help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2005-0321
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lefebvre, B.
Right arrow Articles by Lefebvre, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lefebvre, B.
Right arrow Articles by Lefebvre, P.
Molecular Endocrinology 20 (9): 2109-2121
Copyright © 2006 by The Endocrine Society

Down-Regulation of the Tumor Suppressor Gene Retinoic Acid Receptor ß2 through the Phosphoinositide 3-Kinase/Akt Signaling Pathway

Bruno Lefebvre, Céline Brand, Sébastien Flajollet and Philippe Lefebvre

Institut National de la Santé et de la Recherche Médicale, Unité 459, and Université de Lille, Faculté de Médecine Henri Warembourg, F-59045 Lille, France

Address all correspondence and requests for reprints to: Dr. Bruno Lefebvre, Institut National de la Santé et de la Recherche Médicale, Unité 545, Faculté de Médecine Henri Warembourg, 1 Place de Verdun, 59045 Lille cedex, France. E-mail: bruno.lefebvre{at}lille.inserm.fr.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The retinoic acid receptor ß2 (RARß2) is a potent, retinoid-inducible tumor suppressor gene, which is a critical molecular relay for retinoid actions in cells. Its down-regulation, or loss of expression, leads to resistance of cancer cells to retinoid treatment. Up to now, no primary mechanism underlying the repression of the RARß2 gene expression, hence affecting cellular retinoid sensitivity, has been identified. Here, we demonstrate that the phosphoinositide 3-kinase/Akt signaling pathway affects cellular retinoid sensitivity, by regulating corepressor recruitment to the RARß2 promoter. Through direct phosphorylation of the corepressor silencing mediator for retinoic and thyroid hormone receptors (SMRT), Akt stabilized RAR/SMRT interaction, leading to an increased tethering of SMRT to the RARß2 promoter, decreased histone acetylation, down-regulation of the RARß2 expression, and impaired cellular differentiation in response to retinoid. The phosphoinositide 3-kinase/Akt signaling pathway, an important modulator of cellular survival, has thus a direct impact on cellular retinoid sensitivity, and its deregulation may be the triggering event in retinoid resistance of cancer cells.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE NUCLEAR RETINOIC acid receptor ß2 gene (RARß2) is a tumor suppressor gene and several lines of evidence document its role as a mediator of the antiproliferative effects of both natural [including all-trans retinoic acid (atRA)] and synthetic retinoids: 1) ectopic expression of RARß2 in retinoid-resistant cancer cells restored growth inhibition in response to atRA and led to decreased cell tumorigenicity (1, 2, 3, 4), 2) inhibition of RARß2 expression in retinoid-responsive cancer cell lines abolished the growth inhibition induced by atRA (5, 6), and 3) RARß2 antisense RNA expression in transgenic mice caused an increased frequency of lung carcinoma (7). The mechanism by which RARß2 inhibits tumor growth remains elusive but seems to be linked to its constitutive ability to block the activator protein 1 signaling pathway, in contrast to the ligand-dependent cross talk of the {alpha} and {gamma} isotypes (8). A growing body of data demonstrates that RARß2 expression is greatly decreased in several forms of human cancers (9), but potential causes for this reduced expression are still largely unknown. However, several studies suggest that this process involves epigenetic mechanisms including histone deacetylation, associated or not with DNA methylation (10, 11, 12, 13).

Through the interaction of the constitutively expressed RAR{alpha} with a canonical retinoic acid responsive element (RARE) located within its promoter, the RARß2 gene is one of the immediate-early gene to be expressed upon retinoid treatment. Transcriptional regulation by retinoids involves two types of nuclear receptors, the retinoic acid receptors (RARs) and the retinoid X receptors (RXRs). Based on the observations made in the nuclear receptor field, a model for transcriptional regulation by RXR/RAR heterodimer has been proposed in which the transcriptional activation is concomitant to promoter histone hyperacetylation (14). In the absence of ligand, RXR/RAR heterodimers are associated with corepressor complexes (CoR) and repress transcription. These CoR complexes are characterized by an histone deacetylase (HDAC) activity, catalyzing histone deacetylation, chromatin compaction, and thus repression of target genes. The recruitment of HDACs occurs through two intermediary proteins, silencing mediator for retinoic and thyroid hormone receptors (SMRT) and nuclear receptor corepressor (NCoR). Ligand binding induces modification of the RAR structure, leading to the destabilization of the CoR-receptor interaction, and the formation of a new interface suitable for coactivators recruitment, thereby tethering histone acetyl transferase activity to the promoter (15, 16).

Epithelial cancers are frequently associated with hyperactivation of the phosphoinositide 3-kinase (PI3K)/Akt signaling pathway. In response to growth factors, PI3K catalyzes the production of the lipidic second messenger phosphatidylinositol-3,4,5-triphosphate (PIP3) from PIP2 at the inner side of the cytoplasmic membrane. PIP3 contributes to the recruitment and activation of several downstream targets, including the serine/threonine kinase Akt (17). The PI3K/Akt pathway is a key regulator of cell survival through multiple downstream targets. This includes the inactivation of the proapoptotic factors Bad and procaspase-9 by phosphorylation, increased transcription of nuclear factor-{kappa}B and cAMP response element-binding protein survival genes or nuclear exclusion of the cyclin inhibitors p21 and p27 (18). Activation of PI3K/Akt signaling pathway can occur through several mechanisms. Amplification of the PI3K gene has been detected in ovarian and cervix cancers (19, 20) and also in several forms of epithelial cancers (21, 22, 23). Another mechanism involved in PI3K/Akt activation is the loss of the tumor suppressor phosphatase and tensin homolog (PTEN). PTEN is a 3' phosphatase that converts PIP3 back to PIP2, thus exerting a negative control on the PI3K signaling pathway. The loss of PTEN function by mutations is extremely common in prostate, breast, and lung cancers (24).

We previously investigated the mode of transcriptional regulation of the RARß2 promoter in the retinoid-sensitive P19 embryonal carcinoma cell line. We showed that its regulation follows rules that differ significantly from the consensual model. First, the acetylation state of histones H3 and H4 associated to this promoter does not vary upon ligand treatment (25). We further demonstrated that the ligand-induced transcriptional activation of this promoter is correlated to histone H3 hyperphosphorylation and prevented by a retinoid antagonist, thereby establishing a relationship between the activation state of RAR and the phosphorylation state of histone H3 (26). In the experiments described here, we extend our studies of the mechanism underlying histone constitutive acetylation at the RARß2 gene and its implication in transcriptional regulation. We demonstrate that activation of the PI3K/Akt signaling pathway induces transcriptional repression of the RARß2 gene. This Akt-mediated repression is characterized by an enhanced recruitment of SMRT to the RARß2 promoter, leading to histones H3 and H4 deacetylation and impaired biological responses to atRA. Akt-mediated phosphorylation of SMRT led to a strengthened interaction with RAR, thereby identifying the PI3K/Akt pathway as a major negative regulator of the tumor suppressor gene RARß2 expression.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Histones Posttranslational Modifications and RNA Polymerase II (RNAP) Loading at the RARß2 Promoter in P19 and HeLa Cells
To identify the epigenetic mechanism regulating RARß2 expression, we first investigated the histone acetylation status in the retinoid responsive cell lines P19 and in a poorly retinoid responsive cell line, HeLa cells (27, 28, 29). As shown in Fig. 1AGo, P19 cells exhibited a rapid accumulation of the RARß2 transcripts after atRA exposure, which was detectable after 30 min, whereas a delayed response was observed in HeLa cells (1 h). We also observed a considerable basal expression of this gene in P19 cells. In addition, RARß2 transcripts reached a plateau after 4 h in HeLa cells instead of P19 cells, in which they continually increased even after 8-h treatment.


Figure 1
View larger version (31K):
[in this window]
[in a new window]
  		Fig. 1. Histones H3 and H4 Acetylation and RNAP Loading at the RARß2 Promoter in HeLa and P19 Cell Lines

A, Real-time RT-PCR analysis of RARß2 promoter activity in P19 and HeLa cells. All experiments were carried out in triplicate, and SD never exceeded 0.002. B, Functional organization of the RARß2 promoter. Cis-acting sequences are indicated along the primary sequence of the RARß2 promoter as well as the main trans-acting factors known to regulate its activity. C, Analysis of H3 acetylation level in HeLa and P19 cells. Cells were subjected to cross-linking by 1% formaldehyde treatment. Chromatin fragments were then immunoprecipitated using antibodies (Ab) against nonacetylated/nonphosphorylated H3 or acetylated histone H3 and analyzed by semiquantitative PCR for the presence of the RARß2 promoter. Representative PCR results are shown. D, Analysis of H3-K4 and H3-K9 trimethylation in P19 cells. Cells were treated with 100 nM atRA for 2 h and treated with formaldehyde as described in B. ChIPs were carried out with anti-trimethyl H3-K4 or anti-trimethyl H3-K9 and analyzed as described in B. E, Analysis of H3 and H4 acetylation levels upon retinoid treatment. HeLa and P19 cells were treated with 100 nM atRA for 2 h and treated with formaldehyde as described in B. ChIPs were carried out with anti-acetylated H3 and H4 antibodies. Amplified DNAs were quantified by densitometry, and results were expressed relative to the control, which was arbitrarily set to 1. All experiments were carried out in triplicate and SD never exceeded 0.15. F, Recruitment of RNAP in P19 and HeLa cells. ChIPs were carried out as described in E using an antibody against RNAP. ND, Not determined.

 
Antibodies specific for nonacetylated/nonphosphorylated or acetylated histone H3 were used to immunoprecipitate formaldehyde-cross-linked, sonicated chromatin from P19 and HeLa cells. A semiquantitative PCR analysis of input DNA and of immunoprecipitated DNA, for which conditions were adjusted to ensure linear amplification of DNA targets, was carried out to detect a fragment of the RARß2 promoter encompassing several cis-acting elements, including the canonical DR5 (Fig. 1BGo). These chromatin immunoprecipitation (ChIP) analyses demonstrated a high level of acetylated histone H3 at the RARß2 promoter with barely any detectable form of nonacetylated/nonphosphorylated H3 in the retinoid-responsive P19 cells (Fig. 1CGo). In contrast, only the nonacetylated/nonphosphorylated histone H3 was detected in HeLa cells at the same locus, showing that nonacetylated histone H3 is associated to a poorly transcriptionally active promoter.

Histone H3 K4 methylation is associated with active chromatin, whereas histone K9 methylation is associated with repressed chromatin (30). We thus investigated the level of methylation on K4 and K9 at the RARß2 promoter in P19 and HeLa cells. Only trimethylated K4 was detected in P19 cells at the RARß2 promoter, a posttranslational modification that was not further altered by atRA treatment. A similar analysis showed that none of these posttranslational modifications of histone H3 were detectable in HeLa cells, as well as histone H3 serine 10 phosphorylation, a hallmark of RARß2 promoter activation in P19 cells (26).

We next assessed whether atRA treatment correlates with alteration of histone acetylation at the RARß2 promoter. Constitutive acetylation of H3 and H4 was detected in the absence of ligand in retinoid-responsive P19 cells (Fig. 1EGo). Adding 100 nM atRA caused no further detectable changes after a 2-h treatment. Similar results were obtained for shorter or longer incubation times (25). In contrast, ChIP analysis revealed that ligand treatment of HeLa cells caused an increase in the acetylation of H3 (4.2-fold induction) and of H4 (1.6-fold induction).

We previously demonstrated that RNAP was constitutively loaded at the RARß2 promoter (Fig. 1FGo) (25). In sharp contrast, ChIP analysis in HeLa cells revealed that no RNAP could be detected at the nonstimulated RARß2 promoter, and that a clear increase of RNAP loading occurred in response to atRA.

These results thus show that the retinoid-responsive cell line P19 exhibits a high level of H3 and H4 acetylation at the RARß2 promoter in absence of ligand and that this correlates with a constitutive RNAP loading. Because histone deacetylation at nuclear receptor-regulated promoters relies on corepressor recruitment and associated HDAC activities, we hypothesized that a specific regulation of corepressor complexes might occur in the retinoid-responsive P19 cells.

RARß2 Promoter H3 and H4 Hyperacetylation Is Linked to a Lack of Corepressor Binding to RAR/RXR Heterodimers
Several studies indicated that corepressor activity is regulated through several mechanisms, including proteosomal degradation, nuclear exclusion, regulation of its association with others components of the corepressor complex, or their association with nuclear receptor themselves (31).

To unravel the molecular basis for the observed constitutive histone H3 and H4 acetylation, we first compared the level of expression of SMRT in P19 and HeLa cells by Western blot analysis. As shown in Fig. 2AGo, SMRT was detected in these cell lines in equal amounts and localized mostly to the nucleus, ruling out a regulation via nuclear exclusion. Nuclear localization of SMRT was also confirmed by immunocytochemistry, and similar results were obtained for NCoR (data not shown). The SMRT polypeptide displays a much higher affinity for RAR compared with NCoR (32) (Fig. 2Go, C and D). We therefore tested the functionality of SMRT in P19 cells using the one-hybrid system. As shown in Fig. 2BGo, transfection of increasing amounts of a Gal4DBD-SMRT expression vector led to a strong inhibition of the basal level of expression of a Gal4-tk luc promoter (>80% at 50 ng).


Figure 2
View larger version (27K):
[in this window]
[in a new window]
  		Fig. 2. Absence of Corepressor-RAR/RXR Heterodimer Interaction in P19 Cells

A, Expression of SMRT in HeLa and P19 cells. A total of 50 µg proteins from nuclear or cytoplasmic extracts was analyzed by Western blotting as described in Materials and Methods, using a polyclonal antibody against SMRT. B, SMRT represses transcription in P19 cells. Increasing amounts of Gal4DBD or Gal4DBD-SMRT expression vectors were transfected together with the Gal4-tk luciferase reporter gene and the luciferase activity was determined as described in Materials and Methods. Results are expressed in fold induction relative to the control. C, Modified mammalian two-hybrid analysis of SMRT and NCoR interactions with RAR/RXR heterodimers on the RARß2-luc promoter. P19 or HeLa cells were transfected with the RARß2-luc reporter and the indicated VP16 fusion proteins. Results are expressed in fold induction compared with VP16-AD control alone. D, Modified mammalian two-hybrid analysis of the SMRT and NcoR interactions with RAR/RXR heterodimers on the synthetic (DR5)3 tk-luc reporter gene. P19 and HeLa cells were transfected as in C with the (DR5)3 tk-luc reporter gene. E, SMRT binding on the RARß2 promoter is dependent on RAR/RXR heterodimer binding to RARE. HeLa cells were transfected with RARß2-luc or the mutated RARß2(xpRARE)-luc and indicated VP16 fusion proteins. F, RAR{alpha} and SMRT loading at the RARß2 promoter in HeLa and P19 cells. ChIPs were carried out as described in Fig. 1Go with an anti-RAR{alpha} or an anti-SMRT antibody.

 
Taken together, these data demonstrate that corepressor complexes are expressed and functional in P19 cells. They further suggest that H3 and H4 constitutive acetylation on the RARß2 promoter may be linked to a specific regulation of corepressor-RAR interaction. To test this hypothesis, we used a modified mammalian two-hybrid assay. A chimeric reporter gene, containing the –124/+14 fragment of the RARß2 promoter driving the luciferase gene (RARß2-luc), was cotransfected in HeLa or P19 cells either with an expression plasmid coding for VP16-AD (activation domain) or a VP16-AD fused to the C-terminal domain [including the nuclear receptor interacting domain (RID)] of NCoR or SMRT (Fig. 2CGo). In HeLa cells, only a marginal activation was observed upon cotransfection of VP16-NCoR (2-fold induction), whereas VP16-SMRT induced a strong activation (10-fold induction) of the reporter system. However, when the same experiment was repeated in P19 cells, no activation could be detected, neither in the presence of VP16-SMRT nor of VP16-NCoR. This suggests that corepressor association to RAR may be defective. Because the RARß2 promoter contains binding sites for several transcription factors (see Fig. 1BGo), we next wanted to establish whether this interaction was dependent solely on the presence of RAR/RXR heterodimer on the promoter. We thus performed a similar two-hybrid assay using a synthetic reporter gene bearing a trimerized RARE hooked to the tk promoter [(DR5)3-tk luc]. As previously shown for the RARß2 promoter, a potent activation (65-fold increase) was observed in HeLa cells when this reporter gene was cotransfected with the VP16-SMRT fusion protein. Again, this activation was much weaker (<10-fold increase) in the presence of VP16-NCoR (Fig. 2DGo). No activation was detected in P19 cells. In addition, mutation in the proximal RARE of the RARß2 promoter completely abolished the reporter gene activity in HeLa cells, demonstrating that the SMRT effect is only carried through RAR/RXR heterodimers (Fig. 2EGo). We therefore wanted to extend these results to the endogenous RARß2 promoter using ChIP assay. In this experiment, we used antibodies directed against RAR{alpha}, expressed predominantly in P19 and HeLa cells (28, 29, 33), and SMRT to immunoprecipitate formaldehyde-cross-linked, sonicated chromatin from untreated HeLa and P19 cells. As shown in Fig. 2FGo, RAR{alpha} could be cross-linked to the RARß2 promoter in HeLa and P19 cells. However, SMRT could be detected only in HeLa cells, thus establishing a direct correlation between the histone acetylation status and SMRT binding at the RARß2 promoter.

Taken together, these results demonstrate that 1) the RXR/RAR heterodimer interacts preferentially with SMRT and 2) this interaction is regulated in a cell-specific manner (P19 vs. HeLa cells).

Akt Signaling Pathway Regulates the Interaction of SMRT with RAR/RXR
Several signaling pathways have been shown to regulate SMRT/nuclear receptor interactions. In particular, MEK-1 and MEK-1 kinase (MEKK-1) kinases can inhibit this interaction (34). However, overexpressing dominant-negative mutants of these kinases had no effect on RXR/RAR-SMRT interaction in P19 cells (data not shown). To identify signaling pathway(s) that could regulate this interaction, we screened a large panel of protein kinases inhibitors for their ability to alter the RXR/RAR-SMRT interaction in HeLa cells. Among them, we found that the PI3K kinase inhibitor LY294002 led to a strong decrease (>70% at 50 µM) of the reporter activity (Fig. 3AGo). We next wanted to know whether this signaling pathway was effective in regulating RXR/RAR-SMRT interaction in P19 cells. We used again our modified two-hybrid system, using the [(DR5)3-tk luc] reporter gene, in which the fusion protein VP16-SMRT is overexpressed, together with either a constitutive active form of Akt1 (Akt-CA) or a dominant-negative form (Akt-dN). As shown in Fig. 3BGo, increasing concentrations of Akt-CA strongly stimulated the luciferase activity, whereas no effect was found upon overexpression of Akt-dN. Similar results were found with the RARß2-luc reporter gene (data not shown). In contrast, expressing increasing amounts of Akt-CA in HeLa cells had no effect, whereas Akt-dN efficiently repressed the luciferase response (supplemental Fig. 1, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org).


Figure 3
View larger version (19K):
[in this window]
[in a new window]
  		Fig. 3. The Akt Signaling Pathway Regulates SMRT-RAR/RXR Heterodimer Interaction

A, Inhibition of the interaction between SMRT and RAR/RXR heterodimers by the PI3K inhibitor LY294002. The modified two-hybrid assay was carried out as in Fig. 2Go using the (DR5)3 tk-luc reporter gene. Luciferase activity was assayed 12 h after inhibitor treatment. B, Overexpression of Akt-CA increases the interaction between SMRT and RAR/RXR heterodimers in P19 cells. Cells were transfected as in A with a constitutive active mutant of Akt (Akt-CA) or its dominant-negative counterpart (Akt-dN). C, Akt kinase activity in P19 and HeLa cells. The activity of Akt in cell lysates was assayed by an immunoprecipitation/kinase assay using GSK3 as a substrate. Results are expressed as arbitrary scanning units relative to protein content. A typical fluorogram is shown with duplicate assays.

 
An increased cellular Akt activity is thus correlated to a strong interaction between DNA-bound RXR/RAR heterodimer and SMRT. From this, it can be inferred that a strong RXR/RAR-SMRT interaction in HeLa cells results from a higher Akt activity in this cell line. To test this hypothesis, we evaluated the level of activity of this kinase in P19 and HeLa cells by an immunoprecipitation/kinase assay using glycogen synthase kinase 3 (GSK3) as a substrate. As shown in Fig. 3CGo, Akt activity in HeLa cells was at least four times higher than that detected in P19 cells, demonstrating that SMRT binding efficiency to RAR/RXR heterodimer is strongly correlated to cellular Akt activity.

SMRT Is a Direct Substrate for Akt Kinase
To determine how Akt could regulate RXR/RAR-SMRT interaction, we first analyzed whether a component of the RXR/RAR-SMRT complex was a direct substrate for Akt. Because RXR displays only a very low binding affinity for SMRT, RAR represented a possible target in the RXR/RAR heterodimer. We thus tested the interaction between an immobilized glutathione S-transferase (GST)-RAR{alpha} fusion protein and radiolabeled Akt. No stable interaction could be detected in this system (data not shown). We next tested the ability of Akt to interact with SMRT RID (amino acids 1028 to 1495). As shown in Fig. 4AGo, a specific interaction could be detected between SMRT RID and Akt.


Figure 4
View larger version (36K):
[in this window]
[in a new window]
  		Fig. 4. SMRT is a Substrate for Akt

A, The interaction of 35S-labeled Akt with SMRT (amino acids 982-1495) fused to GST was assayed by GST pull-down experiments. A typical autoradiogram is shown. B, In vitro phosphorylation of SMRT using recombinant Akt. GST or GST-SMRT fusion protein were immobilized on glutathione-agarose beads and incubated with [{gamma}-32P]ATP in the presence of recombinant activated Akt. GSK3 is shown as a control for the activity of Akt. C, Comparison of SMRT phosphorylation by Akt or GSK3. The GST-SMRT fusion protein was immobilized on glutathione-agarose beads and incubated with [{gamma}-32P]ATP in the presence of recombinant activated Akt or GSK3 (duplicate assays).

 
We then performed in vitro phosphorylation reactions using purified components (Fig. 4BGo). Incubation of the activated form of Akt with radiolabeled ATP led to Akt autophosphorylation (Fig. 4BGo, lane 1), whereas GSK3 was efficiently phosphorylated by this kinase (Fig. 4BGo, lane 2). Purified GST was not phosphorylated in these experimental conditions (Fig. 4BGo, lane 3). Incubating increasing amounts of activated Akt with purified GST-SMRT RID led to phosphorylation of GST-SMRT, demonstrating that the SMRT RID moiety is a substrate for Akt (Fig. 4BGo, lanes 4–7).

To assess the specificity of the reaction, we also performed an in vitro phosphorylation reaction using another component of the PI3K/Akt signaling pathway, the GSK3. As shown previously, the GST-SMRT fusion protein was phosphorylated in vitro by Akt kinase (Fig. 4CGo). This phosphorylation was specific because active GSK3 was unable to modify SMRT RID.

Thus, Akt is able to interact with and to phosphorylate SMRT RID, suggesting a possible interference with the RAR-SMRT interaction.

Identification of an Akt Phosphorylation Site in SMRT RID
Analysis of the SMRT amino acid sequence using an algorithm at low stringency identified four potential phosphorylation sites for Akt (35), with three of them being located within SMRT RID (T1112, S1407, S1434) (Fig. 5AGo). We thus introduced single alanine substitutions in the VP16-SMRT fusion protein, generating VP16-SMRT T933A, VP16-SMRT T1112A, VP16-SMRT S1407A, and VP16-SMRT S1434A mutants. Their activities were assayed in the modified two-hybrid assay in HeLa cells using the [(DR5)3-tk luc] reporter gene. As shown in Fig. 5BGo, the T933A, S1407A, and S1434A mutations did not impact on the luciferase response, whereas the T1112A mutation led to a 55% decrease of the reporter activity. We showed above that overexpression of a constitutively active mutant of Akt (Akt-CA) promoted the interaction between SMRT and RXR/RAR heterodimer in P19 cells. In this assay, the T933A, S1407A, and S1434A mutants were sensitive to Akt-CA overexpression, whereas T1112A turned out to be insensitive, clearly indicating that T1112 mediates Akt effect on the SMRT-RXR/RAR interaction (Fig. 5CGo). This effect was specific because the T1112A mutation did not impede on the ability of SMRT to bind RAR in vitro (supplemental Fig. 2, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). Similar results were obtained using the RARß2-luc reporter gene (data not shown).


Figure 5
View larger version (29K):
[in this window]
[in a new window]
  		Fig. 5. Interaction of SMRT Mutants with RXR/RAR Heterodimers in Response to Akt Signaling

A, Schematic representation of the corepressor SMRT and localization of the potential Akt phosphorylation sites. B, Effect of SMRT point mutations on the interaction with RAR/RXR heterodimer in HeLa cells. The mammalian two-hybrid interaction was realized as described in Fig. 2Go with the (DR5)3 tk-luc reporter gene. C, Response of SMRT mutants to Akt signaling in P19 cells. The modified two-hybrid assay was carried out as in Fig. 3BGo with the (DR5)3 tk-luc reporter gene. D, Phosphorylation in vitro of SMRT T1112A. GST-SMRT or GST-SMRT T1112A fusion proteins were immobilized on glutathione-agarose beads and incubated with [{gamma}-32P]ATP in the presence of recombinant activated Akt. Results are expressed as arbitrary scanning units.

 
T1112 is therefore very likely to be a major Akt phosphorylation site. We thus tested the ability of SMRT T1112A mutant to be phosphorylated by purified Akt kinase in vitro. As shown previously, the GST-SMRT fusion protein was phosphorylated in the presence of the activated form of Akt (Fig. 5DGo), whereas the T1112A mutation severely compromised Akt-catalyzed phosphorylation of SMRT RID (3.5-fold decrease).

Effect of Akt Activation on RARß2 Promoter Activity and Retinoid Signaling in P19 Cells
To gain further insights in the role of Akt on the RARß2 promoter activity, we established P19 subclones expressing Akt-CA. Two clones exhibiting distinct levels of Akt-CA expression were selected and characterized (Fig. 6AGo). As shown in Fig. 6BGo, the two clones displayed a reduced basal expression level of the RARß2 gene when compared with wt P19 (see insert). Kinetic experiments at a saturating concentration of atRA (100 nM) showed lower amounts of RARß2 transcripts at all time points for each Akt-CA subclones (>2-fold at 8 h). More importantly, RARß2 transcripts reached a plateau after 4 h, in sharp contrast to wild-type cells, for which the level of RARß2 transcripts continually increased even after 8 h of treatment. In addition, we also observed clearly reduced retinoid response at subsaturating concentration (1 and 10 nM) after a 20-h treatment (supplemental Fig. 3, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org).


Figure 6
View larger version (23K):
[in this window]
[in a new window]
  		Fig. 6. Effect of Akt Hyperactivation on the RARß2 Promoter Activity in P19 Cells

A, Western blot analysis of the Akt-CA content in stable transfected P19 cells. A total of 50 µg of whole-cell extracts was analyzed as described in Materials and Methods using a monoclonal antibody against the HA tag. B, Quantification of RARß2 promoter activity in wt P19, clone 1, and clone 2. Cells were treated with atRA (100 nM) for the indicated time, and RARß2 transcripts were quantified by real-time PCR. Inset represents the basal level of wt P19, clone 1, and clone 2. All experiments were carried out in duplicate.

 
These data show that Akt activation impairs on RARß2 promoter activity in response to retinoic acid.

We then aimed at establishing the ligand-independent recruitment of SMRT on the RARß2 promoter in these two subclones using a ChIP assay. Western blot analysis revealed that similar amounts of SMRT were expressed in the two subclones compared with wt P19 (data not shown). As shown previously, no association of SMRT to the RARß2 promoter could be detected in wt P19 cells (Fig. 7AGo). However, SMRT could be cross-linked to the RARß2 promoter in the absence, but not in the presence of 100 nM atRA in the two subclones. This observation provides direct evidence that SMRT recruitment on the RARß2 promoter is dependent on the level of Akt activation in P19 cells. Paralleling the recruitment of SMRT, ChIP analysis using antibodies specific for the nonacetylated/nonphosphorylated or for acetylated histone H3 demonstrated that the amount of nonmodified H3 increased significantly upon expression of Akt-CA (Fig. 7BGo). We next assessed the effect of atRA treatment on H3 and H4 acetylation status at the RARß2 promoter. We noticed that virtually no H4 acetylation could be detected in the two Akt-CA-expressing clones in the absence of ligand (Fig. 7CGo). Retinoid treatment led to an increase in the level of acetylation of histones H3 and H4 associated with this promoter (2.2- and 2-fold for H3; 3.3- and 2.8-fold for H4), in sharp contrast with wt P19 cells (Fig. 7CGo). As a consequence, a lower amount of RNAP was associated to the RARß2 promoter in the two Akt-CA subclones, which was further increased upon atRA treatment (2.2- and 2.6-fold increase) (Fig. 7DGo). We next examined whether SMRT recruitment impacted on transcriptional elongation by studying histone acetylation levels and density of RNAP on the exon 3 of the RARß2 gene. ChIP analysis revealed a low level of acetylation of H3 and H4 in the absence of ligand. atRA treatment led to a strong increase in both H3 and H4 acetylation levels in wt P19 and in the two P19 Akt-CA subclones (supplemental Fig. 4, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). Low amounts of RNAP were detected on exon 3 in nonstimulated cells, and ligand addition strongly increased RNAP density on exon 3 in each cellular background.


Figure 7
View larger version (32K):
[in this window]
[in a new window]
  		Fig. 7. Histones H3 and H4 Acetylation, RNAP, and SMRT loading at the RARß2 Promoter in P19 and P19 Akt-CA Subclones

A, SMRT loading at the RARß2 promoter in P19 and Akt-CA P19 subclones. Cells were treated with 100 nM atRA for 2 h and subjected to cross-linking by 1% formaldehyde treatment. Chromatin fragments were then immunoprecipitated using antibody against SMRT and analyzed by semiquantitative PCR for the presence of the RARß2 promoter. B, Analysis of H3 acetylation level in P19 and Akt-CA P19 subclones. Cells were subjected to cross-linking by 1% formaldehyde treatment. Chromatin fragments were then immunoprecipitated and analyzed as described in Fig. 1Go. Amplified DNA was quantified by densitometry, and results were expressed as the ratio Ac-H3/H3. C, Analysis of H3 and H4 acetylation levels upon retinoid treatment. P19 and Akt-CA P19 subclones were treated with 100 nM atRA for 2 h and treated with formaldehyde. ChIPs were carried out and analyzed as described in Fig. 1Go. D, Recruitment of RNAP in P19 and Akt-CA P19 subclones. ChIPs were carried out as described in E using an antibody against total RNAP.

 
We conclude from these experiments that Akt, by regulating the interaction of SMRT with RAR/RXR heterodimers, controls histones H3 and H4 acetylation level and RNAP loading at the RARß2 promoter without affecting significantly transcriptional elongation.

P19 cells differentiate into neuronal cells upon retinoic acid treatment during cellular aggregation and the differentiation state is characterized by the expression of the neuron-specific marker ßIII-tubulin. A dose-dependent increase of the expression of this marker was detected in P19 cells after atRA treatment (Fig. 8Go). Although the expression of ßIII-tubulin increased after retinoid treatment in the two P19 Akt-CA clones, the maximal level of expression was lower than that observed in wt P19 cells (2.8- and 2-fold vs. 4.2-fold).


Figure 8
View larger version (13K):
[in this window]
[in a new window]
  		Fig. 8. Impaired Retinoid Response in P19 Cells in Response to Akt Hyperactivation

Impaired neuronal differentiation in response to Akt activation. Aggregated wt P19, clones 1 and 2 were treated with the indicated concentration of atRA as described in Materials and Methods to promote neuronal differentiation. The differentiation was monitored by Western blot analysis of ßIII-tubulin expression, using a polyclonal antibody. Results are expressed as arbitrary scanning units of the ratio ßIII-tubulin/actin, in fold induction relative to the basal activity of wt P19, which was arbitrarily set to 1.

 
Taken together, these data show that Akt activation, and thus SMRT phosphorylation, decreased the sensitivity of P19 cells to retinoid-induced differentiation.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
Although the RARß2 gene is frequently down-regulated in epithelial cancers, the mechanism(s) by which this shutdown occurs remain unclear. It has been shown that a gradual down-regulation process, culminating with the recruitment of DNA methyltransferase and the establishment of a stable, repressed chromatin structure, occurs in cancer cells (10, 36). In this work, we demonstrated that hyperactivation of the PI3K/Akt signaling pathway leads to a stable recruitment of corepressor complexes to the RARß2 promoter, causing its transcriptional down-regulation. Further support for a role of the PI3K/Akt signaling pathway in retinoid resistance comes from recently published reports. A decrease in the growth inhibitory effects of retinoids can be induced in breast cancer cell lines by overexpressing the insulin receptor substrate-1, which correlates with a hyperactivation of the PI3K/Akt pathway (37). Moreover, a subclone of the HL60 leukemia cell line with a constitutive hyperactivated PI3K/Akt pathway displayed also a retinoid-resistant phenotype (38, 39).

We demonstrated in two retinoid-responsive cell lines (P19 embryonal carcinoma and NIH3T3 fibroblasts) that histones H3 and H4 are constitutively acetylated at the RARß2 promoter, and that this acetylation correlates with a lack of stable interaction of RAR{alpha} with the corepressor SMRT. These observations are in agreement with our previously published data. In particular, we demonstrated a specific antagonist of RAR{alpha}, which strengthened corepressor-RAR{alpha} interaction in vitro, exhibited no effect on the acetylation level of the RARß2 promoter in P19 cells (26). These results strongly suggest that CoR, and more especially SMRT, does not interact or interact only very weakly with RAR{alpha} in this cellular background. At this point, we are not sure whether the same phenomenon occurs for other retinoid-responsive genes. Indeed, it has been shown that the structure of the responsive elements as well as its sequence influence the ability of RXR/RAR dimers to recruit cofactors (40, 41).

Regulation of corepressor/nuclear receptor interaction by posttraductional modifications has been already reported. Phosphorylation of SMRT by the mitogen-activated protein kinase kinase 1 (MEK-1) and MEKK-1 results in a nuclear export to perinuclear and cytoplasmic compartments and, thus, to loss of repression by thyroid receptor (34). In contrast, phosphorylation of SMRT by casein kinase II increase the stability of SMRT/thyroid receptor interaction (42). We now show that SMRT is a direct substrate for the serine/threonine kinase Akt, and that the major Akt phosphorylation site maps to the receptor-interaction domain of the SMRT. Akt effect on RXR/RAR-SMRT association occurs most likely through a stabilization of the interaction, because SMRT is present mostly in the nucleus of P19 and HeLa cells (data not shown). In addition, inhibition of the proteasome did not modify the RXR/RAR-SMRT interaction in P19 cells (data not shown), demonstrating that SMRT phosphorylation by Akt did not increase its stability, as demonstrated for several others proteins including Mdm2 (43). It should be noted that NCoR has been reported to be phosphorylated by Akt, leading to its nuclear exclusion and loss of NCoR-mediated repression (44). However, it is unlikely that this regulation could affect RARß2 promoter transcriptional regulation, because NCoR displays a very low affinity for RXR/RAR heterodimers as shown in Fig. 2Go, B and C, and as reported by others (32).

Paralleling the stabilization of RXR/RAR-SMRT interaction, overexpression of Akt-CA in P19 cells resulted in a strong decrease of the basal level of expression of the RARß2 gene. This effect correlates with H3 and H4 deacetylation at the RARß2 promoter. A direct relationship between histone deacetylation and transcriptional repression has been demonstrated for several promoters (45, 46). One of the suggested mechanisms is that histone deacetylation leads to a more compact chromatin structure, which prevents transcription factors access to DNA (47). In this regard, we previously demonstrated that histone acetylation at the RARß2 promoter is necessary for RXR/RAR heterodimer binding to their responsive elements in vitro (48). In addition, we now show that histones H3 and H4 hypoacetylation, found in HeLa cells and P19-Akt CA-expressing clones, correlates with the lack of RNAP binding at the RARß2 promoter. In addition to affecting basal transcription level, Akt-CA overexpression resulted in blunting the transcriptional response to subsaturating (<50 nM) (data not shown) and saturating concentration (>50 nM) concentrations of atRA (Fig. 6BGo). Interestingly, Hazzalin and Mahadevan (49) described recently that altering histone deacetylation/acetylation dynamics at the two immediate-early genes c-fos and c-jun results in an inhibited gene transcription. As demonstrated here for the RARß2 promoter, c-fos and c-jun promoters are constitutively trimethylated on K4 of histone H3, irrespective of their transcriptional activity. K4 methylated H3 tails are subject to a rapid turnover of acetyl group, which is required for efficient c-fos and c-jun induction. In particular, they found that blocking acetyl group turnover at these promoters, using HDAC inhibitors, results in an inhibited c-fos and c-jun expression. Interestingly, we previously demonstrated that the two HDAC inhibitors trichostatin A and sodium butyrate inhibited RARß2 gene expression (25). It is therefore tempting to speculate that altering the dynamics of histone acetylation at the RARß2 promoter through the recruitment of corepressor complexes also leads to a similar effect. These results further suggest that trimethylation on K4 of histone H3 is absolutely required for efficient induction of the RARß2 gene. In this regard, we found that the RARß2 gene expression in HeLa cells is much lower compared with wt P19 cells.

Given the importance of atRA in epithelium maintenance and differentiation, its concentration is tightly controlled. Blood concentrations of atRA ranges from 10–8 to 10–6 M and are believed to be in the nanomolar range in tissues. Thus, altering retinoid sensitivity and response of the RARß2 promoter at these concentrations through Akt activation may be involved in the development of epithelial tumors.

The RARß2 promoter contains a CpG island frequently methylated in cancer cells, and DNA methylation correlates with a lack of expression of the RARß2 gene. Interestingly, Mutskov et al. (50, 51) demonstrated that maintenance of histone acetylation on a promoter is sufficient to prevent its inactivation by DNA methylation, thus emphasizing a possible role of this mechanism in counteracting RARß2 promoter silencing. These observations further suggest that histone deacetylation at the RARß2 promoter must occur before CpG methylation, which then acts as a secondary modification to stabilize the repressive state.

In summary, our studies provide evidence for a direct role of PI3K/Akt signaling pathway in retinoid signaling. Phosphorylation of SMRT by Akt, by regulating its ability to interact with RXR/RAR heterodimers, influences RARß2 gene expression and subsequent biological responses to retinoids.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Materials and Plasmids
atRA was obtained from Sigma (St. Quentin-Fallavier, France) and was reconstituted in dimethylsulfoxide. The PI3K kinase inhibitor LY294002 (2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one) was obtained from Cell Signaling Technology (Beverly, MA) and reconstituted in dimethylsulfoxide.

The reporter plasmids mRARß promoter-luciferase/GL2, mRARß xRARELuc, and (DR5)3-tkLuc and (Gal)3-tkLuc were described elsewhere (25, 26, 52). pSG5-Gal4 SMRT was kindly provided by M. L. Privalsky (Davis, CA). VP16-NCoR and VP16-SMRT expression plasmids were kind gifts from M. Schulz (Giessen, Germany) and D. Leprince (Lille, France), respectively. pCDNA3-HA-Akt CA and pCDNA3-HA-Akt dN were kindly provided by J. R. Testa (Philadelphia, PA). SMRT mutants were constructed by site directed mutagenesis (QuikChange, Stratagene Europe, Amsterdam, The Netherlands) following the manufacturer’s protocol using VP16-SMRT or GST-SMRT (kind gift of J. D. Chen, Boston, MA) as templates. Specific oligonucleotides were used to mutate SMRT residues 933T, 1112T, 1407S, and 1434S into alanine. All constructs were verified by automated sequencing (MWG-Biotech, Roissy-CDG, France).

Cell Culture and Transfection
P19, NIH3T3, and HeLa cells were grown in DMEM Glutamax-1, high glucose (Invitrogen, Cergy-Pontoise, France) supplemented with 10% fetal calf serum (BioWhittaker, Walkersville, MD) plus 100 U penicillin and 100 µg/ml streptomycin (Invitrogen). Transient transfection experiments were performed using the Lipofectamine 2000 reagent (Invitrogen). Luciferase assays were performed with the dual-luciferase assay system (Promega, Charbonnières, France) according to manufacturer’s guidelines. Cell viability for LY294002 experiment has been controlled using the ATP assay Celltiter-glo luminent cell viability assay (Promega) according to manufacturer’s guidelines.

To isolate stably transfected clones, P19 cells were transfected as described previously with the pcDNA3-HA-Akt CA and selected with G418 (200 µg/ml) for 10–15 d (25). Isolated clones were screened for Akt expression (see below).

Neuronal differentiation was induced as follows: P19 cells were aggregated in bacterial-grade petri dishes with the indicated concentration of atRA after mild dissociation of adherent cells using Ca2+/Mg2+-free PBS. After 4 d, aggregates were dissociated with trypsin and replated in tissue culture dishes and allowed to differentiate for 4 more days.

RNA Preparation and Real-Time PCR
P19 cells were grown as described above and treated for the indicated time with 100 nM atRA. Total RNA was prepared using RNeasy Mini-kit (Qiagen, Courtaboeuf, France). Purified RNA was adjusted to 1 µg/µl, and its integrity was assessed by gel electrophoresis. Reverse transcription was performed using random hexamers as recommended by the manufacturer (Promega). cDNAs were analyzed by PCR amplification using the TaqMan PCR master mix (Applied Biosystems, Courtaboeuf, France) and a mix of 18S and mRARß2 primers and probes. The 18S primers, hRARß2 and probes were purchased from Applied Biosystems. The FAM/TAMRA probe and forward and reverse primers for the mRARß2 cDNA were CAGCACCGGCATACTGCTCAA, TCAGTGGATTCACCCAGGC (RAR468F), and TCGGGACGAGCTCCTCAG (RAR557B). Reactions (40 cycles) and data analysis were carried out with an ABI Prism 7700 (PerkinElmer, Courtaboeuf, France). Same efficiency was found for mouse and human RARß2.

ChIP Assays
ChIP protocol were carried out as described previously except for HeLa cells that were cross-linked with 1% formaldehyde at room temperature for 15 min (25, 26). Primers sequences were previously described except for human RARß2 primers used in this study: forward, 5'-GGGAGTTTTTAAGCTCTGTGAG-3', and reverse, 5'-TGAACAGCTCACTTCCTACT-3'. Antibodies used in the studies included the following: acetylated H3 (06-599) and H4 (06-866), nonacetylated or phosphorylated histone H3 (06-755), trimethyl-histone H3 (Lys9) (07-442) and trimethyl-histone H3 (Lys4) (07-473) (Upstate Biotechnology, Lake Placid, NY), SMRT (sc-20778), RAR{alpha} (sc-551), and RNAP (sc-899) (Santa Cruz Biotechnology, Santa Cruz, CA). All ChIP analyses were performed at least in three independent experiments.

Cellular Extracts and Western Blotting
For preparation of whole P19 cell extracts, approximately 107 cells were washed twice in ice-cold PBS and scraped in lysis buffer [50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, protease inhibitor mixture (Sigma)]. The lysate was rotated 1 h at 4 C and centrifuged 15 min at 4 C. Preparation of nuclear and cytoplasmic extracts from P19 and HeLa cells was prepared according to Dignam et al. (53). Proteins were resolved by SDS-PAGE after boiling in SDS sample buffer and transferred onto nitrocellulose membrane (GE Healthcare, Orsay, France). Immunodetection were performed using an anti-SMRTe antiserum or anti-ßIII tubulin (Upstate Biotechnology) and the AP fluorescent substrate system (Promega).

Kinase Assays
Akt activities were assayed from whole-cell lysates according to the manufacturer’s protocol (Cell Signaling Technology). Briefly, cells were lysed and sonicated. Two hundred micrograms of total protein was incubated overnight at 4 C with an anti-Akt agarose-immobilized antibody. Immunoprecipitates were incubated with GST-GSK3{alpha}/ß fusion protein in kinase buffer. Samples were separated by SDS-PAGE, transferred onto nitrocellulose membranes, and probed with an anti-phospho-GSK3{alpha}/ß.

The SMRT in vitro phosphorylation assay was carried out as follows: GST-SMRT fusion proteins were expressed in Escherichia coli and immobilized on glutathione-agarose beads as described previously (48). A total of 0.5 µg GST-SMRT (wild-type or mutant) was incubated with 0.5 µg purified activated Akt or GSK3 (Upstate Biotechnology) in 50 µl kinase buffer [25 mM Tris-HCl (pH 7.5), 5 mM ß-glycerolphosphate, 2 mM dithiothreitol, 0.1 mM Na3VO4, 10 mM MgCl2] with 5 µCi [{gamma}-32P]ATP during 10 min at 30 C. Kinase reactions were terminated by boiling samples in SDS sample buffer, samples were resolved on SDS-PAGE, and gel was autoradiographed.

GST-Pull-down Assays
GST-pull-down experiments were performed as described previously (54, 55).


   ACKNOWLEDGMENTS
 
We express our thanks to members of the Molecular Biology of Nuclear Receptors Group for constant support and helpful discussions. We are grateful to P. Sacchetti for critical comments on the manuscript. We thank M. L. Privalsky, M. Schulz, D. Leprince, J. R. Testa, and J. D. Chen for their kind gifts of plasmids.


   FOOTNOTES
 
This work was supported by Institut National de la Santé et de la Recherche Médicale and Ligue Nationale contre le Cancer.

Present address for B.L., C.B., S.F., and P.L.: Institut National de la Santé et de la Recherche Médicale, Unité 545, Faculté de Médecine Henri Warembourg, 1 Place de Verdun, 59045 Lille cedex, France.

B.L., C.B., S.F., and P.L. have nothing to declare.

First Published Online April 13, 2006

Abbreviations: atRA, All-trans retinoic acid; CA, constitutive active; ChIP, chromatin immunoprecipitation; CoR, corepressor; dN, dominant negative; GSK3, glycogen synthase kinase 3; GST, glutathione S-transferase; HDAC, histone deacetylase; NCoR, nuclear receptor corepressor; PI3K, phosphoinositide 3-kinase; PIP3, phosphatidylinositol-3,4,5-triphosphate; PTEN, phosphatase and tensin homolog; RAR, retinoic acid receptor; RARE, retinoic acid responsive element; RID, receptor interacting domain; RNAP, RNA polymerase II; RXR, retinoid X receptor; SMRT, silencing mediator for retinoic and thyroid hormone receptors.

Received for publication August 4, 2005. Accepted for publication April 3, 2006.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Campbell MJ, Park S, Uskokovic MR, Dawson MI, Koeffler HP 1998 Expression of retinoic acid receptor-ß sensitizes prostate cancer cells to growth inhibition mediated by combinations of retinoids and a 19-nor hexafluoride vitamin D3 analog. Endocrinology 139:1972–1980[Abstract/Free Full Text]
  2. Hoffman AD, Engelstein D, Bogenrieder T, Papandreou CN, Steckelman E, Dave A, Motzer RJ, Dmitrovsky E, Albino AP, Nanus DM 1996 Expression of retinoic acid receptor ß in human renal cell carcinomas correlates with sensitivity to the antiproliferative effects of 13-cis-retinoic acid. Clin Cancer Res 2:1077–1082[Abstract]
  3. Kaiser A, Herbst H, Fisher G, Koenigsmann M, Berdel WE, Riecken EO, Rosewicz S 1997 Retinoic acid receptor ß regulates growth and differentiation in human pancreatic carcinoma cells. Gastroenterology 113:920–929[CrossRef][Medline]
  4. Liu Y, Lee MO, Wang HG, Li Y, Hashimoto Y, Klaus M, Reed JC, Zhang X 1996 Retinoic acid receptor ß mediates the growth-inhibitory effect of retinoic acid by promoting apoptosis in human breast cancer cells. Mol Cell Biol 16:1138–1149[Abstract]
  5. Houle B, Leduc F, Bradley WE 1991 Implication of RARB in epidermoid (Squamous) lung cancer. Genes Chromosomes Cancer 3:358–366[Medline]
  6. Faria TN, Mendelsohn C, Chambon P, Gudas LJ 1999 The targeted disruption of both alleles of RARß2 in F9 cells results in the loss of retinoic acid-associated growth arrest. J Biol Chem 274:26783–26788[Abstract/Free Full Text]
  7. Berard J, Laboune F, Mukuna M, Masse S, Kothary R, Bradley WE 1996 Lung tumors in mice expressing an antisense RARß2 transgene. FASEB J 10:1091–1097[Abstract]
  8. Lin F, Xiao D, Kolluri SK, Zhang X 2000 Unique anti-activator protein-1 activity of retinoic acid receptor ß. Cancer Res 60:3271–3280[Abstract/Free Full Text]
  9. Freemantle SJ, Spinella MJ, Dmitrovsky E 2003 Retinoids in cancer therapy and chemoprevention: promise meets resistance. Oncogene 22:7305–7315[CrossRef][Medline]
  10. Sirchia SM, Ren M, Pili R, Sironi E, Somenzi G, Ghidoni R, Toma S, Nicolo G, Sacchi N 2002 Endogenous reactivation of the RARß2 tumor suppressor gene epigenetically silenced in breast cancer. Cancer Res 62:2455–2461[Abstract/Free Full Text]
  11. Nakayama T, Watanabe M, Yamanaka M, Hirokawa Y, Suzuki H, Ito H, Yatani R, Shiraishi T 2001 The role of epigenetic modifications in retinoic acid receptor ß2 gene expression in human prostate cancers. Lab Invest 81:1049–1057[Medline]
  12. Ivanova T, Petrenko A, Gritsko T, Vinokourova S, Eshilev E, Kobzeva V, Kisseljov F, Kisseljova N 2002 Methylation and silencing of the retinoic acid receptor-ß2 gene in cervical cancer. BMC Cancer 2:4[CrossRef][Medline]
  13. Suh YA, Lee HY, Virmani A, Wong J, Mann KK, Miller Jr WH, Gazdar A, Kurie JM 2002 Loss of retinoic acid receptor ß gene expression is linked to aberrant histone H3 acetylation in lung cancer cell lines. Cancer Res 62:3945–3949[Abstract/Free Full Text]
  14. Lefebvre P, Martin PJ, Flajollet S, Dedieu S, Billaut X, Lefebvre B 2005 Transcriptional activities of retinoic acid receptors. Vitam Horm 70:199–264[CrossRef][Medline]
  15. Glass CK, Rosenfeld MG 2000 The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev 14:121–141[Free Full Text]
  16. Lefebvre P 2001 Molecular basis for designing selective modulators of retinoic acid receptor transcriptional activities. Curr Drug Targets Immune Endocr Metabol Disord 1:153–164[CrossRef][Medline]
  17. Cantley LC 2002 The phosphoinositide 3-kinase pathway. Science 296:1655–1657[Abstract/Free Full Text]
  18. Luo J, Manning BD, Cantley LC 2003 Targeting the PI3K-Akt pathway in human cancer: rationale and promise. Cancer Cell 4:257–262[CrossRef][Medline]
  19. Shayesteh L, Lu Y, Kuo WL, Baldocchi R, Godfrey T, Collins C, Pinkel D, Powell B, Mills GB, Gray JW 1999 PIK3CA is implicated as an oncogene in ovarian cancer. Nat Genet 21:99–102[CrossRef][Medline]
  20. Ma YY, Wei SJ, Lin YC, Lung JC, Chang TC, Whang-Peng J, Liu JM, Yang DM, Yang WK, Shen CY 2000 PIK3CA as an oncogene in cervical cancer. Oncogene 19:2739–2744[CrossRef][Medline]
  21. Bellacosa A, de Feo D, Godwin AK, Bell DW, Cheng JQ, Altomare DA, Wan M, Dubeau L, Scambia G, Masciullo V 1995 Molecular alterations of the AKT2 oncogene in ovarian and breast carcinomas. Int J Cancer 64:280–285[Medline]
  22. Cheng JQ, Ruggeri B, Klein WM, Sonoda G, Altomare DA, Watson DK, Testa JR 1996 Amplification of AKT2 in human pancreatic cells and inhibition of AKT2 expression and tumorigenicity by antisense RNA. Proc Natl Acad Sci USA 93:3636–3641[Abstract/Free Full Text]
  23. Ruggeri BA, Huang L, Wood M, Cheng JQ, Testa JR 1998 Amplification and overexpression of the AKT2 oncogene in a subset of human pancreatic ductal adenocarcinomas. Mol Carcinog 21:81–86[CrossRef][Medline]
  24. Li J, Yen C, Liaw D, Podsypanina K, Bose S, Wang SI, Puc J, Miliaresis C, Rodgers L, McCombie R, Bigner SH, Giovanella BC, Ittmann M, Tycko B, Hibshoosh H, Wigler MH, Parsons R 1997 PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275:1943–1947[Abstract/Free Full Text]
  25. Lefebvre B, Brand C, Lefebvre P, Ozato K 2002 Chromosomal integration of retinoic acid response elements prevents cooperative transcriptional activation by retinoic acid receptor and retinoid X receptor. Mol Cell Biol 22:1446–1459[Abstract/Free Full Text]
  26. Lefebvre B, Ozato K, Lefebvre P 2002 Phosphorylation of histone H3 is functionally linked to retinoic acid receptor ß promoter activation. EMBO Rep 3:335–340[CrossRef][Medline]
  27. Isogai M, Chiantore MV, Haque M, Scita G, De Luca LM 1997 Expression of a dominant-negative retinoic acid receptor construct reduces retinoic acid metabolism and retinoic acid-induced inhibition of NIH-3T3 cell growth. Cancer Res 57:4460–4464[Abstract/Free Full Text]
  28. Brand C, Segard P, Plouvier P, Formstecher P, Danze PM, Lefebvre P 2002 Selective alteration of gene expression in response to natural and synthetic retinoids. BMC Pharmacol 2:13[CrossRef][Medline]
  29. Folkers GE, van der BB, van der Saag PT 1998 Promoter architecture, cofactors, and orphan receptors contribute to cell-specific activation of the retinoic acid receptor ß2 promoter. J Biol Chem 273:32200–32212[Abstract/Free Full Text]
  30. Martin C, Zhang Y 2005 The diverse functions of histone lysine methylation. Nat Rev Mol Cell Biol 6:838–849[Medline]
  31. Jepsen K, Hermanson O, Onami TM, Gleiberman AS, Lunyak V, McEvilly RJ, Kurokawa R, Kumar V, Liu F, Seto E, Hedrick SM, Mandel G, Glass CK, Rose DW, Rosenfeld MG 2000 Combinatorial roles of the nuclear receptor corepressor in transcription and development. Cell 102:753–763[CrossRef][Medline]
  32. Cohen RN, Putney A, Wondisford FE, Hollenberg AN 2000 The nuclear corepressors recognize distinct nuclear receptor complexes. Mol Endocrinol 14:900–914[Abstract/Free Full Text]
  33. Roy B, Taneja R, Chambon P 1995 Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor {alpha} (RAR{alpha})-, RARß-, or RAR{gamma}-selective ligand in combination with a retinoid X receptor-specific ligand. Mol Cell Biol 15:6481–6487[Abstract]
  34. Hong SH, Privalsky ML 2000 The SMRT corepressor is regulated by a MEK-1 kinase pathway: inhibition of corepressor function is associated with SMRT phosphorylation and nuclear export. Mol Cell Biol 20:6612–6625[Abstract/Free Full Text]
  35. Obenauer JC, Cantley LC, Yaffe MB 2003 Scansite 2.0: proteome-wide prediction of cell signaling interactions using short sequence motifs. Nucleic Acids Res 31:3635–3641[Abstract/Free Full Text]
  36. Xu XC, Sneige N, Liu X, Nandagiri R, Lee JJ, Lukmanji F, Hortobagyi G, Lippman SM, Dhingra K, Lotan R 1997 Progressive decrease in nuclear retinoic acid receptor ß messenger RNA level during breast carcinogenesis. Cancer Res 57:4992–4996[Abstract/Free Full Text]
  37. del Rincon SV, Rousseau C, Samanta R, Miller Jr WH 2003 Retinoic acid-induced growth arrest of MCF-7 cells involves the selective regulation of the IRS-1/PI 3-kinase/AKT pathway. Oncogene 22:3353–3360.[CrossRef][Medline]
  38. Neri LM, Borgatti P, Tazzari PL, Bortul R, Cappellini A, Tabellini G, Bellacosa A, Capitani S, Martelli AM 2003 The phosphoinositide 3-kinase/AKT1 pathway involvement in drug and all-trans-retinoic acid resistance of leukemia cells. Mol Cancer Res 1:234–246[Abstract/Free Full Text]
  39. Martelli AM, Tazzari PL, Tabellini G, Bortul R, Billi AM, Manzoli L, Ruggeri A, Conte R, Cocco L 2003 A new selective AKT pharmacological inhibitor reduces resistance to chemotherapeutic drugs, TRAIL, all-trans-retinoic acid, and ionizing radiation of human leukemia cells. Leukemia 17:1794–1805[CrossRef][Medline]
  40. Mouchon A, Delmotte MH, Formstecher P, Lefebvre P 1999 Allosteric regulation of the discriminative responsiveness of retinoic acid receptor to natural and synthetic ligands by retinoid X receptor and DNA. Mol Cell Biol 19:3073–3085[Abstract/Free Full Text]
  41. Hall JM, McDonnell DP, Korach KS 2002 Allosteric regulation of estrogen receptor structure, function, and coactivator recruitment by different estrogen response elements. Mol Endocrinol 16:469–486[Abstract/Free Full Text]
  42. Zhou Y, Gross W, Hong SH, Privalsky ML 2001 The SMRT corepressor is a target of phosphorylation by protein kinase CK2 (casein kinase II). Mol Cell Biochem 220:1–13[CrossRef][Medline]
  43. Feng J, Tamaskovic R, Yang Z, Brazil DP, Merlo A, Hess D, Hemmings BA 2004 Stabilization of Mdm2 via decreased ubiquitination is mediated by protein kinase B/Akt-dependent phosphorylation. J Biol Chem 279:35510–35517[Abstract/Free Full Text]
  44. Hermanson O, Jepsen K, Rosenfeld MG 2002 N-CoR controls differentiation of neural stem cells into astrocytes. Nature 419:934–939[CrossRef][Medline]
  45. Kadosh D, Struhl K 1998 Targeted recruitment of the Sin3-Rpd3 histone deacetylase complex generates a highly localized domain of repressed chromatin in vivo. Mol Cell Biol 18:5121–5127[Abstract/Free Full Text]
  46. Rundlett SE, Carmen AA, Suka N, Turner BM, Grunstein M 1998 Transcriptional repression by UME6 involves deacetylation of lysine 5 of histone H4 by RPD3. Nature 392:831–835[CrossRef][Medline]
  47. Collingwood TN, Urnov FD, Wolffe AP 1999 Nuclear receptors: coactivators, corepressors and chromatin remodeling in the control of transcription. J Mol Endocrinol 23:255–275[Abstract]
  48. Lefebvre P, Mouchon A, Lefebvre B, Formstecher P 1998 Binding of retinoic acid receptor heterodimers to DNA. A role for histones NH2 termini. J Biol Chem 273:12288–12295[Abstract/Free Full Text]
  49. Hazzalin CA, Mahadevan LC 2005 Dynamic acetylation of all lysine 4-methylated histone H3 in the mouse nucleus: analysis at c-fos and c-jun. PLoS Biol 3:e393
  50. Mutskov V, Felsenfeld G 2004 Silencing of transgene transcription precedes methylation of promoter DNA and histone H3 lysine 9. EMBO J 23:138–149[CrossRef][Medline]
  51. Mutskov VJ, Farrell CM, Wade PA, Wolffe AP, Felsenfeld G 2002 The barrier function of an insulator couples high histone acetylation levels with specific protection of promoter DNA from methylation. Genes Dev 16:1540–1554[Abstract/Free Full Text]
  52. Depoix C, Delmotte MH, Formstecher P, Lefebvre P 2001 Control of retinoic acid receptor heterodimerization by ligand-induced structural transitions. A novel mechanism of action for retinoid antagonists. J Biol Chem 276:9452–9459[Abstract/Free Full Text]
  53. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  54. Lefebvre B, Mouchon A, Formstecher P, Lefebvre P 1998 H11–H12 loop retinoic acid receptor mutants exhibit distinct trans-activating and trans-repressing activities in the presence of natural or synthetic retinoids. Biochemistry 37:9240–9249[CrossRef][Medline]
  55. Lefebvre B, Mouchon A, Formstecher P, Lefebvre P 1998 Distinct modes of interaction of the retinoic acid receptor {alpha} with natural and synthetic retinoids. Mol Cell Endocrinol 139:161–169[CrossRef][Medline]

NURSA Molecule Pages Link:

Nuclear Receptors:   RARβ
Coregulators:   NCOR  |  SMRT
Ligands:   all-trans-Retinoic acid



This article has been cited by other articles:


Home page
 Mol. Endocrinol.Home page
M. De los Santos, A. Zambrano, A. Sanchez-Pacheco, and A. Aranda
Histone Deacetylase Inhibitors Regulate Retinoic Acid Receptor {beta} Expression in Neuroblastoma Cells by Both Transcriptional and Posttranscriptional Mechanisms
Mol. Endocrinol., October 1, 2007; 21(10): 2416 - 2426.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
M. V. Karamouzis, P. A. Konstantinopoulos, and A. G. Papavassiliou
The Activator Protein-1 Transcription Factor in Respiratory Epithelium Carcinogenesis
Mol. Cancer Res., February 1, 2007; 5(2): 109 - 120.
[Abstract] [Full Text] [PDF]

Home page
 J. Nutr.Home page
C. W. Xiao, J. Mei, W. Huang, C. Wood, M. R. L'Abbe, G. S. Gilani, G. M. Cooke, and I. H. Curran
Dietary Soy Protein Isolate Modifies Hepatic Retinoic Acid Receptor-{beta} Proteins and Inhibits Their DNA Binding Activity in Rats
J. Nutr., January 1, 2007; 137(1): 1 - 6.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lefebvre, B.
Right arrow Articles by Lefebvre, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lefebvre, B.
Right arrow Articles by Lefebvre, P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals