Based on immunofluorescence, pancreata from Foxm1{Delta}panc male mice appeared to display a gradual loss of insulin-producing cells. As an independent assay for insulin expression, total pancreatic insulin content was measured in control and Foxm1{Delta}panc mice. There was no difference in total insulin content at P1 and 4 wk between control and Foxm1{Delta}panc mice. Foxm1{Delta}panc male mice did show a significant decrease in total insulin content at both 6 and 9 wk (Fig. 7AGo). In control mice, the total insulin content continually increased from P1 to 9 wk. In contrast, in Foxm1{Delta}panc mice, pancreatic insulin content increased between P1 and 4 wk, after which insulin content remained the same or slightly decreased. At 9 wk, the total pancreatic insulin content of Foxm1{Delta}panc mice was only 30% of control mice. When normalized for pancreatic wet weight, the total insulin content was lower in 6-wk-old Foxm1{Delta}panc mice, but the difference was no longer statistically significant (P = 0.18). At 9 wk, normalized insulin content in Foxm1{Delta}panc mice was significantly lower than control mice (Fig. 7BGo). Interestingly, Foxm1{Delta}panc females also tended toward a decrease in total pancreatic insulin content at 9 wk (5.9 ± 2.0 µg, n = 4 vs. 7.3 ± 2.2 µg in controls, n = 4), although this difference was not statistically significant (P = 0.36).


Figure 7
View larger version (33K):
[in this window]
[in a new window]
  		Fig. 7. Decreased ß-Cell Mass in Foxm1{Delta}panc Pancreata Is Due to Decreased Proliferation

Insulin protein was extracted from whole pancreata at P1, and 4, 6, and 9 wk and measured using radioimmunoassay. Raw data are shown in A and corrected for pancreas weight in B. Foxm1{Delta}panc animals showed decreased total insulin content at 6 and 9 wk. Morphometric analysis revealed that ß-cell mass in Foxm1{Delta}panc animals is already significantly lower than controls at 4 wk (C) and that Foxm1{Delta}panc animals had a significant reduction in islet size at 6 and 9 wk (D). BrdU labeling of control and Foxm1{Delta}panc pancreata revealed a dramatic decrease in ß-cell proliferation at 4, 6, and 9 wk (E). *, P < 0.05

 
Foxm1{Delta}panc Mice Have Decreased ß-Cell Mass and Islet Size, and Abnormal ß-Cell Size
A decrease in total insulin content can result from a decrease in absolute ß-cell number or a decrease in insulin content per ß-cell without a decrease in cell number. To determine the cause of the decreased pancreatic insulin content in Foxm1{Delta}panc animals, we measured the mean cross-sectional area of pancreatic tissue positive for insulin immunoreactivity as an indicator of ß-cell mass. There was no difference in ß-cell mass at P1 between control and Foxm1{Delta}panc mice (Fig. 7CGo). Despite the fact that there is no obvious impairment in glucose homeostasis at 4 wk, there was already a significant difference in ß-cell mass at this age. ß-Cell mass was also significantly lower in Foxm1{Delta}panc mice at 6 and 9 wk, compared with controls. Similar to what was observed for total insulin content, ß-cell mass increased continually from P1 to 9 wk in control mice, whereas in Foxm1{Delta}panc mice, ß-cell mass increased only between P1 and 4 wk, and thereafter remained the same, or slightly decreased. At 9 wk, the ß-cell mass of Foxm1{Delta}panc male mice was only about 30% of that in controls. Foxm1{Delta}panc female mice showed an approximate 20% decrease in ß-cell mass at 9 wk (data not shown).

A decrease in ß-cell mass can result from a decrease in islet number or a decrease in islet size, or both. Islet size is normal at birth in Foxm1{Delta}panc mice (Fig. 7DGo). At 4 wk, islet size tended to be smaller in mutant animals, but the average islet size was not statistically different from controls. At 9 wk, the average islet size in both male and female Foxm1{Delta}panc mice was significantly smaller than the control mice, and was similar to the average islet size at 4 wk.

Average ß-cell size was also analyzed to determine whether ß-cells in Foxm1{Delta}panc islets underwent hypertrophy to compensate for ß-cell loss. There was no difference in average ß-cell size at P1, 4, 6, or 9 wk between control and Foxm1{Delta}panc mice (data not shown). At 9 wk, however, although the average ß-cell size per pancreas was essentially the same in control (88.16 nm2) and Foxm1{Delta}panc diabetic mice (89.83 nm2), average ß-cell size per islet in the Foxm1{Delta}panc mice was quite variable (supplemental Fig. 2) compared with controls. Thus, some islets were mainly composed of ß-cells that were much larger than the average (>140 µm2), whereas others were composed mainly of ß-cells less than 60 µm2. These observations suggest that in diabetic Foxm1{Delta}panc mice some ß-cells were undergoing hypertrophy whereas others were dying, and could explain the decrease in total pancreatic insulin content described above. These results are consistent with the phenotype of cardiomyocytes and hepatocytes in the Foxm1 global knockout (18, 25) and in the conditional hepatocyte-specific deletion of Foxm1 in regenerating liver and hepatic cancer (19, 32).

Foxm1{Delta}panc Mice Have a Dramatic Decrease in ß-Cell Proliferation
The failure of several parameters of functional ß-cell mass to increase beyond 4 wk of age in Foxm1 mutant pancreata could be due to decreased postnatal ß-cell proliferation and/or increased ß-cell death. To examine ß-cell proliferation, BrdU was injected 6 h before mice were killed (avoiding the inclusion of daughter cells in our analysis). BrdU is incorporated into newly synthesized DNA and therefore labels only replicating cells. There were significantly fewer proliferating ß-cells in the Foxm1{Delta}panc mice at 4, 6, and 9 wk compared with controls (Fig. 7EGo). BrdU-labeled ß-cells were observed in Foxm1{Delta}panc pancreata, however, indicating that there was not a complete cessation of proliferation in these animals.

To address the mechanism for decreased ß-cell proliferation in Foxm1{Delta}panc pancreata, we examined the expression of the CDKI, p27Kip1. For progression into S phase, Foxm1 was shown to be essential for diminishing nuclear accumulation of the CDKI proteins p21Cip1 and p27Kip1 (23, 24). Consistent with these studies, FoxM1 is required for transcription of the specificity subunit proteins S-phase kinase-associated protein 2 (Skp2) and CDK subunit 1 (Cks1) of the Skp1-Cullin1-F-box (SCF) ubiquitin ligase complex (21), which targets the CDKI proteins for degradation during the G1/S transition (33, 34). In the absence of Foxm1, therefore, p27 would be expected to localize to nuclei, thus inhibiting cell cycle progression. Indeed, we observed a dramatic increase in nuclear p27 at P1 and 4 wk in Foxm1{Delta}panc islets compared with controls (Fig. 8Go and data not shown).


Figure 8
View larger version (108K):
[in this window]
[in a new window]
  		Fig. 8. Loss of Foxm1 Results in Increased Nuclear p27Kip1 and SA-ß-Gal Activity

Control islets show very few p27Kip1-positive nuclei at P1 (A). In contrast, most islet nuclei contain p27Kip1 in the Foxm1{Delta}panc pancreata at P1 (B). Control pancreata showed no obvious SA-ß-Gal activity (C). Pancreata from Foxm1{Delta}panc animals exhibited a great increase in ß-Gal activity in many acinar cells (D) and scattered islet ß-cells (F). E is the same islet as in F, stained with insulin. Scale bars, 50 µm.

 
TUNEL assay and immunohistochemistry for cleaved caspase 3 failed to detect an increase in ß-cell apoptosis in Foxm1{Delta}panc mice at any time point (data not shown). In exocrine tissue from diabetic Foxm1{Delta}panc animals, many cells were clearly enlarged, undergoing lysis and losing membrane integrity, all signs of cellular necrosis (see Fig. 6Go). The cysts observed in mutant pancreata are thus most likely the final outcome of necrotic cell death. The acellular areas within Foxm1{Delta}panc islets were often observed to contain macrophages (see Fig. 6DGo), suggesting scavenging of cellular debris after cell lysis.

Because increased expression of p27Kip1 has been associated with increased cellular senescence (35), we performed X-gal staining to assay for the presence of senescence-associated ß-galactosidase (SA-ß-Gal) activity (36). Whole-mount staining of pancreata from 9-wk-old control animals showed no obvious ß-Gal activity (data not shown). In contrast, pancreata from Foxm1{Delta}panc animals exhibited a great increase in ß-Gal activity (data not shown), a finding consistent with premature senescence of early passage Foxm1–/– mouse embryo fibroblasts (21). Sectioning of mutant pancreata revealed that SA-ß-Gal was present in many acinar cells and scattered islet endocrine cells (Fig. 8Go, D and F). Thus, we conclude that loss of Foxm1 and the associated increase in nuclear p27Kip1 leads to exit from the cell cycle and senescence. Ultimately, senescent cells die via necrosis and are scavenged by macrophages.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
The current study shows that pancreas-wide deletion of Foxm1 results in IGT and ultimately diabetes. The variability in the severity of the phenotype might be due to partial compensation for loss of Foxm1 by another as-yet-unidentified factor, or alternatively, the mixed genetic background of these mice. Regardless of the degree to which glucose tolerance was ultimately impaired, loss of Foxm1 in the pancreas during embryogenesis results in a dramatic decline in postnatal ß-cell mass, pancreatic insulin content, and ß-cell proliferation by 4 wk of age. Our results revealed a significant difference in ß-cell mass in mutant pancreata as early as 4 wk, despite the fact that there is no obvious impairment in glucose homeostasis at this age. Although pancreas-wide inactivation of Foxm1 occurs during embryogenesis, mutant animals show no alterations in the generation of appropriate exocrine or endocrine cell mass during development. ß-Cell mass at birth was normal in the Foxm1{Delta}panc mice, seemed to reach a maximum in mutant animals at 4 wk, and declined thereafter. In control animals, ß-cell mass continued to expand as animals aged. These results suggest that deletion of Foxm1 from the pancreas early in development results in a gradual loss of ß-cell mass specifically in adulthood. Thus, we propose that Foxm1 is required during normal ß-cell turnover to maintain ß-cell mass in the adult.

ß-Cell mass changes throughout the life of the organism in response to metabolic alterations and demands. Increases in ß-cell mass are thought to occur via replication of existing ß-cells, individual ß-cell hypertrophy, and ß-cell neogenesis from stem cell progenitors. The number of ß-cells present at any given time is determined by the balance of newly forming ß-cells (via replication and neogenesis), and ß-cell loss through apoptosis. It is estimated that there are 1–4% proliferating ß-cells per day (4). Thus, in the absence of apoptosis, the ß-cell number would double in about a month. After 3 months, the normal turnover of ß-cells approaches the replication rate, preventing a continued doubling of ß-cell mass. Thus, the endocrine pancreas should be considered a slowly renewing tissue whose ability to undergo cell division decreases with age.

Autopsies of human patients reveal a 40% increase in ß-cell mass in obese individuals suggesting that ß-cell compensation does indeed occur with increasing insulin resistance (5). Defects in ß-cell mass compensation in all probability contribute to type 2 diabetes, but trying to identify the complex array of genes affecting this process is likely to be difficult. Although there has been much research on genes involved in pancreas development and islet differentiation (37, 38), little is known about the genes that affect endocrine proliferation and regeneration, or the maintenance of islet mass. Any gene product that affects the renewal, proliferation, or turnover of ß-cells would be a candidate for genes involved in the etiology of diabetes (39). This is underscored by the recent findings that global inactivation of two different cell cycle regulators, cdk4 and cyclin D2, results in a gradual decrease in ß-cell mass and subsequent diabetes after birth (8, 9, 10, 40, 41). Here, we provide evidence that FoxM1 plays a similar role.

A role for Foxm1 in cell cycle progression is supported by the following: FoxM1 is a direct transcriptional activator of cdc2, cdc25B, and cyclin B1 (19, 42, 43), transgenic expression of FoxM1 in the liver up-regulates genes involved in cell cycle progression and DNA repair (26), and FoxM1 expression prevents the nuclear localization of the Cdk inhibitor, p27Kip1 (23, 24). FoxM1 also directly activates expression of genes involved in mitosis and cytokinesis such as CENP-A, Polo-like kinase (Plk-1), and Aurora B kinase (18, 21, 22). The fact that FoxM1 is expressed broadly during embryogenesis, but only in proliferating cell populations in the adult, suggests that it is involved in cell cycle regulation rather than in promoting differentiation of a particular cell type. Interestingly, not all organs show general defects in mitosis and growth in the absence of Foxm1, and Foxm1–/– embryos themselves look surprisingly normal considering the loss of a key cell cycle regulator. The liver and heart seem to be most affected in Foxm1–/– embryos. Both of these organs show a high degree of polyploidy; there are 75% fewer hepatocytes in mutant animals, and intrahepatic bile ducts do not form (18, 25). In the lung, proliferation of the endodermally derived epithelium is normal; however, there is a significant decrease in mesenchymal cell proliferation and vasculature fails to develop in the distal part of the lung (20). Thus, Foxm1 seems to have specific, nonredundant functions in certain tissue/cell types.

Our analysis shows that FoxM1 is highly expressed in endocrine cells as their population expands during the second wave of endocrine development (E15.5–E18.5) and during the period when endocrine proliferation is highest (early postnatal stages). Although expression within islets decreases as animals age, a significant number of FoxM1+ endocrine cells could still be detected at 9 wk of age. At this time point, only 1–4% of ß-cells are thought to be replicating, and thus the number of cells expressing FoxM1 exceeds the actual number of cells that are expected to be undergoing proliferation. This expression pattern is similar to that observed for cdk4 in the adult islet (41).

Although we cannot explain the sexual dimorphism of the Foxm1 mutant phenotype at the present time, this phenomenon has been observed in other rodent models of diabetes (44, 45, 46, 47) and has been linked to a protective effect of estrogen (48, 49), as well as the tendency for females in general to have increased glucose tolerance and a higher pancreatic insulin and glucagon content (50).

The present results suggest that Foxm1 is dispensable for endocrine progenitor and/or ß-cell proliferation during embryogenesis and that pathways or mechanisms for embryonic ß-cell replication (or neogenesis) may differ from those used in the adult. The recently described adult-onset diabetic phenotypes in global knockouts of cdk4 and cyclin D2 occurred with little to no effect on general growth and development (8, 9, 10, 40, 41). Indeed, similar to what we observe in our Foxm1 mutant pancreata, ß-cell mass is normal at birth in these knockout models. In addition, transgenic overexpression of the cell cycle inhibitor, p27Kip1 (whose activity and nuclear accumulation are directly inhibited by FoxM1), in ß-cells results in a phenotype strikingly similar to the phenotype we observed in our Foxm1{Delta}panc mice (11).

The combined evidence to date suggests that mature ß-cells are particularly sensitive to perturbations in cell cycle regulation. This may be due, in part, to the fact that ß-cells do not express cdk6, which is functionally redundant with cdk4 in most other cell types (41). Likewise, ß-cells express high levels of cyclin D2 and much less of the other D cyclins, which are functionally redundant with each other (8, 9).

Although in normal adults, new insulin+ cells are thought to arise mainly from existing ß-cells (51), neogenesis from pancreatic stem cells has been reported to occur in several models of pancreas regeneration including ß-cell destruction using chemical toxins (52, 53), induction of pancreatitis (54, 55, 56), cellophane wrapping (57), partial pancreatectomy (58, 59), and targeting of inflammatory cytokines to the ß-cell (60). The mammalian pancreas has significant regenerative capacity after insult or injury, although not to the same extent as the liver (55, 61). Foxm1 is essential for generating the appropriate number of hepatocytes during liver development and hepatocyte mitosis during liver regeneration. Thus, Foxm1 is a strong candidate for a gene that may be involved in pancreatic endocrine and exocrine proliferation and regeneration in models of pancreatic or islet injury, including diabetes. Decreased FoxM1 activity could result in a person’s inability to expand ß-cell mass during time of increased metabolic demand (weight gain, pregnancy), predisposing them to type 2 diabetes, whereas increasing Foxm1 activity could potentiate ß-cell regeneration in type 1 diabetes.

Based on our results, we predict that FoxM1 is a critical regulator of ß-cell proliferation and maintenance of ß-cell mass. Because diabetes results from an absolute (type 1) or relative (type 2) inadequate functional ß-cell mass, genes and pathways involved in maintaining or altering ß-cell mass are candidates for being affected in diabetic individuals. Functional analysis of these genes may lead to new therapeutic strategies for increasing existing ß-cell mass in diabetic patients and/or facilitate the production of ß-cells in vitro from embryonic or stem cells.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Generation of Mice with Pancreas-Specific Foxm1 Deletion
Foxm1fl/fl mice were described previously (19). Upon exposure to Cre recombinase, exons 4 through 7 containing the DNA binding domain and the transcriptional activation domain, as well as the positive selection cassette, are excised generating a null allele (Fig. 2AGo). All mouse studies were performed in accordance with the Vanderbilt Institutional Animal Care and Use Committee guidelines under the supervision of the Division of Animal Care.

Genotyping of Foxm1fl/fl mice was by PCR amplification using primers flanking the loxP site with intron 3 [5' primer, TAGGAGATACACTGTTATAT (primer 1); 3' primer, TGTGGGAAAATGCTTACAAAAG (primer 2)]. These primers amplify a 180-bp band in the endogenous allele and a 230-bp band in the floxed allele (Fig. 2BGo).

Pancreas-specific recombination of the Foxm1fl/fl allele was accomplished using pdx1-Cre mice (28). Pdx1-Cre is driven by 4.3 kb of promoter/enhancer sequence from the pdx1 gene (a gift from Dr. Guoqiang Gu, Vanderbilt University, Nashville, TN). This promoter/enhancer fragment has been shown to drive expression of a lacZ reporter transgene to the endogenous pdx1 domain, i.e. throughout the pancreatic buds as early as E10.5 and later becoming restricted mainly to ß-cells, with lower levels present in acinar cells (29, 30).

The recombined Foxm1 null allele was detected by PCR: primer 1, 5'-TAGGAGATACACTGTTATAT-3', and primer 3, 5'-CTCATGTAGCATAGAGGGCTG-3' (see Fig. 2CGo). Recombination results in production of a 510-bp PCR product. The pdx1-Cre transgene was identified by PCR using primers for Cre (5' primer, ACCTGAAGATGTTCGCGATTATCT; 3' primer, ACCGTCAGTACGTGAGATATCTT). Foxm1fl/fl;pdx1-Cre bigenic mice will be referred to as Foxm1{Delta}panc, because they are expected to have a pancreas-wide deletion of Foxm1.

IPGTT
After a 16-h fast, baseline blood glucose levels (in milligrams per deciliter) were measured in tail vein blood from mice using a FreeStyle glucometer. Glucose (2 g dextrose/kg body weight) in sterile PBS was injected ip and blood glucose was measured 15, 30, 60, 90, and 120 min after injection. IPGTTs were performed at 4, 6, and 9 wk after birth. Controls for these studies included Foxm1fl/+ and Foxm1fl/fl mice. Mice with a normal fasting glucose (<140 mg/dl) and 120-min glucose level of ≥200 mg/dl were considered to have IGT. Mice with fasting glucose levels of ≥140 mg/dl and at 120 min of ≥200 mg/dl were considered diabetic.

X-Gal Staining, Histology, and Immunolabeling
Pancreata or digestive organs were dissected in cold PBS and fixed immediately in ice-cold 4% paraformaldehyde at 4 C for 45 min (P1) or 2 h (adult). For X-gal staining, after fixation, tissues were washed twice for 30 min in permeabilization solution (62). X-gal staining was performed overnight (12–16 h) at room temperature and tissues were postfixed (4% paraformadehyde in PBS; 1 h at 4 C). Tissues were dehydrated, embedded in paraffin, and sectioned at 5 µm. Sections were deparrafinized using xylene, or CitriSolv (Fisher, Hampton, NH) for previously X-gal-stained tissues, and rehydrated in a decreasing ethanol series to distilled water. SA-ß-Gal was detected by X-gal staining (pH 6.0) overnight at 4 C.

Primary antibodies were used at the following dilutions: guinea pig antibovine insulin (Linco, St. Charles, MO), 1:1000; rabbit antiglucagon (Linco), 1:1000; rat anti-BrdU (Accurate Chemical & Scientific, Westbury, NY), 1:400; mouse anti-Kip1/p27 (catalog no. 610241; BD Biosciences, San Jose, CA), 1:100; and rabbit antikeratin (DakoCytomation, Carpinteria, CA), 1:5000. All primary antibody incubations were overnight in a humid chamber at 4 C. Detection of keratin required proteinase-K (DakoCytomation) (diluted 1:20) antigen retrieval for 5 min. Detection of FoxM1 protein was performed as described (26). For BrdU detection, slides were treated with 0.2 N HCl for 20 min at 37 C, neutralized in sodium borate buffer for 1 min at room temperature, and treated with 0.005 mg/ml trypsin (Sigma-Aldrich, St. Louis, MO) and 0.005 mg/ml CaCl2 (in Tris buffer; pH 7.5) for 3 min at 37 C. Detection of insulin or keratin was carried out using the AEC kit (Zymed Laboratories, San Francisco, CA). Some slides were H&E (Sigma-Aldrich) stained. For immunofluorescence, donkey anti-guinea pig CY2 (insulin), donkey antirabbit CY3 (glucagon), and donkey antirat CY3 (BrdU) were used as secondary antibodies at a 1:500 dilution. The mounting medium contained 1.5 µg/ml nuclear fluorogen 4',6'-diamidino-2-phenylindole (DAPI) (Molecular Probes, Eugene, OR).

Oil red O staining was performed on frozen sections as described previously (63). Tissues were fixed as above, incubated in 30% sucrose overnight at 4 C, embedded in optimum cutting temperature compound (VWR Scientific, West Chester, PA), and 5-µm sections were cut on a Leica (Nussloch, Germany) CM 3050 S cryostat.

Samples were viewed under bright-field illumination or appropriate optical filters (immunofluorescence) using an Olympus (Tokyo, Japan) BX41 microscope and digital camera with the Magnafire program (Optronics, Chelmsford, MA). Whole-mount X-gal-stained samples were viewed using an Olympus SZX9 dissecting microscope and photographed using a Nikon (Melville, NY) 4300 digital camera. TIFF images from each experiment were processed equivalently in Adobe Photoshop.

Measurement of Total Pancreatic Insulin Content
The dissected pancreata were quickly rinsed in ice-cold PBS, blotted with filter paper, weighed, and homogenized (Polytron PT 10/35; Brinkmann Instruments, Westbury, NY) in 1 ml of acid alcohol (64). The homogenate was extracted with an additional 5 ml of acid alcohol for 48 h at 4 C and centrifuged at 2500 rpm for 30 min. The supernatant was stored at –20 C until it was assayed for insulin by radioimmunoassay (64).

ß-Cell Mass and Average Islet Size Analysis
Entire pancreata were rapidly removed from the mice, nonpancreatic tissues were removed, and pancreata were weighed and fixed as described above. Five-micrometer longitudinal sections (5) were prepared for insulin immunoperoxidase labeling. Every 30th section (an average of 8–13 sections per pancreas) was used in the analysis of ß-cell mass. Images of anti-insulin-labeled sections were taken under x40 magnification as described above. Using Metamorph software (Molecular Devices, Downingtown, PA), ß-cell mass was measured by first obtaining the fraction of the cross-sectional area of pancreatic tissue positive for insulin staining and then multiplying this by the pancreatic weight. At least four control and four Foxm1{Delta}panc mice were measured for ß-cell mass at each time point (4, 6, and 9 wk).

The same slides were used to measure average islet size. Using Metamorph software, average islet size was obtained by dividing the number of islets by the total islet area.

ß-Cell Replication Measurement
BrdU (100 mg/kg; Sigma-Aldrich) was injected ip 6 h before harvesting the pancreata. Pancreata were isolated and processed for histology as described above. BrdU-labeled ß-cells were detected by triple immunolabeling with BrdU and insulin antibodies, and DAPI. Using Metamorph software, all BrdU-positive (red nuclei overlapping with DAPI) and negative (only blue DAPI nuclei) nuclei in insulin-positive (green cytoplasm) cells were counted at x400 magnification. At least two sections and over 2500 ß-cells were counted for each of three control and three Foxm1{Delta}panc mice at 4, 6, and 9 wk. The proportion of BrdU-positive ß-cell nuclei to total ß-cell nuclei was calculated and represents the percentage of ß-cells undergoing replication.

ß-Cell Size Determination
The same slides used for BrdU incorporation were used for measurement of average ß-cell size. Metamorph software was used to measure insulin-positive area of each islet. Average ß-cell size was obtained by dividing the insulin-positive area by the number of DAPI-stained nuclei in this area.

Apoptosis Assay
Apoptosis was detected by the DeadEnd colorimetric TUNEL system (Promega, Madison, WI) in 5-µm paraffin-embedded sections according to the manufacturer’s instructions. At least two slides each from three controls and three Foxm1{Delta}panc pancreata at 4, 6, and 9 wk were examined. Apoptosis was also assessed morphologically (condensed apoptotic body) by H&E staining.

Statistical Analysis
All data were expressed as mean ± SE. Statistical significance was calculated using a Student’s t test. A value of P ≤ 0.05 was considered significant.


   ACKNOWLEDGMENTS
 
We thank the members of the Gannon lab for their helpful discussions and critical reading of the manuscript. We thank Venus Childress and Angela Slater for their expert technical assistance.


   FOOTNOTES
 
This work was supported by a grant from National Institutes of Health/National Institute of Diabetes and Digestive and Kidney Diseases [R56 (DK071052-01) to M.G., R01 (DK54687-07) to R.H.C., and U24 (DK59637) to The Vanderbilt University Mouse Metabolic Phenotyping Center/Diabetes Research and Training Center Hormone Assay and Analytical Services Core (Wanda L. Snead, Manager)].

H.Z., A.M.A., G.A.G., D.L., X.F., U.G.K., R.H.C., and M.G. have nothing to declare.

First Published Online March 23, 2006

Abbreviations: BrdU, 5-Bromo-2'-deoxyuridine; CDK, cyclin-dependent kinase; CDKI, cyclin-dependent kinase inhibitor; DAPI, 4',6'-diamidino-2-phenylindole; E14.5, embryonic d 14.5; H&E, hematoxylin and eosin; IGT, impaired glucose tolerance; IPGTT, intraperitoneal glucose tolerance test; P1, postnatal d 1; SA-ß-Gal, senescence-associated ß-galactosidase.

Received for publication February 1, 2006. Accepted for publication March 15, 2006.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Bonner-Weir S 2000 Life and death of the pancreatic ß cells. Trends Endocrinol Metab 11:375–378[CrossRef][Medline]
  2. Bonner-Weir S 2000 Perspective: postnatal pancreatic ß cell growth. Endocrinology 141:1926–1929[Free Full Text]
  3. Scaglia L, Cahill CJ, Finegood DT, Bonner-Weir S 1997 Apoptosis participates in the remodeling of the endocrine pancreas in the neonatal rat. Endocrinology 138:1736–1741[Abstract/Free Full Text]
  4. Finegood DT, Scaglia L, Bonner-Weir S 1995 Dynamics of ß-cell mass in the growing rat pancreas. Estimation with a simple mathematical model. Diabetes 44:249–256[Abstract]
  5. Butler AE, Janson J, Bonner-Weir S, Ritzel R, Rizza RA, Butler PC 2003 ß-Cell deficit and increased ß-cell apoptosis in humans with type 2 diabetes. Diabetes 52:102–110[Abstract/Free Full Text]
  6. Parsons JA, Brelje TC, Sorenson RL 1992 Adaptation of islets of Langerhans to pregnancy: increased islet cell proliferation and insulin secretion correlates with the onset of placental lactogen secretion. Endocrinology 130:1459–1466[Abstract/Free Full Text]
  7. Scaglia L, Smith FE, Bonner-Weir S 1995 Apoptosis contributes to the involution of ß-cell mass in the post partum rat pancreas. Endocrinology 136:5461–5468[Abstract]
  8. Georgia S, Bhushan A 2004 ß Cell replication is the primary mechanism for maintaining postnatal ß cell mass. J Clin Invest 114:963–968[CrossRef][Medline]
  9. Kushner JA, Ciemerych MA, Sicinska E, Wartschow LM, Teta M, Long SY, Sicinski P, White MF 2005 Cyclins D2 and D1 are essential for postnatal pancreatic ß-cell growth. Mol Cell Biol 25:3752–3762[Abstract/Free Full Text]
  10. Mettus RV, Rane SG 2003 Characterization of the abnormal pancreatic development, reduced growth and infertility in Cdk4 mutant mice. Oncogene 22:8413–8421[CrossRef][Medline]
  11. Uchida T, Nakamura T, Hashimoto N, Matsuda T, Kotani K, Sakaue H, Kido Y, Hayashi Y, Nakayama KI, White MF, Kasuga M 2005 Deletion of Cdkn1b ameliorates hyperglycemia by maintaining compensatory hyperinsulinemia in diabetic mice. Nat Med 11:175–182[CrossRef][Medline]
  12. Kaestner KH, Knochel W, Martinez DE 2000 Unified nomenclature for the winged helix/forkhead transcription factors. Genes Dev 14:142–146[Free Full Text]
  13. Westendorf JM, Rao PN, Gerace L 1994 Cloning of cDNAs for M-phase phosphoproteins recognized by the MPM2 monoclonal antibody and determination of the phosphorylated epitope. Proc Natl Acad Sci USA 91:714–718[Abstract/Free Full Text]
  14. Korver W, Roose J, Wilson A, Clevers H 1997 The winged-helix transcription factor Trident is expressed in actively dividing lymphocytes. Immunobiology 198:157–161[Medline]
  15. Yao KM, Sha M, Lu Z, Wong GG 1997 Molecular analysis of a novel winged helix protein, WIN. Expression pattern, DNA binding property, and alternative splicing within the DNA binding domain. J Biol Chem 272:19827–19836[Abstract/Free Full Text]
  16. Ye H, Kelly TF, Samadani U, Lim L, Rubio S, Overdier DG, Roebuck KA, Costa RH 1997 Hepatocyte nuclear factor 3/fork head homolog 11 is expressed in proliferating epithelial and mesenchymal cells of embryonic and adult tissues. Mol Cell Biol 17:1626–1641[Abstract]
  17. Costa RH, Kalinichenko VV, Major ML, Raychaudhuri P 2005 New and unexpected: forkhead meets ARF. Curr Opin Genet Dev 15:42–48[CrossRef][Medline]
  18. Krupczak-Hollis K, Wang X, Kalinichenko VV, Gusarova GA, Wang IC, Dennewitz MB, Yoder HM, Kiyokawa H, Kaestner KH, Costa RH 2004 The mouse Forkhead Box m1 transcription factor is essential for hepatoblast mitosis and development of intrahepatic bile ducts and vessels during liver morphogenesis. Dev Biol 276:74–88[CrossRef][Medline]
  19. Wang X, Kiyokawa H, Dennewitz MB, Costa RH 2002 The Forkhead Box m1b transcription factor is essential for hepatocyte DNA replication and mitosis during mouse liver regeneration. Proc Natl Acad Sci USA 99:16881–16886[Abstract/Free Full Text]
  20. Kim IM, Ramakrishna S, Gusarova GA, Yoder HM, Costa RH, Kalinichenko VV 2005 The forkhead box m1 transcription factor is essential for embryonic development of pulmonary vasculature. J Biol Chem 280:22278–22286[Abstract/Free Full Text]
  21. Wang I-C, Chen Y-J, Hughes D, Petrovic V, Major ML, Park HJ, Tan Y, Ackerson T, Costa RH 2005 Forkhead Box M1 regulates the transcriptional network of genes essential for mitotic progression and genes encoding the SCF (Skp2-Cks1) ubiquitin ligase. Mol Cell Biol 25:10875–10894[Abstract/Free Full Text]
  22. Wonsey DR, Follettie MT 2005 Loss of the forkhead transcription factor FoxM1 causes centrosome amplification and mitotic catastrophe. Cancer Res 65:5181–5189[Abstract/Free Full Text]
  23. Krupczak-Hollis K, Wang X, Dennewitz MB, Costa RH 2003 Growth hormone stimulates proliferation of old-aged regenerating liver through forkhead box m1b. Hepatology 38:1552–1562[Medline]
  24. Wang X, Krupczak-Hollis K, Tan Y, Dennewitz MB, Adami GR, Costa RH 2002 Increased hepatic Forkhead Box M1B (FoxM1B) levels in old-aged mice stimulated liver regeneration through diminished p27Kip1 protein levels and increased Cdc25B expression. J Biol Chem 277:44310–44316[Abstract/Free Full Text]
  25. Korver W, Schilham MW, Moerer P, van den Hoff MJ, Dam K, Lamers WH, Medema RH, Clevers H 1998 Uncoupling of S phase and mitosis in cardiomyocytes and hepatocytes lacking the winged-helix transcription factor Trident. Curr Biol 8:1327–1330[CrossRef][Medline]
  26. Ye H, Holterman AX, Yoo KW, Franks RR, Costa RH 1999 Premature expression of the winged helix transcription factor HFH-11B in regenerating mouse liver accelerates hepatocyte entry into S phase. Mol Cell Biol 19:8570–8580[Abstract/Free Full Text]
  27. Herrera PL, Huarte J, Zufferey R, Nichols A, Mermillod B, Philippe J, Muniesa P, Sanvito F, Orci L, Vassalli JD 1994 Ablation of islet endocrine cells by targeted expression of hormone-promoter-driven toxigenes. Proc Natl Acad Sci USA 91:12999–13003[Abstract/Free Full Text]
  28. Gu G, Dubauskaite J, Melton DA 2002 Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors. Development 129:2447–2457[Medline]
  29. Stoffers DA, Heller RS, Miller CP, Habener JF 1999 Developmental expression of the homeodomain protein IDX-1 in mice transgenic for an IDX-1 promoter/lacZ transcriptional reporter. Endocrinology 140:5374–5381[Abstract/Free Full Text]
  30. Gannon M, Gamer LW, Wright CV 2001 Regulatory regions driving developmental and tissue-specific expression of the essential pancreatic gene pdx1. Dev Biol 238:185–201[CrossRef][Medline]
  31. Soriano P 1999 Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet 21:70–71[CrossRef][Medline]
  32. Kalinichenko VV, Major ML, Wang X, Petrovic V, Kuechle J, Yoder HM, Dennewitz MB, Shin B, Datta A, Raychaudhuri P, Costa RH 2004 Foxm1b transcription factor is essential for development of hepatocellular carcinomas and is negatively regulated by the p19ARF tumor suppressor. Genes Dev 18:830–850[Abstract/Free Full Text]
  33. Nakayama KI, Hatakeyama S, Nakayama K 2001 Regulation of the cell cycle at the G1-S transition by proteolysis of cyclin E and p27Kip1. Biochem Biophys Res Commun 282:853–860[CrossRef][Medline]
  34. Pagano M 2004 Control of DNA synthesis and mitosis by the Skp2–p27-Cdk1/2 axis. Mol Cell 14:414–416[CrossRef][Medline]
  35. Torella D, Rota M, Nurzynska D, Musso E, Monsen A, Shiraishi I, Zias E, Walsh K, Rosenzweig A, Sussman MA, Urbanek K, Nadal-Ginard B, Kajstura J, Anversa P, Leri A 2004 Cardiac stem cell and myocyte aging, heart failure, and insulin-like growth factor-1 overexpression. Circ Res 94:514–524[Abstract/Free Full Text]
  36. Sone H, Kagawa Y 2005 Pancreatic ß cell senescence contributes to the pathogenesis of type 2 diabetes in high-fat diet-induced diabetic mice. Diabetologia 48:58–67[CrossRef][Medline]
  37. Edlund H 2001 Factors controlling pancreatic cell differentiation and function. Diabetologia 44:1071–1079[CrossRef][Medline]
  38. Jensen J 2004 Gene regulatory factors in pancreatic development. Dev Dyn 229:176–200[CrossRef][Medline]
  39. Bernard-Kargar C, Ktorza A 2001 Endocrine pancreas plasticity under physiological and pathological conditions. Diabetes 50:S30–S35
  40. Rane SG, Dubus P, Mettus RV, Galbreath EJ, Boden G, Reddy EP, Barbacid M 1999 Loss of Cdk4 expression causes insulin-deficient diabetes and Cdk4 activation results in ß-islet cell hyperplasia. Nat Genet 22:44–52[CrossRef][Medline]
  41. Martin J, Hunt SL, Dubus P, Sotillo R, Nehme-Pelluard F, Magnuson MA, Parlow AF, Malumbres M, Ortega S, Barbacid M 2003 Genetic rescue of Cdk4 null mice restores pancreatic ß-cell proliferation but not homeostatic cell number. Oncogene 22:5261–5269[CrossRef][Medline]
  42. Korver W, Roose J, Heinen K, Weghuis DO, de Bruijn D, van Kessel AG, Clevers H 1997 The human TRIDENT/HFH-11/FKHL16 gene: structure, localization, and promoter characterization. Genomics 46:435–442[CrossRef][Medline]
  43. Leung TW, Lin SS, Tsang AC, Tong CS, Ching JC, Leung WY, Gimlich R, Wong GG, Yao KM 2001 Over-expression of FoxM1 stimulates cyclin B1 expression. FEBS Lett 507:59–66[CrossRef][Medline]
  44. Ostenson CG, Grill V, Roos M 1989 Studies on sex dependency of B-cell susceptibility to streptozotocin in a rat model of type II diabetes mellitus. Exp Clin Endocrinol 93:241–247[Medline]
  45. Bell RC, Khurana M, Ryan EA, Finegood DT 1994 Gender differences in the metabolic response to graded numbers of transplanted islets of Langerhans. Endocrinology 135:2681–2687[Abstract]
  46. Yoshioka M, Kayo T, Ikeda T, Koizumi A 1997 A novel locus, Mody4, distal to D7Mit189 on chromosome 7 determines early-onset NIDDM in nonobese C57BL/6 (Akita) mutant mice. Diabetes 46:887–894[Abstract]
  47. Amrani A, Durant S, Throsby M, Coulaud J, Dardenne M, Homo-Delarche F 1998 Glucose homeostasis in the nonobese diabetic mouse at the prediabetic stage. Endocrinology 139:1115–1124[Abstract/Free Full Text]
  48. Efrat S 1991 Sexual dimorphism of pancreatic ß-cell degeneration in transgenic mice expressing an insulin-ras hybrid gene. Endocrinology 128:897–901[Abstract/Free Full Text]
  49. Geisler JG, Zawalich W, Zawalich K, Lakey JR, Stukenbrok H, Milici AJ, Soeller WC 2002 Estrogen can prevent or reverse obesity and diabetes in mice expressing human islet amyloid polypeptide. Diabetes 51:2158–2169[Abstract/Free Full Text]
  50. Bonnevie-Nielsen V 1982 Different effects of high glucose and high fat diet on pancreatic insulin and glucagon in female and male mice. Diabete Metab 8:271–277[Medline]
  51. Dor Y, Brown J, Martinez OI, Melton DA 2004 Adult pancreatic ß-cells are formed by self-duplication rather than stem-cell differentiation. Nature 429:41–46[CrossRef][Medline]
  52. McEvoy RC, Hegre OD 1977 Morphometric quantitation of the pancreatic insulin-, glucagon-, and somatostatin-positive cell populations in normal and alloxan-diabetic rats. Diabetes 26:1140–1146[Abstract]
  53. Guz Y, Nasir I, Teitelman G 2001 Regeneration of pancreatic ß-cells from intra-islet precursor cells in an experimental model of diabetes. Endocrinology 142:4956–4968[Abstract/Free Full Text]
  54. Gress T, Muller-Pillasch F, Elsasser HP, Bachem M, Ferrara C, Weidenbach H, Lerch M, Adler G 1994 Enhancement of transforming growth factor ß1 expression in the rat pancreas during regeneration from caerulein-induced pancreatitis. Eur J Clin Invest 24:679–685[Medline]
  55. Risbud MV, Bhonde RR 2002 Models of pancreatic regeneration in diabetes. Diabetes Res Clin Pract 58:155–165[CrossRef][Medline]
  56. Taguchi M, Yamaguchi T, Otsuki M 2002 Induction of PDX-1-positive cells in the main duct during regeneration after acute necrotizing pancreatitis in rats. J Pathol 197:638–646[CrossRef][Medline]
  57. Wang RN, Kloppel G, Bouwens L 1995 Duct- to islet-cell differentiation and islet growth in the pancreas of duct-ligated adult rats. Diabetologia 38:1405–1411[CrossRef][Medline]
  58. Bonner-Weir S, Baxter LA, Schuppin GT, Smith FE 1993 A second pathway for regeneration of adult exocrine and endocrine pancreas. A possible recapitulation of embryonic development. Diabetes 42:1715–1720[Abstract]
  59. Bonner-Weir S 2000 Islet growth and development in the adult. J Mol Endocrinol 24:297–302[CrossRef][Medline]
  60. Gu D, Sarvetnick N 1993 Epithelial cell proliferation and islet neogenesis in IFN-{gamma} transgenic mice. Development 118:33–46[Abstract]
  61. Tsiotos GG, Barry MK, Johnson CD, Sarr MG 1999 Pancreas regeneration after resection: does it occur in humans? Pancreas 19:310–313[Medline]
  62. Gannon M, Ray MK, Van Zee K, Rausa F, Costa RH, Wright CV 2000 Persistent expression of HNF6 in islet endocrine cells causes disrupted islet architecture and loss of ß cell function. Development 127:2883–2895[Abstract]
  63. Goodpaster BH, Kelley DE, Thaete FL, He J, Ross R 2000 Skeletal muscle attenuation determined by computed tomography is associated with skeletal muscle lipid content. J Appl Physiol 89:104–110[Abstract/Free Full Text]
  64. Brissova M, Shiota M, Nicholson WE, Gannon M, Knobel SM, Piston DW, Wright CV, Powers AC 2002 Reduction in pancreatic transcription factor PDX-1 impairs glucose-stimulated insulin secretion. J Biol Chem 277:11225–11232[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Mol. Endocrinol.Home page
L. A. Crawford, M. A. Guney, Y. A. Oh, R. A. DeYoung, D. M. Valenzuela, A. J. Murphy, G. D. Yancopoulos, K. M. Lyons, D. R. Brigstock, A. Economides, et al.
Connective Tissue Growth Factor (CTGF) Inactivation Leads to Defects in Islet Cell Lineage Allocation and {beta}-Cell Proliferation during Embryogenesis
Mol. Endocrinol., March 1, 2009; 23(3): 324 - 336.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
A. Ackermann Misfeldt, R. H. Costa, and M. Gannon
{beta}-Cell Proliferation, but Not Neogenesis, Following 60% Partial Pancreatectomy Is Impaired in the Absence of FoxM1
Diabetes, November 1, 2008; 57(11): 3069 - 3077.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
R. K. Gupta, N. Gao, R. K. Gorski, P. White, O. T. Hardy, K. Rafiq, J. E. Brestelli, G. Chen, C. J. Stoeckert Jr., and K. H. Kaestner
Expansion of adult beta-cell mass in response to increased metabolic demand is dependent on HNF-4{alpha}
Genes & Dev., April 1, 2007; 21(7): 756 - 769.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
A. M Ackermann and M. Gannon
Molecular regulation of pancreatic {beta}-cell mass development, maintenance, and expansion
J. Mol. Endocrinol., February 1, 2007; 38(2): 193 - 206.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
L. C. Murtaugh
Pancreas and beta-cell development: from the actual to the possible
Development, February 1, 2007; 134(3): 427 - 438.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, H.
Right arrow Articles by Gannon, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, H.
Right arrow Articles by Gannon, M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals