| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pharmacology, University of Louisiana College of Pharmacy, Monroe, Louisiana 71209
Address all correspondence and requests for reprints to: Girish V. Shah, Ph.D., Department of Pharmacology, College of Pharmacy, University of Louisiana, 700 University Avenue, Monroe, Louisiana 71209. E-mail: shah{at}ulm.edu.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
A previous study from this laboratory has shown that the expression of neuropeptide human (h) calcitonin (CT) and its receptor (CTR) is localized to the basal epithelium of a normal prostate but is distributed throughout the epithelium of malignant prostates (13). Moreover, most of the hCT and CTR mRNAs in primary prostate tumors display a positive correlation with the tumor grade (13). High-affinity CTRs are present in the membranes of primary prostate tumors as well as LNCaP cells, and their activation leads to the proliferation of PC cells through the activation of Gs-and/or Gq-mediated signaling pathways (14, 15).
Because hCT is an endogenously secreted autocrine peptide in androgen-resistant prostate tumors (13), the objective of the present study was to test the significance of CT expression in invasiveness and tumorigenicity of PC cells. We tested this by 1) enforcing the expression of hCT in LNCaP cells, which are poorly invasive and tumorigenic, and normally express CTR but not CT; and 2) by modulating the expression of hCT in PC-3M cells, which are highly invasive and tumorigenic and coexpress hCT and CTR. We then evaluated the impact of this modulation on oncogenicity of PC cell lines. Our results suggest that the expression of hCT in LNCaP and PC-3M PC cells dramatically enhances their oncogenic characteristics as assessed by cell proliferation, invasion through Matrigel, formation of colonies in soft agar, and growth of xenografts in nude mice. In contrast, the silencing of hCT expression markedly reduces their oncogenicity. Additional studies attempted to delineate the mechanisms associated with hCT-induced oncogenicity of PC cell lines.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
show the abundance of hCT mRNA in PC-3M and LNCaP cell sublines. Among PC-3M cells transfected with five ribozymes (R1–R5), R1 and R2 cells displayed markedly less abundance of CT mRNA as compared with the cells expressing the carrier plasmid ptv5 (v). The abundance of hCT mRNA in R4 cells was similar to the v cells, and that in R3 was marginally less. However, hCT mRNA could not be detected in R5 cells. In contrast, PC-3M cells overexpressing hCT (CT+) displayed markedly higher levels of CT mRNA. LNCaP cells transfected with hCT-pcDNA3.1 (CT) expressed abundant hCT mRNAs when compared with LNCaP cells expressing carrier plasmid (v), which were undetectable (Fig. 1A). Because all samples expressed almost equal amounts of ß-actin mRNA, the changes in hCT mRNA abundance in these cell lines are specific.
|
). Overexpression of hCT in PC-3M-CT+ cells resulted in more than a 3-fold increase in hCT secretion as compared with PC-3M-v (Fig. 1B). Likewise, LNCaP-CT cells secreted fair amounts of hCT as compared with no hCT secretion by LNCaP-v cells (Fig. 1B). It is conceivable that a longer doubling time of LNCaP cells may have contributed to lower hCT secretion in LNCaP-CT cells as compared with PC-3M cells. PC-3M cell lines transfected with ribozymes also displayed predictable secretory profiles (Fig. 1C). The cells transfected with ribozyme 5, the most effective ribozyme to silence hCT mRNA expression, also abolished hCT secretion. Ribozymes 1 and 2 reduced, but did not abolish, hCT secretion whereas ribozymes 3 and 4 were relatively ineffective in modulating hCT secretion by PC-3M cells.
Effects of hCT Expression on Oncogenicity
To examine the effect of endogenous hCT on oncogenicity of PC cells, we chose the following three groups of cell lines: 1) PC-3M-CT+; 2) PC-3M-CT– (complete hCT knockdown with ribozyme R5), PC-3M-R2 (partial CT knockdown with ribozyme R2); and 3) LNCaP-CT. The vehicle controls were PC-3M-v, PC-3M-R4, and LNCaP-v, respectively.
hCT Expression and Cell Proliferation
Growth rate of cell lines was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays. The results of Fig. 2 reveal that cell growth rate of all PC cell sublines was altered with the change in their endogenous hCT expression. The overexpression of hCT resulted in a dramatic decline in the ability of PC-3M-CT+ cells to adhere to plastic substratum and required more than 48 h for the cells to barely attach to the culture plates. Therefore, the rate of proliferation could reliably be measured only after 72 h. At that time point, PC-3M-CT+ cells displayed a 2-fold increase in their proliferation rate as compared with PC-3M-v cells (PC-3M cells expressing carrier plasmid) (Fig. 2A). LNCaP-CT cells displayed a 50% increase in their proliferation as compared with LNCaP-v cells in first 24 h, and this increased to 75% after 48 h (Fig. 2B).
|
). R2 cells (partial knockdown of hCT) also displayed a decrease in proliferation rate (as compared with R4 cells) but it was not as low as that of R5 cells.
Replacement of hCT by Exogenous Addition Restores the Proliferative Activity of PC-3M-CT– Cells
Because PC-3M-CT– cells lack hCT expression but have intact cellular machinery to respond to CT, the replacement of hCT should restore the loss in proliferative activity caused by silencing of hCT expression. We tested this by stimulating these cells with 50 nM hCT. As depicted in Fig. 2D, exogenously added CT brought up the proliferative rate of PC-3M-CT– cells to that of PC-3M-v2 cells (expressing carrier plasmid ptv5). Interestingly, basal proliferative activity of PC-3Mv2 cells was markedly higher than R4 cells, raising a possibility that RNA polymerase III promoter, which is constitutively expressed by PC-3M-v2 cells, may induce transcription of small RNA species to nonspecifically increase the basal proliferation rate (16). This may explain why exogenously added CT could not increase the level of proliferative activity of R5 cells above that of PC-3Mv2.
Modulation of Endogenous hCT Expression and Invasion of PC Sublines through Matrigel
As expected, PC-3M-v cells (expressing carrier plasmid pcDNA3.1) displayed a significant capacity to invade through the Matrigel (Fig. 3A). Overexpression of CT (PC-3M-CT+) caused almost 2-fold increase in their invasiveness. In contrast, PC-3M-CT– cells lost the ability to invade Matrigel. R2 cells (partial knockdown of hCT) showed a marked decrease in their invasiveness when compared with either PC-3M-v2 (carrier plasmid ptv5) or R4 cells (inactive ribozyme).
|
suggest that 50 nM hCT increased their invasiveness only to the level of PC-3M-v2 cells and not above. Once again, this may have been due to a higher basal invasion rate of PC-3Mv2 cells than wild-type PC-3M or R4 cells, as explained in the legend for Fig. 2D.
LNCaP cells are indolent and do not display invasive characteristics as assessed by invasion through Matrigel (17). Our results that LNCaP-v cells could not penetrate through Matrigel are consistent with the present evidence (Fig. 3C). However, LNCaP-CT cells displayed significant ability to penetrate Matrigel, raising the possibility that persistent exposure of hCT to CT-R-positive PC cells leads to the acquisition or increase in their invasive ability. The relative impact of hCT on invasion was more dramatic than that on cell proliferation, raising the possibility that the process of invasion may be a primary target of hCT.
Effect of Modulation of hCT Expression on Colony Formation by PC Cell Lines on Soft Agar
We next evaluated the effect of hCT expression on colony formation in soft agar as an in vitro measure of tumorigenicity (Fig. 4). The metastasizing ability of PC-3M was demonstrated by the formation of several colonies in soft agar, and the transfection of carrier plasmid (PC-3M-v) did not alter this ability (Fig. 4A). However, the overexpression of CT (PC-3M-CT+) increased the number of colonies as well as their diameters by severalfold. In contrast, down-regulation of hCT expression led to a dramatic decline in the numbers as well the size of colonies formed. PC-3M-R4 cells formed the colonies that were similar in number and size to those formed by PC-3M-v2 cells (Fig. 4B). However, PC-3M-CT– cells formed fewer colonies, which were smaller than the cut-off diameter of 50 µm.
|
).
Modulation of hCT Expression Alters PC Cell Growth in Vivo
To test the hypothesis that hCT increases tumorigenicity of PC cells in vivo, we conducted xenograft studies with PC sublines in nude mice. Overexpression of hCT did not alter in vivo growth profile when compared with that of parental PC-3M and PC-3M-v cells in the first 25 d (Fig. 5A). At the end of 5 wk, the mice were killed, and tumors were dissected and weighed. The results show that PC-3M cells and PC-3M-v cells displayed similar tumor weights but the tumors formed by PC-3M-CT+ cells were significantly larger. Because growth of these tumors in the first 25 d was similar to that of control cells, it is very possible that the growth of PC-3M-CT+ cells accelerated considerably in the last 10 d.
|
show that PC-3M-v2 and R4 cells displayed a comparable growth profile. The impact of CT silencing on in vivo growth of PC cells was dramatic, resulting in no growth in most cases (a minimal growth in only one of six mice, and total absence of tumor in the remaining five). R2 cells (partial knockdown of hCT) showed significantly reduced tumor growth. At the end of 5 wk, R4 cells (expressing inactive ribozymes) formed tumors of similar weight as that of PC-3M-v2 cells. R2 cells formed significantly smaller tumors (a decline of >than 80% when compared with controls). Interestingly R5 cells did not even form xenografts in five of six animals. We observed only a small growth in one mouse, suggesting more than 98% decline in their in vivo growth.
LNCaP cells are known to be poorly tumorigenic and do not form xenografts unless they are mixed with Matrigel for the injection (18, 19). We injected LNCaP-v and LNCaP-CT cells without Matrigel. As expected, LNCaP-v cells did not form xenografts in nude mice (Fig. 5C). However, LNCaP-CT cells grew well to form tumors, although their rate of growth was markedly lower than that of PC-3M cells.
hCT-Induced Oncogenicity: Role for Protein Kinase A (PKA)
hCT Expression and Basal PKA Activity of PC Sublines.
Our previous studies have shown that CT increases the invasiveness of PC cells, and this may be mediated by PKA (20). If hCT is the major stimulator of PKA in LNCaP or PC-3M cells, then modulation of their endogenous hCT expression should alter their basal PKA activity. We examined the endogenous PKA activity of PC-3M and LNCaP cell sublines. The results of Fig. 6A show that LNCaP-v cells displayed very low basal PKA activity, and enforced CT expression (LNCaP-CT) led to a 6-fold increase. In contrast, PC-3M cells displayed high basal PKA activity (consistent with their high endogenous CT expression), and further increase in CT expression (PC-3M-CT+) resulted in a moderate increase of 60%. However, the silencing of CT expression (PC-3M-CT–) led to a dramatic, 4-fold decline in their PKA activity (Fig. 6B). Similarly, the expression of PKA-DN (PKA dominant negative) vector in PC-3M as well as LNCaP-CT cells also led to a significant decrease in their endogenous PKA activity (Fig. 6, A and B).
|
, A and B, have shown that the transfection of DN-PKA reduced the endogenous PKA activity of PC-3M and LNCaP-CT cells by greater than 5- and 7-fold, respectively. Silencing of PKA expression almost abolished the invasiveness of LNCaP-CT cells (Fig. 6C). However, a similar down-regulation of PKA in PC-3M cells decreased their invasiveness by only 50% (Fig. 6D), which was less than that caused by the silencing of hCT expression (PC-3M-CT–), suggesting a role for an additional effector(s) in proinvasive actions of hCT.
Role of Urokinase-Type Plasminogen Activator (uPA)-uPA Receptor (uPAR) System in Invasiveness of PC Sublines
Our recent studies suggest that CT increases the secretion of uPA by several-fold in PC cells, and this CT action is mediated by PKA (21). Considering the importance of uPA system in the invasiveness of several cancer cell lines (22, 23, 24), we examined the levels of uPAR in PC-3M cell sublines. Subsequently, we tested the efficacy of the small interfering RNA (siRNA) in silencing the uPAR expression in LNCaP-CT and PC-3M cell lines. The concentrations of uPAR immunoreactivity in PC cell sublines varied with changes in CT expression (Fig. 7.1). PC-3M-CT+ cells showed greater levels of uPAR than PC-3M-v1 cells (lanes B and A, respectively, of Fig. 7.1). In contrast, the levels of uPAR in PC-3M-CT– cells were below the detection limit (lane D of Fig. 7.1). As expected, the levels of uPAR were similar in both control cell lines PC-3M-v1 and PC-3M-v2 (lanes A and C of Fig. 7.1). The results also show that the forced expression of CT in LNCaP cells (LNCaP-CT, lane F) led to an increase in the levels of uPAR, which were below the detection limit in LNCaP-v cells. In uPAR silencing experiments, the results demonstrate that PC-3M and LNCaP-CT cells receiving uPAR siRNA displayed very low uPAR protein content as compared with those receiving negative control siRNA (Fig. 7.2).
|
|
The results presented in upper panel A of Fig. 7B show that the transfection of plasmid pcDNA3.1-uPAR in PC-3M-CT– cells led to the increase in uPAR immunoreactivity. Treatment of these cells with 2 µg uPA for 24 h led to further increase in uPAR levels, suggesting that the loss in invasiveness due to silencing of hCT expression can be completely restored by overexpression and activation of uPA-uPAR system. In a second set of experiments, we silenced uPAR expression in PC-3M-CT+ cells, which displayed higher uPA protein levels than PC-3M-v1 cells. The results of Fig. 7B show that the silencing of uPAR expression in PC-3M-CT+ cells reduced their invasiveness significantly.
Similarly, we examined the effect of uPA-uPAR restoration on proliferation of PC-3M-CT– cells (Fig. 7C). Once again, forced expression of uPAR increased proliferation of PC-3M-CT– cells, and exogenous addition of uPA increased it further to the levels of PC-3M cells. Similarly, silencing of uPAR decreased proliferative activity of PC-3M-CT+ cells, suggesting the importance of the uPA-uPAR system in hCT-mediated oncogenicity of PC-3M cells.
uPAR Silencing and Invasiveness of Sublines.
The silencing of uPAR expression in LNCaP-CT cells resulted in the loss of the ability to invade Matrigel (Fig. 8A). However, the same in PC-3M cells reduced it only partially (Fig. 8B). Interestingly, the silencing of CT expression was severalfold more effective than uPAR silencing in reducing their invasiveness.
|
). Although the combined uPAR-PKA silencing was more effective in attenuating the invasiveness of PC-3M cells than either of them alone, it still was less effective than CT silencing (Fig. 8D).
PKA, uPA, and Colonogenicity of PC-3M and LNCaP-CT Cell Lines
The results of Fig. 9 show that PC-3M cells and those expressing control vectors showed similar colony-forming ability in soft agar as assessed by the colony number or the colony diameter. Overexpression of CT (PC-3M-CT+) increased the colony-forming ability of PC-3M cells by 4-fold. In contrast, the silencing of hCT expression (R5) completely abolished their colony-forming ability (as assessed by the ability to form a colony of 50-µm diameter in 14 d). Down-regulation of PKA reduced their colony-forming ability by 50%, but silencing of uPAR abolished this ability (Fig. 9, A and B). LNCaP-v cells did not form any colonies on soft agar, but LNCaP-CT cells formed several colonies. Inhibition of PKA activity markedly attenuated but did not abolish this ability. However, the silencing of uPAR expression completely abolished the colonogenicity of LNCaP-CT cells (Fig. 9, C and D).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Earlier studies from this laboratory have shown that a population of secretory cells of malignant prostate epithelium express hCT and/or CTR, and this population increases with the progression of PC (13). However, all tumor cells of advanced PCs coexpress hCT and CTR. In support of the possibility that coexpression of hCT and CTR may be associated with metastatic phenotypes, our results indicate that highly aggressive PC-3M and DU-145 cell lines coexpress hCT and CTR (13, 39). In contrast, poorly invasive LNCaP cells express only CTR. To test the hypothesis that elevated expression of hCT may provide CTR-positive PC cells with constitutive stimulus for invasion and tumorigenicity, we examined the effect of up-regulation and down-regulation of hCT expression on the oncogenicity of PC-3M cells. Overexpression of hCT in PC-3M cells significantly enhanced their transformed phenotype as assessed by cell proliferation assays, invasion assays, and anchorage-independent growth as well as xenograft formation in nude mice. In contrast, down-regulation of hCT expression dramatically reduced these characteristics. Specifically, the cells expressing R5 ribozyme completely lost the ability to invade the basement membrane or form colonies on soft agar or xenografts in nude mice. The dose-dependent decrease of hCT expression was associated with a similar decrease in the invasiveness and tumorigenicity of PC-3M cells. Specificity of hCT action on these paradigms was further suggested by restoration of invasiveness and proliferation of PC-3M-CT– cells by exogenously added hCT.
This hypothesis was further tested in LNCaP cells, which are androgen responsive, lack invasive and tumorigenic characteristics, present the phenotype of early-stage tumor cells and express only CTR, and not hCT (13, 18, 40). To test the possibility that constitutive hCT stimulus may increase oncogenicity of LNCaP cells, we enforced hCT expression by stable transfection of constitutively active CT expression vector. LNCaP-CT cells acquired invasive and colonogenic properties and also formed tumor xenografts in nude mice. Considering the lack of the ability of LNCaP cells to invade or form tumor xenografts, this was a significant finding and suggests that the acquisition of hCT-CTR coexpression may be a significant step in their progression toward invasive phenotype. It is important to note that invasive and tumorigenic abilities of LNCaP-CT cells were much less in magnitude than those of PC-3M cells, suggesting that the coexpression of hCT and CTR expression may be an important, but not the only, factor in oncogenic progression of PC cells.
Previous studies from this laboratory have shown that CTR in PC cells is coupled to the Gs- and Gq-mediated signaling pathways (15). Stimulation of LNCaP and PC-3M cells leads to the activation of adenylyl cyclase and protein kinase C (14). However, constitutive activation of Gs, but not Gq, leads to increased tumorigenicity of PC-3M cells (41). Consistent with these findings, our recent results suggest that hCT stimulates invasiveness of several PC cell lines by activating PKA (20). There is increasing evidence for the role of PKA in neuroendocrine differentiation and for mediating proinvasive actions of neuroendocrine peptides (42, 43, 44, 45). Furthermore, we have shown that hCT stimulates uPA secretion from PC-3M cells through a PKA-dependent pathway (21). To test the possible role of PKA in hCT/CTR-induced transformation of PC cells, we first examined the total PKA activity of PC-3M and LNCaP sublines. As expected, the increase in hCT expression in PC-3M cells or the enforced expression of hCT in LNCaP cells significantly increased their endogenous PKA activity. In contrast, the silencing of hCT expression in PC-3M cells led to a marked decline in their PKA activity. In subsequent experiments, we down-regulated endogenous PKA activity of PC-3M and LNCaP-CT cells. This led to almost complete loss of invasiveness and colony-forming activity of LNCaP-CT cells, but only partially reduced those of PC-3M cells. These results suggest that PKA is a predominant mediator of mechanisms that regulate the invasiveness and colonogenicity of LNCaP-CT cells, but other PKA-independent mechanisms may be involved in more advanced PC-3M PC cells.
We have recently reported that CT stimulates the uPA secretion from PC-3M cells in a dose-dependent manner (21). Moreover, Rp.cAMP, a competitive inhibitor of PKA, inhibits the stimulatory action of CT on uPA secretion. It has been reported that the binding of uPA to its cell surface receptor (uPAR) promotes plasminogen activation at the cell’s surface and may lead to the activation of metalloproteinases (47). Moreover, up-regulation of uPA and uPAR has been reported in multiple invasive tumor cell lines (22). uPAR promotes tumor invasion via matrix degradation by its protease ligand uPA, as well as by cellular signaling of migration via other receptors such as integrins and epidermal growth factor receptor (48, 49, 50). Whereas hCT stimulates uPA secretion as well as the secretion of matrix metalloproteinase (MMP)-2 and MMP-9, it can increase the proteolytic activation of MMPs only through uPA-uPAR complex formation. We examined the expression of uPAR in the present study and observed that uPAR concentrations in PC-3M-CT+ cells were markedly higher than PC-3M cells, but were undetectable in PC-3M-CT– cells. To examine functional significance of hCT-modulated uPAR expression, we enforced the expression of uPAR in PC-3M-CT– cells, which expressed undetectable levels of uPAR and displayed very little invasive activity. Enforced uPAR expression markedly increased invasiveness of PC-3M-CT– cells and also increased their proliferation rate. Interestingly, exposure of PC-3M-CT– cells to uPA further increased uPAR expression and invasiveness of PC-3M-CT– cells. This could possibly be explained by the reports that uPA can directly increase the expression of its own receptor (51). Because PC-3M-CT+ cells display greater invasiveness and proliferative rate, as well as uPAR expression, we examined the effect of uPAR silencing on their invasive and proliferative activity. Once again, uPAR silencing moderately decreased their invasive and proliferative characteristics but did not bring them to the level of PC-3M-CT– cells.
Therefore, we examined the effect of combined silencing of PKA and uPAR on invasiveness of PC-3M cells. Although this reduced the invasiveness of PC-3M cells to a greater extent than that by silencing of either uPA or PKA individually, it did not bring it to the level of PC-3M-CT– cells. These results raise a possibility that CT may stimulate additional mechanisms to increase the invasion of PC-3M cells. However, the silencing of uPAR was effective in abolishing the ability of PC-3M as well as LNCaP-CT cells to form colonies in soft agar, whereas inactivation of PKA could only partially block this ability. These results suggest that the uPA-uPAR system plays a predominant role in CT-induced invasiveness and tumorigenicity of PC cells. Whereas PKA is an important mediator of CT-induced up-regulation of the uPA-uPAR axis in LNCaP cells, its role is diminished in more aggressive PC-3M cells.
PC is the most common human male cancer that causes high degree of morbidity and mortality, mainly due to metastases of these tumors to various distal organs, and particularly to the bone (3, 52, 53, 54, 55). These distal lesions are often refractory to conventional therapies and continue to grow, resulting in high mortality associated with metastatic PC (56, 57, 58). Present results have shown that endogenous expression of hCT may be an important factor in oncogenicity of PC cells, and have identified that PKA is an important mediator of oncogenic actions of hCT in PC-3M and LNCaP cells. Whereas the transformed phenotype of LNCaP-CT cells results from PKA-mediated activation of the uPA-uPAR system, other signaling system(s) may also play a role in CT-induced activation of the uPA-uPAR system in more advanced PC-3M cells. However, activation of uPA/uPAR axis seems critical for oncogenic phenotype of both PC-3M and LNCaP cells. Consistent with this assumption, the silencing of CT expression in PC-3M cells leads to the loss of oncogenic phenotype as well as uPAR expression. The identification of CT-induced alternative pathway(s) activating the uPA/uPAR axis in androgen-independent PC cells may provide further understanding of the molecular processes associated with oncogenic progression of PC.
In summary, the present results extend our previous findings that tumor cells of metastatic PCs express hCT and CTR and demonstrate that hCT significantly increases cell proliferation, invasion, and colonogenicity as well as tumorigenicity of LNCaP and PC-3M cell lines. This action of hCT may be mediated by PKA-dependent activation of the uPA/uPAR axis in less invasive LNCaP cells. However, the signaling networks mediating hCT-induced oncogenicity in more progressive PC-3M cells are altered. These results raise a strong possibility that endogenously produced hCT may play an important role in metastatic progression of PC.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Cell Culture
The PC-3M cell line (provided by Dr. Isiah Fidler, MD; Anderson Cancer Center, Houston, TX) was maintained in complete medium (RPMI 1640 supplemented with 5% fetal calf serum and 15% horse serum, 50 IU/ml penicillin G, and 100 µg/ml streptomycin) under standard culture conditions. LNCaP cells were obtained from American Type Culture Collection (Manassas, VA) and cultured as recommended by the provider.
Plasmids and Transfections
CT-pcDNA3.1.
The full-length human CT cDNA cloned from primary prostate tumor specimens was inserted into pcDNA3.1 plasmid (Invitrogen, San Diego, CA) in the sense direction (13). The orientation of the insert was confirmed by sequencing at the institutional DNA sequencing facility. CT-pcDNA3.1 construct was then transfected into PC-3M and LNCaP cells, and G418-resistant colonies were selected as described previously (41).
PKA-DN.
PKA activity in PC cell lines was silenced by the transfection of plasmid REVAB, which contains the cDNA encoding a mutant regulatory subunit type I
. Mutations in each of two cAMP-binding sites cause RI to act as a DN inhibitor of C subunit activity (59). This REVAB (RAB) gene product associates with the C subunit with low efficiency, maintaining the holoenzyme in an inactive state.
uPAR-pcDNA3.1
Silencing of CT mRNA Expression: Generation of anti-CT Hammerhead Ribozymes.
Two strands of oligonucleotide templates encoding each ribozyme against CT cDNA with BamH1 and HindIII site at the 3'- and 5'-ends, respectively, were synthesized at Genemed Biosynthesis, Inc. (San Francisco, CA).
1. 5'-GAAGATCTTC/GCAAGTAAG/TTTCGTCCTCACGCACTCATCAG/CTTCTTTC/CCGCTCGAGCGG-3'
5'-CTTCTAGAAG/CGTTCATTC/AAAGCAGGAGUGCCUGAGUAGUC/GAAGAAAG/GGCGAGCUCGCC-3'
2. 5'-GAAGATCTTC/CTGGGCACG/AAAGCAGGAGUGCCUGAGUAGUC/CACACAAG/CCGCTCGAGCGG-3'
5'-CTTCTAGAAG/ACUCCGUAC/AAAGCAGGAGUGCCUGAGUAGUC/GTGTGTTC/CCGCTCGAGCGG-3'
3. 5'-GAAGATCTTC/AGGAGAAAG/TTTCGTCCTCACGCACTCATCAG/CCACAGGC/CCGCTCGAGCGG-3'
5'-CTTCTAGAAG/TCCTCTTTC/AAAGCAGGAGTGCCTGAGTAGTC/GGTGTCCG/GGCGAGCTCGCC-3'
4. 5'-GAAGATCTTC/CAAGGGCAG/TTTCGTCCTCACGCACTCATCAG/ATCTGGCT/CCGCTCGAGCGG-3'
5'-CTTCTAGAAG/GTTCCCGTCA/AAAGCAGGATGCCGTGAGAGTC/TAGACCGA/GGCGAGCUCGCC-3'
5. 5'-GAAGATCTTC/AGCTTCTAG/TTTCGTCCTCACGCACTCATCAG/ATCTGGCT/CCGCTCGAGCGG-3'
5'-CTTCTAGAAG/TCGAAGATC/AAAGCAGGATGCCGTGAGAGTC/TAGACCGA/GGCGAGCUCGCC-3'
After purification on polyacrylamide gel, the oligonucleotides were annealed and cloned into BamH1 and HindIII sites of the ptv5 vector (60). The vector is a pUC-based plasmid carrying a U6 polIII promoter driving the transcription of the ribozyme. The transcription is terminated by a polIII polymerase termination signal (four thymidine residues) to generate ribozymes with very small extraneous sequences. Each ribozyme was cotransfected with plasmid pcDNA3.1-zeocin in to PC-3M cells, and zeocin-resistant colonies were selected after 4 wk. As a vector control, plasmid ptv5 lacking the ribozyme template was transfected to generate PC-3M-v2 cell line.
The clones were then screened for hCT mRNA expression and hCT secretion by S1 nuclease assay and specific RIA, respectively, as described below (13, 29).
Measurement of CT mRNA Abundance: S1 Nuclease Assay
Plasmid Constructs and Riboprobe Preparation.
Partial cDNA for CT (86–580) was cloned in the pGem-T vector (13). pTRI-ß-actin mouse antisense control template contained a 245-bp fragment of mouse cytoplasmic ß-actin gene, which extends from codon 220 to codon 303 (Ambion, Austin, TX). The plasmids were linearized with ApaI or PstI, respectively, were used as templates to transcribe 32P-labeled antisense riboprobes for CT and ß-actin using either T7 or T3 RNA polymerase. The reaction mixtures were then digested with RNase-free DNase (Roche, Indianapolis, IN), and the riboprobes were extracted with phenol/chloroform, and precipitated in ethanol. The integrity of the riboprobes was checked on 8 M urea-5% polyacrylamide gel.
RNA isolation and S1 Nuclease Protection Assay
Total RNA from prostate cell lines was extracted by the modified method of Chomczynski and Sacchi (61) as described by Xie and Rothblum (62). In brief, the cells were rinsed with prechilled PBS, and lysed using a single-step acid-guanidinium thiocyanate-phenol-chloroform extraction. Total RNA was precipitated in isopropanol. The precipitates were washed in 70% ethanol, and dissolved in diethylpyrocarbonate-treated water.
Total RNA samples from prostate cell lines were analyzed for hCT and ß-actin mRNA abundance individually but in the same samples by S1 nuclease protection assays as previously described (13, 14). In brief, 20 µg of total RNA was incubated with appropriate antisense riboprobes (
500,000 cpm) for 18 h at 42 C. Sense riboprobes served as negative controls. The samples were then digested with 50 U of S1-nuclease for 30 min at 37 C. The protected RNA was fractionated on 8 M urea 5% polyacrylamide gel. The gel was then dried and autoradiographed. Each experiment was repeated three separate times.
Secretion of CT in the Conditioned Media: CT RIA
PC cell lines were seeded at a density of 3 x 105 cells per well in six-well plates for 24 h. The complete medium was then replaced with basal incubation medium for 24 h, after which the conditioned medium was collected and analyzed for immunoreactive hCT by RIA as previously described (29).
Assessment of Oncogenicity
Proliferation of PC Cells: MTT Assay.
The proliferation of PC cells was assessed by MTT assay kit (American Type Culture Collection). Exponentially growing cells were plated in a 96-well plate at a density of 8 x 103 cells per well and cultured for 24 h. The complete growth medium was then replaced with 100 µl of basal incubation medium (RPMI 1640 containing 0.1% BSA, 10 mM HEPES, 4 mM L-glutamine, 100 IU/ml penicillin G, and 100 µg/ml streptomycin), and the culture was continued at 37 C under 5% CO2 for 24 or 48 h. The cells were then treated with MTT solution at 37 C for 4 h, and the color reaction was stopped with the stop solution (100 µl/well). The incubation at 37 C was continued until the formazan product was completely dissolved. Absorbance of the samples was determined at 595 nm with an ELISA plate reader (Bio-Rad Laboratories, Inc., Hercules, CA).
In Vitro Invasion Assay.
Invasion experiments were conducted in 24-well, two-compartmented, Matrigel invasion chambers (Becton Dickinson, Bedford, MA). Exponentially growing PC cells were serum starved for 24 h with basal incubation medium. Serum-starved cells were then seeded at a density of 25 x 103 cells per well in the upper insert of the Matrigel invasion chamber. The lower chamber received the chemoattractant medium, which consisted of 90% basal RPMI medium and 10% conditioned medium from the cultures of PC-3M cells expressing constitutively active Gs protein (41). The incubations were carried out for 24 h, after which the Matrigel (along with noninvading cells) was scraped off with cotton swabs, and the outer side of the insert was fixed and stained using Diff Quik staining (Dade Behring Diagnostics, Aguada, Puerto Rico). The cells migrated on the outer bottom side of the insert were counted under the microscope in six or more randomly selected fields (magnification: x100). The final results were expressed as mean ± SEM number of invaded cells per x100 field. Each experiment was done in triplicate, and the experiment was repeated twice.
Growth Correction.
Because some PC-3M cell sublines exhibited a higher proliferation rate, we considered the possibility that the cells migrated during the early part of the 24-h incubation period could proliferate during the remaining period of incubation, causing a slight overestimation of the final results. To correct this, we determined the growth rate of PC-3M cells under identical culture conditions. Cells (25 x 103) were plated at hourly intervals in six-well dishes and cultured for 1–24 h. Mean percent increase in the cell number was determined by counting the net increase in the number of cells. The relative CT-induced increase of the pooled results of all time points was found to be 1.19 (vehicle control = 1). This correction was applied to the results of invasion assays.
Soft Agar Colonogenic Assays.
Soft agar assays were performed as described previously (41). An underlay of 0.5% agar in RPMI 1640 containing 5% fetal calf serum was prepared by mixing equal volumes of 1% agarose and 2x RPMI 1640 plus 10% fetal calf serum. Two milliliters of this mixture were pipetted into the wells of six-well plates and allowed to set. Cells (5 x103) were seeded in each well of a six-well culture dish containing 0.3% top low-melt agarose. The agarose was allowed to set, and the plates were incubated in a humidified chamber at 37 C for 14 d. Colonies were counted in a blinded manner using a x10 objective on a Zeiss inverted microscope (Carl Zeiss, Thornwood, NY). Colonies with a diameter larger than 50 µm were scored. Data are expressed as average number of colonies formed as well as the average diameter of colonies.
Tumor Xenografts in nu/nu Mice.
Nude athymic male mice were injected sc with cell lines (1 x 106 cells per mouse) as described in Results and maintained on a laboratory diet ad libitum for 5 wk. Tumor size was measured every alternate day by a caliper. The tumor volumes were determined by using the formula: V = (L*W*H). After 5 wk, the tumors were removed, weighed, fixed in neutral buffered formalin, and embedded in paraffin. Six to eight mice were used for each cell line.
PKA Assays
For PKA assays, PC cell lines (2 x 106 cells per 100-mm dish) were harvested in lysis buffer (50 mM Tris, pH 7.5, containing 5 mM EDTA, 50 mM NaF, 1 mM sodium pyrophosphate, 0.5 mM EGTA, 10 mM ß-mercaptoethanol, 1 µg/ml leupeptin, and 1 µg/ml aprotinin). The cell extracts were sonicated, and debris was removed by centrifugation. The extracts were then incubated for 5 min at 30 C in the reaction buffer [final concentration was 50 mM Tris, pH 7.5; 10 mM MgCl2; 100 µM ATP; 4 nM of [
-32P]ATP; 0.25 mg/ml BSA; and 50 µM Leu-Arg-Arg-Ala-Ser-Leu-Gly (Biotinylated Kemptide; Promega Corp., Madison, WI)] either alone (control) or in the presence of either 1 mM protein kinase I (PKI) (background), 10 µM cAMP (total PKA activity), 10 nM CT, or PKA inhibitor plus cAMP (total background activity). Triplicates of each sample were assayed, and blotted on SAM2 biotin capture membranes at the end of incubation (Promega Corp., Milwaukee, WI). The membranes were then washed extensively with 2 M NaCl as well as 2 M NaCl + 1% H3PO4, and the bound phosphorylated substrate on a filter disc was quantified in a scintillation counter. PKI-inhibitable kinase activity was calculated, and the data were reported as picomoles ATP per min·µg protein.
Silencing of uPAR Expression with siRNA
Exponentially growing PC-3M or LNCaP-CT cells were plated at a density of 2 x 105 cells per well in a six-well plate and cultured for 24 h. The complete culture medium was then replaced with the serum-free basal incubation medium. The cells were then transfected with siRNA duplexes against uPAR of the following sense and antisense sequences:
5'-gaucctuacagcaguggagagc-3' and 5'-P-aaucgcucuccacugcuguag-3'.
The controls received RNA duplexes of random sequences of equivalent length.
The transfection was carried out by lipofection using FuGene reagent (Roche), and the incubation was continued overnight. The medium was then replaced with RPMI 1640 complete medium containing 10% fetal bovine serum. Cell lysates were prepared 48 h after the transfection to monitor uPAR levels by Western blot analysis 48 h after the transfection. In addition, the surface uPAR expression in the transfectants was monitored by immunocytochemistry. The transfectants were also tested for invasiveness on Matrigel and for colony formation on soft agar.
Western Blotting
The cells were grown to approximately 80% confluency, transferred to the serum-free basal medium, washed twice with ice-cold PBS (0.15 M NaCl; 0.01 M NaPO4, pH 7.4), and lysed on ice in 50 mM Tris buffer (pH 7.4, containing 1% Nonidet P-40, 0.25% Na-deoxycholate, 1 mM EDTA, and freshly supplemented with 1 mM phenylmethylsulfonylfluoride, 1 µg/ml leupeptin, 1 µg/ml aprotinin, 1 µg/ml pepstatin, 1 mM Na3VO4, 1 mM NaF) for 10 min. The nuclear fraction and debris were separated by centrifugation at 2000 x g for 10 min at 4 C, and the protein content of the supernatants was determined using Bio-Rad Reagent. The lysates were then boiled for 5 min in 2x Laemmli solution containing 20 mM dithiothreitol, and 50 µg protein per lane was loaded on 12.5% sodium dodecyl sulfate-polyacrylamide gel. The separated proteins were electrically transferred to a nitrocellulose membrane, and the blots were incubated with uPAR antiserum (American Diagnostica Co., Greenwich, CT) for 18 h at 4 C. After three washes, the blots were incubated with antirabbit IgG-conjugated horseradish peroxidase (1:5000). After three successive washes, the immune complexes were visualized on chemiluminiscence radiography film using Western blot enhanced chemiluminescence detection system (Radiochemical Center, Amersham Pharmacia Biotech, Arlington Heights, IL). After radiography, the blots were washed and reprobed for -tubulin. The autoradiograms were scanned on densitometer for semiquantitation. The same experiment was repeated two more times.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
First Published Online March 30, 2006
Abbreviations: CT, Calcitonin; CTR, CT receptor; DN, dominant negative; MMP, matrix metalloproteinase; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; PC, prostate cancer; PKA, protein kinase A; PKI, protein kinase I; siRNA, small interfering RNA; uPA, urokinase-type plasminogen activator; uPAR, uPA receptor.
Received for publication July 12, 2005. Accepted for publication March 16, 2006.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
) in proliferation of PC-3M prostate cancer cells. Int J Cancer 91:46–54[CrossRef][Medline]
