help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2006-0102
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fretz, J. A.
Right arrow Articles by Pike, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fretz, J. A.
Right arrow Articles by Pike, J. W.
Molecular Endocrinology 20 (9): 2215-2230
Copyright © 2006 by The Endocrine Society

1,25-Dihydroxyvitamin D3 Regulates the Expression of Low-Density Lipoprotein Receptor-Related Protein 5 via Deoxyribonucleic Acid Sequence Elements Located Downstream of the Start Site of Transcription

Jackie A. Fretz, Lee A. Zella, Sungtae Kim, Nirupama K. Shevde and J. Wesley Pike

Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin 53706

Address all correspondence and requests for reprints to: J. Wesley Pike, Department of Biochemistry, University of Wisconsin-Madison, 433 Babcock Drive, Madison, Wisconsin 53706. E-mail: pike{at}biochem.wisc.edu.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The skeleton is a direct target of vitamin D action, where the hormone modulates the proliferation of osteoblast precursors, their differentiation into mature osteoblasts, and their functional activity. Some of these effects of vitamin D are reminiscent of those orchestrated by the Wnt signaling pathway wherein stimulation of the membrane receptor Frizzled and its coreceptor LRP5 leads to activation of ß-catenin and subsequent transcription-mediated changes in osteoblast biology. Indeed, LRP5 is now known to play a particularly important role in bone formation such that the loss of this component results in a reduction in osteoblast number, a delay in mineralization, and a reduction in peak bone mineral density. Interestingly, we discovered during the course of a vitamin D receptor (VDR) chromatin immunoprecipitation/DNA microarray analysis that 1,25-(OH)2D3 could induce binding of the VDR to sites within the Lrp5 gene locus. VDR and retinoid X receptor binding was evident both in primary osteoblasts as well as in osteoblasts of cell line origin. Importantly, this interaction between 1,25-(OH)2D3-activated VDR and the Lrp5 gene led to both a modification in chromatin structure within the Lrp5 locus and the induction of Lrp5 mRNA transcripts in vivo as well as in vitro. One of these sites within the Lrp5 locus was discovered to confer vitamin D response to a heterologous promoter when introduced into osteoblastic cells, permitting both the identification and characterization of the vitamin D response element located within. Interestingly, additional studies revealed that whereas the regulatory region in the mouse Lrp5 gene was highly conserved in the human genome, the vitamin D response element was not. Our studies show that 1,25-(OH)2D3 can enhance the expression of a critical component of the Wnt signaling pathway that is known to impact osteogenesis.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE ACTIONS OF 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3] on the intestine, kidney, and bone are vital to the maintenance of calcium and phosphorus homeostasis, a process that is critical to the integrity of the vertebrate skeleton (1, 2, 3). Central to these actions is the ability of 1,25-(OH)2D3 to diffuse into cells and to interact specifically with an intracellular vitamin D receptor (VDR). This protein, in turn, is capable of binding directly to the regulatory regions of target genes and altering their transcriptional output, actions that are analogous to those of other steroid hormone receptors (2). Regulatory elements or VDREs have been found within many target genes and generally comprise two hexanucleotide half-sites separated by 3 bp (2). For the most part, VDREs are found immediately upstream of transcriptional start sites (TSS), although very recent studies suggest that these sequences can be located at sites that are rather distant from sites of transcriptional action (4). On most target genes, the VDR functions as a heterodimer with a retinoid X receptor (RXR) partner (5). The primary role of this heterodimer is to precipitate the formation of multicomponent complexes that are enzymatic in nature and play direct and unique roles in modulating transcriptional output (1, 6). Selective VDR and RXR DNA binding, therefore, enables the cell to direct its transcriptional machinery to a subset of genes the products of which orchestrate the specific biological response to 1,25-(OH)2D3.

As indicated earlier, bone is a primary target of 1,25-(OH)2D3 action. Early studies have shown that 1,25-(OH)2D3 plays a significant role in controlling mature osteoblast function, particularly as it relates to the secretion of bone matrix and the capacity to promote bone mineralization (7, 8, 9). This role is highlighted by the direct effects of 1,25-(OH)2D3 that have been observed on specific target genes including collagen 1A1, alkaline phosphatase, bone sialoprotein, osteopontin (Opn), and osteocalcin (10). Indeed, initial studies on the mechanism of action of 1,25-(OH)2D3 focused on pinpointing the molecular interactions that occur between the VDR and the regulatory regions of these genes (11, 12). The actions of vitamin D on osteoblasts are much more complex than this, however, and impact such events as early osteoblast precursor cell progression as well as osteoblast proliferation and differentiation (8). These effects are highly cell stage specific, and as a result, have produced an array of diverse and sometimes conflicting observations with respect to osteoblast biology. With regard to proliferation, 1,25-(OH)2D3 is known to suppress c-Myc (13) and to induce the expression of p21 and p27 (14, 15), regulatory proteins that can play critical roles in growth. The effects of 1,25-(OH)2D3 on differentiation, however, are much more intricate. Thus, whereas 1,25-(OH)2D3 modulates the expression of functional genes as described above, the hormone is also able to influence the expression of 1) secreted factors that activate cellular differentiation pathways, 2) components that represent key transducing factors within those pathways, and 3) the transcription factor targets that serve as mediators of these pathways at the level of gene expression. Examples include the ability of vitamin D to modulate factors, such as macrophage colony-stimulating factor (16), TNF{alpha} (17), IL-4 (18), interferon-{gamma} (18), receptor activator of NF{kappa}B ligand (19), and TGFß (20, 21) expression, to activate various components of MAPK signal transduction pathways and to regulate the expression of key osteoblast transcription factors such as Runx2 (22, 23), c-fos, and c-jun (24). Thus, the hormone is likely capable of triggering a broad range of effects on osteoblast proliferation, differentiation, and function.

The canonical Wnt signaling pathway plays a crucial role in osteoblast proliferation and differentiation and thus appears to exert a significant developmental role in bone formation (25, 26, 27). The activity of this pathway is initiated through the interaction between the cell surface receptor Frizzled and one or more members of the Wnt family of signaling molecules. Stimulation leads to inhibition of the activity of glycogen synthase kinase-3ß (GSK3ß) within a GSK3ß/axin/adenomatous polyposis coli/ß-catenin complex, which results in stabilization and redistribution of the transcription factor ß-catenin to the nucleus where it activates lymphoid enhancer factor/T-cell factor-mediated gene transcription. An additional component of the Wnt signaling pathway is LRP5 (and LRP6), a single-pass membrane protein that interacts directly with and serves as a coreceptor for Frizzled (28). One of the functions of LRP5 is to recruit axin from the GSK3ß/axin/adenomatous polyposis coli/ß-catenin complex upon activation, perhaps as a result of dual phosphorylation of the cytoplasmic tail of LRP5 by both GSK3ß and casein kinase-1 (29). Finally, activation of Frizzled and its coreceptor is also regulated by numerous Wnt antagonists such as a secreted form of Frizzled (Frizzled-related proteins) (30) and various members of the Wise/Sclerostin (31) and Dikkopf (Dkk) (32) protein families. Several of these inhibitory actions involve additional membrane proteins such as the Kremens (33). The direct role of the Wnt pathway in the timely production of these antagonists adds additional complexity to the downstream actions of many of the Wnt signaling molecules.

The primary effects of Wnt signaling on osteoblasts is to increase bone mass, both in mouse models as well as in humans (34, 35, 36, 37, 38). Indeed, many of the osteogenic effects of the Wnt signaling pathway were brought to light through early discoveries of the biological consequences associated with aberrant expression of LRP5. Accordingly, it was observed that hypermorphic alleles of LRP5 were associated with high bone mass (34, 36), and loss-of-function mutations in LRP5 were associated with osteoporosis-pseudoglioma syndrome (35). The Lrp5 gene was subsequently inactivated in mice, resulting in a phenotype of low bone mass similar to that seen in osteoporosis-pseudoglioma (38). Importantly, a thorough investigation of the phenotype of this mouse model revealed that the primary effect of Wnt activation was to influence both osteoblast proliferation and function, particularly as it related to both the secretion of bone matrix and subsequent timely mineralization.

During a VDR chromatin immunoprecipitation (ChIP)/DNA microarray analysis (ChIP-chip) screen of genes capable of influencing osteoblast function, we found potential binding sites for this receptor on the Lrp5 gene. A direct ChIP analysis confirmed the presence of the VDR at several of these sites in both primary osteoblasts as well as osteoblast-like cell lines. 1,25-(OH)2D3 activation and VDR binding were correlated directly to subsequent modifications that occurred on chromatin within this locus as well as to increased levels of expression of LRP5 both in vitro and in vivo. The cloning of each of these potential regulatory regions revealed that the major regulatory site could confer vitamin D response to a heterologous promoter. The VDRE sequence located within this region was therefore identified and characterized. Interestingly, the VDRE within the mouse (m) Lrp5 gene was not conserved in the human gene, despite the significant conservation that was apparent in the surrounding region. Our studies identify mLrp5 as a target gene for 1,25-(OH)2D3 and provide a mechanism whereby this hormone can influence the expression of a regulatory component influential in modulating bone formation.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
ChIP-Chip Analysis Reveals VDR/RXR Binding to Regions Located within the mLrp5 Locus
The activity of the VDR is central to the actions of 1,25-(OH)2D3 on bone cells. We therefore carried out a ChIP-chip analysis to identify potential binding sites for the VDR and its RXR partner on a series of candidate genes with the potential to modulate osteoblast differentiation and/or function. ST2 cells that have been previously shown to contain a functional Wnt signaling pathway (35) were treated for 6 h with either vehicle or 1,25-(OH)2D3 and then subjected to a standard ChIP using antibodies to VDR, RXR, or a nonspecific IgG. The precipitated DNA was isolated and amplified, and the individual samples were then labeled with either cyan3 (Cy3) or cyan5 (Cy5) dye (see Materials and Methods). Samples to be compared were cohybridized to a high-density oligonucleotide DNA microarray, which contained a tiled region of potential vitamin D target gene loci from 20 kb upstream of the TSS to 10 kb downstream of the final exon at a resolution of 50 bp. We compared the hybridization signals generated from precipitations using 1) IgG in the presence and absence of hormone, 2) VDR in the absence or presence of hormone, 3) VDR in the presence of hormone vs. input DNA, and 4) RXR in the presence of hormone vs. input DNA for control target genes such as Cyp24a1 and Opn as well as the potential target genes. Figure 1Go illustrates the results of the tiling analysis across the Cyp24a1 gene, highlighting (in orange) the detection of well-known VDR/RXR-binding sites located immediately upstream of the proximal promoter using a number of different comparative conditions. This screen also led to the identification of a number of additional targets of VDR/RXR actions, including that of mLrp5. As illustrated in Fig. 1BGo (and highlighted in orange), an enrichment of VDR and RXR binding was observed at three separate sites across the Lrp5 gene when 1,25-(OH)2D3-induced VDR or RXR binding was contrasted against input DNA. As indicated in the figure, mLrp5-P1 is located immediately downstream of the TSS in intron 1–2, and the two additional sites (mLrp5-P2 and mLrp5-P3) are located at even greater distances downstream in introns 1–2 and 5–6. No VDR/RXR binding was noted upstream of the Lrp5 TSS. Peak finding analysis of these data indicated that binding of the VDR and RXR to the P2 region was considerably more robust than that observed at either mLrp5-P1 or mLrp5-P3 (data not shown). Additional chip comparisons revealed similar peaks of activity. The only exception was the analysis of RXR binding in the absence and presence of hormone, wherein no peaks of activity were observed. These screening data suggest the location of at least three potential intronic VDR/RXR-binding sites on the Lrp5 gene.


Figure 1
View larger version (34K):
[in this window]
[in a new window]
  		Fig. 1. ChIP-Chip Analysis Identifies VDR-Binding Regions in the Mouse Cyp24a1 and Lrp5 Loci

A, ChIP-chip analysis of the Cyp24a1 control target gene. Upper panel: schematic diagram of the mCyp24a1 gene and its 12 exons. Base pair numbering indicates nucleotide location on chromosome 2 (December 2004 Assembly). The arrow indicates the direction of transcription on the reverse strand. Lower panel: individual tracts depict the enrichment ratios of Cy5 to Cy3 of the hybridization intensity (log2) for IgG (plus or minus hormone), VDR (plus or minus hormone), VDR (plus hormone vs. input DNA), and RXR (plus or minus hormone). The x-axis describes nucleotide base pair position on chromosome 2. The highlighted areas indicate the peak of interest and is designated VDRE1/2 for the two VDREs that are known to be located at this site. B, ChIP-chip analysis of the mLrp5 candidate target gene. Upper panel: schematic diagram of the mLrp5 gene and its 23 exons. Base pair numbering indicates nucleotide location on chromosome 19 (December 2004 Assembly). The arrow indicates the direction of transcription on the reverse strand. Lower panel: individual data tracks representing the enrichment ratios of Cy5 to Cy3 of hybridization intensity (log2) for VDR plus hormone vs. input DNA and RXR plus hormone vs. input DNA. Base pair numbering indicates nucleotide location on chromosome 19 (December 2004 Assembly). The highlighted areas indicate peaks of interest that are designated mLrp5-P1, mLrp5-P2, and mLrp5-P3. Chrom, Chromosome.

 
Direct ChIP Analysis Supports Variable VDR/RXR Binding to Lrp5 Intronic Sites in ST2, MC3T3-E1, and Primary Calvarial Osteoblasts
To confirm the potential VDR/RXR-binding sites within the LRP5 gene, we designed several sets of oligonucleotide primers capable of amplifying and detecting the mLrp5-P1, mLrp5-P2, and mLrp5-P3 regions as well as an intervening control region, as indicated in Fig. 2AGo, and conducted a direct ChIP analysis in ST2 and primary calvarial osteoblasts (mOB). Cells were treated with either vehicle or 1,25-(OH)2D3 for 6 h and then subjected to ChIP using antibodies to VDR, RXR, or IgG. As can be seen in Fig. 2BGo, whereas no VDR or RXR binding was detected in the intervening control region or using IgG control precipitations, localization of both receptors was evident at mLrp5-P1 and mLrp5-P2, and weakly at mLrp5-P3. Receptor binding was also evident at the Cyp24a1 promoter control. Interestingly, examination of VDR and RXR binding in primary calvarial osteoblasts suggested that the mLrp5-P2 region may represent the primary target site of 1,25-(OH)2D3 activation because interaction of the receptor at the additional sites was difficult to detect (Fig. 2CGo). We also carried out a similar study in MC3T3-E1 cells wherein we explored not only the ability of 1,25-(OH)2D3 to induce VDR and RXR localization to the P1, P2, and P3 regions of the Lrp5 gene, but also the capacity of a VDR small interfering RNA (siRNA) to suppress this binding. This VDR siRNA pool was previously validated to suppress VDR mRNA levels as well as VDR protein (Ref. 4 , but see also Fig. 3Go). The results observed in Fig. 2DGo confirm that VDR and RXR are also able to interact in MC3T3-E1 cells at mLrp5-P1, mLrp5-P2, and mLrp5-P3 but not in the control region, although, as with the primary osteoblasts, the interaction at mLrp5-P2 was the most significant. Perhaps as important, whereas the above binding was carried out in the presence of a nontargeted siRNA, the addition of a VDR siRNA pool substantially reduced both VDR and RXR binding at all three sites. A similar reduction was also seen using Cyp24a1 as a target. These data confirm that VDR and RXR bind to the P1, P2, and P3 regions of the Lrp5 gene in several osteoblastic cell types, although as seen in the tiling array analysis, murine Lrp5-P2 appears to represent the predominant site of VDR/RXR interaction.


Figure 2
View larger version (62K):
[in this window]
[in a new window]
  		Fig. 2. ChIP Analysis in Osteoblastic Cells Confirms VDR and RXR Binding to the mLrp5 Gene

A, Diagram of portions of the mLrp5 gene relevant to direct ChIP analysis. Exons 1/2 and 5/6 are shown in vertical bars with the position and size of the intervening introns indicated. The TSS and the translational start codon (ATG) are located in exon 1. The locations of the mLrp5-P1, mLrp5-P2, and mLrp5-P3 regions as well as the control segment are boxed. Horizontal pairs of arrows and the numbering indicate the general location and nucleotide position (relative to the TSS) of the primer pairs used in the ChIP analysis. B, ChIP analysis of 1,25-(OH)2D3-induced VDR binding to the Lrp5 gene in ST2 cells. Cells were treated with either vehicle or 1,25-(OH)2D3 (10–7 M) for 6 h and then subjected to ChIP analysis using antibodies to either VDR, RXR, or nonspecific IgG. The DNA precipitates were recovered and subjected to 30 cycles of PCR using the primers depicted in panel A. Amplification of input DNA (0.2% of sample) is also shown. VDR and RXR binding to the Cyp24a1 gene promoter was used as a positive control. C, ChIP analysis of 1,25-(OH)2D3-induced VDR binding to the Lrp5 gene in primary calvarial osteoblasts. Cells were treated with either vehicle or 1,25-(OH)2D3 (10–7 M) for 3 h and then subjected to ChIP analysis as described in panel B. C, VDR siRNA reduces VDR binding to the mLRP5 gene. MC3T3-E1 cells were transfected with 50 nM nontargeted siRNA or VDR siRNA as described in Materials and Methods. After 48 h, cells were treated for an additional 6 h with either vehicle or 1,25-(OH)2D3 (10–7 M) and then subjected to ChIP analysis as described in panel B. ctrl, Control; IP, immunoprecipitation; siNonT, small interfering nontargeted; siVDR, small interfering VDR.

 

Figure 3
View larger version (56K):
[in this window]
[in a new window]
  		Fig. 3. 1,25-(OH)2D3 Induces Lrp5 mRNA Levels in Vitro via a VDR-Dependent Mechanism

A, 1,25-(OH)2D3 stimulates Lrp5 induction in MC3T3-E1 cells. Cells were treated with either vehicle or 1,25-(OH)2D3 (10–7 M) for the periods indicated, and the isolated RNA was subjected to RT-PCR using primers specific to either control mouse ß-actin (15 cycles), Cyp24a1 (25 cycles), Opn (15 cycles), or to mLrp5 (23 cycles). The results shown are typical of several independent experiments. B, Effects of VDR siRNA on 1,25-(OH)2D3-induced Lrp5 mRNA expression levels in MC3T3-E1 cells. Cells were transfected with 20 nM nontargeted siRNA or mVDR siRNA. After 48 h, the cells were treated for an additional 6 h with either vehicle or 1,25-(OH)2D3 (10–7 M). Total RNA was isolated and subjected to standard RT-PCR analysis using primers identified in Materials and Methods. The cycle number for amplification of each individual transcript is as follows: VDR (20 cycles), Lrp5 (23 cycles), Cyp24a1 (25 cycles), and ß-actin (15 cycles). These results are typical of several independent experiments. C, Stage-specific induction of the mLrp5 gene by 1,25-(OH)2D3. MC3T3-E1 cells were grown to 80% confluence (d 0) and then treated with 1,25-(OH)2D3 (10–7 M) at the time indicated (d 0–1, d 7–8, d 14–15, and d 21–22) for a 24-h period. RNA was harvested and subjected to RT-PCR analysis as indicated in panel A. D, Effects of 1,25-(OH)2D3 on mLrp5 regulation in vivo. Female C57Bl6 mice (n = 3/group) were treated with a single dose of 1,25-(OH)2D3 (10 ng/g body wt) via ip injection. The calvaria were then harvested after 0, 1, 3, and 6 h, and the isolated RNA was subjected to qRT-PCR analysis using ß-actin and Lrp5 primers as described in Materials and Methods. Lrp5 measurements were normalized to ß-actin levels with each point representing the mean ± SEM. Differences were determined by Student’s one-tailed t test (*, P < 0.05 in comparison to vehicle). NT, No treatment; siNonT, small interfering nontargeted; siVDR, small interfering VDR.

 
1,25-(OH)2D3 Induces Lrp5 Expression via the VDR in Osteoblasts in Vitro and in Mouse Bone in Vivo
Having established a 1,25-(OH)2D3-stimulated interaction between the VDR and the Lrp5 gene, we next examined whether this interaction was capable of inducing Lrp5 gene expression. MC3T3-E1 cells were plated overnight at low density and treated with vehicle or 1,25-(OH)2D3 for periods ranging up to 24 h, after which the isolated RNA was evaluated for Lrp5 transcript levels using the primers indicated in Materials and Methods. As can be seen in Fig. 3AGo, the Lrp5 gene was indeed induced by 1,25-(OH)2D3 with a time course of induction similar to that for Opn, which was examined together with Cyp24a1 as controls. We also plated MC3T3-E1 cells as above and then treated the cells with 1,25-(OH)2D3 for a period of 24 h at d 0–1, d 7–8, d 14–15, and d 21–22 to determine whether the effects of 1,25-(OH)2D3 were stage specific. As can be seen in Fig. 3BGo, Lrp5 response was indeed stage specific, because Lrp5 induction was evident only at d 0–1 and d 7–8. No induction was evident at later times during which mineralization generally occurs. That this induction of Lrp5 was indeed dependent upon the VDR was demonstrated using a VDR knockdown study. MC3T3-E1 cells were first exposed to either nontargeted siRNA or VDR siRNA for a period of 48 h and then treated for an additional 6 h with either vehicle or 1,25-(OH)2D3. The isolated RNA was subsequently evaluated for the expression of VDR, Cyp24a1, and Lrp5 as well as ß-actin using RT-PCR. As can be seen in Fig. 3CGo, the reduction in VDR transcripts [as well as prevention of its up-regulation by 1,25-(OH)2D3] abrogated the ability of 1,25-(OH)2D3 to induce both Lrp5 and the known target gene Cyp24a1. In a final experiment, we asked whether 1,25-(OH)2D3 was capable of inducing Lrp5 in vivo. Groups of wild-type C57BL6 mice were treated with a single dose of 1,25-(OH)2D3 (10 ng/g body wt) for periods up to 6 h, calvarial tissue was then harvested, and the isolated RNA was subjected to qRT-PCR using primers capable of amplifying Lrp5 and ß-actin mRNA. The results in Fig. 3DGo document that Lrp5 is induced by 1,25-(OH)2D3 in a time-dependent fashion. These results suggest that 1,25-(OH)2D3 is capable of inducing Lrp5 expression in bone cells both in vitro and in vivo and that this induction is mediated by both VDR and its RXR partner through an interaction with the P1–P3 regions of Lrp5.

The P2 Region of the mLrp5 Gene Confers 1,25-(OH)2D3 Response to a Heterologous Promoter
The downstream locations of the regulatory regions within the Lrp5 gene preclude their transcriptional analysis in the context of the natural Lrp5 promoter. We therefore amplified each of these regions of approximately 400 bp as seen in Fig. 4AGo, cloned them into a thymidine kinase (TK) promoter-reporter plasmid, and assessed their ability to confer 1,25-(OH)2D3 response after transfection into MC3T3-E1 cells. As can be seen in Fig. 4BGo, only the mLrp5-P2 fragment showed enhanced transcriptional activation in response to 1,25-(OH)2D3. Importantly, this response to 1,25-(OH)2D3 was independent of, but also enhanced by, the addition of increased amounts of VDR expression vector. The mLrp5-P1 and mLrp5-P3 fragments did not manifest any activity, even at the highest concentrations of coexpressed VDR. These results suggest that the P2 region of the Lrp5 gene is indeed capable of mediating 1,25-(OH)2D3 response. Taken together with the strong ChIP data obtained in this region, they suggest the potential presence of a VDRE within the fragment.


Figure 4
View larger version (29K):
[in this window]
[in a new window]
  		Fig. 4. The mLrp5-P2 Region Mediates Transcriptional Response to Both 1,25-(OH)2D3 and VDR

A, Size and location of the mLrp5 DNA fragments, which were investigated in the context of the TK promoter. The numbering coordinates of the regions are defined relative to the Lrp5 TSS. B, Transcriptional activity and inducibility of the mLrp5 gene fragments mLrp5-P1, mLrp5-P2, and mLrp5-P3. MC3T3-E1 cells were cotransfected with pCH110-ß-gal (50 ng) and either ptk-mLrp5-P1-luc, ptk-mLrp5-P2-luc, ptk-mLrp5-P3-luc, or ptk-luc control vector (250 ng), and then treated for 24 h with either vehicle or increasing concentrations of 1,25-(OH)2D3 (10–9 M to 10–7 M). Transfected cells were evaluated for both luciferase and ß-gal activity as described in Materials and Methods. Each point represents the normalized RLU (relative light unit) average ± SEM for a triplicate set of transfections. * Indicates significance at P < 0.001 (one-way ANOVA). C, Transcriptional activity of the mLrp5-P2 region as a function of VDR levels. MC3T3-E1 cells were cotransfected with pCH110-ßgal, increasing amounts of pcDNA-hVDR, and either ptk-luc control vector, ptk-mLrp5-P1-luc, ptk-mLrp5-P2-luc, or ptk-mLrp5-P3-luc (250 ng). Total amount of DNA was normalized using filler DNA. Cells were treated with either vehicle or 1,25-(OH)2D3 (10–7 M) for 24 h and then evaluated for both luciferase and ß-gal activity as described in Materials and Methods. Each point represents fold induction over vehicle.

 
Mapping the VDRE Sequence Located at 19,241/19,255 bp Downstream of the Transcriptional Start Site in the P2 Region of the mLrp5 Gene
Although the entire 600 bp of the originally identified mLrp5-P2 region is not fully conserved across species, there is an island of conservation that is maintained. We therefore scanned this conserved genomic region with a computer algorithm designed to identify VDRE sequences (http://mordor.cgb.ki.se/cgi-bin/CONSITE/consite) and discovered two potential elements, which we designated VDRE A (located 19,197/19,211 bp downstream of the TSS) and VDRE B (located 19,241/19,255 bp downstream of the TSS) (Fig. 5AGo). To determine whether these putative VDREs were active within the context of the mLrp5-P2 region, we used site-directed mutagenesis to alter the sequence of the upstream half-site of each VDRE either separately or together and then examined the effects of these mutations on response to 1,25-(OH)2D3 after transfection into MC3T3-E1 cells. As can be seen in Fig. 5BGo, whereas mutation of the half-site located in VDRE A had no effect on the transcriptional activity of mLrp5-P2, mutagenesis of the half-site located in VDRE B fully compromised hormonal response. Mutation of the half-sites in both VDRE-like sequences also led to inactivation. The results of these experiments support the idea that VDRE B represents the functional regulatory element located in the P2 region of Lrp5.


Figure 5
View larger version (51K):
[in this window]
[in a new window]
  		Fig. 5. The mLrp5-P2 Region Contains a Functional VDRE

A, Conservation of P2 within the mouse, human, and rat Lrp5 genes. Upper panel: the diagram depicts the boxed position of the Lrp5-P2 region located within the intron between exons 1 and 2. The nucleotide and chromosomal position of an analogous region in the human and rat genes are indicated. Lower panel: nucleotide sequence of the P2 region with the mouse, human, and rat Lrp5 gene wherein half-sites of two putative VDREs identified by the CONSITE algorithm are indicated. B, Identification of a functional VDRE within the context of the mLrp5-P2 region. Left panel: nature of the mutations introduced into one half-site of VDRE A and VDRE B or into one half-site of both putative elements via site-directed mutagenesis. The position and sequence of the mutation are indicated. Right panel: transcriptional activity of wild-type and mutant forms of mLrp5-P2. MC3T3-E1 cells were cotransfected with pCH110-ßgal, pcDNA-hVDR, and either ptk-luc control vector, ptk-mLrp5-P2, or the indicated mutant versions of ptk-mLrp5-P2. Cells were treated with either vehicle or increasing concentrations of 1,25-(OH)2D3 (10–7 M) for 24 h and then evaluated for both luciferase and ß-gal activity. Each point represents the normalized relative light unit (RLU) average ± SEM for a triplicate set of transfections. * Indicates significance at P < 0.001; ** indicates significance at P < 0.0001 compared with vehicle-treated controls (one-way ANOVA). mut, Mutant; wt, wild type.

 
VDRE B Is Sufficient to Drive 1,25-(OH)2D3-Dependent Transcription and Interacts Directly with the VDR/RXR Heterodimer
We next tested the capacity of VDRE A and VDRE B to mediate activation of transcription by 1,25-(OH)2D3 in the heterologous context. VDRE A and VDRE B as well as mutant versions of each, as illustrated in Fig. 6AGo, were cloned as single copies into the TK promoter, and their activities were evaluated in response to 1,25-(OH)2D3 after transfection into MC3T3-E1 cells. As can be seen in Fig. 6BGo, only VDRE B retained activity in response to 1,25-(OH)2D3; VDRE A was inactive. The validity of VDRE B as a viable regulatory element was also confirmed through a DNA interaction study with VDR and RXR. Accordingly, the VDR/RXR heterodimer was also able to bind to VDRE B but not VDRE A when assayed by EMSA, as seen in Fig. 6Go, C and D. This binding required the presence of both receptors and was dependent upon the presence of 1,25-(OH)2D3 when the salt conditions were elevated. These studies provide conclusive evidence that VDRE B represents the active regulatory element within the mLrp5-P2 region responsible for mediating the actions of 1,25-(OH)2D3 on Lrp5 gene expression.


Figure 6
View larger version (71K):
[in this window]
[in a new window]
  		Fig. 6. VDRE B in the mLrp5-P2 Region Confers 1,25-(OH)2D3 Response to a Heterologous Promoter

A, VDRE B is active in transcription. The panel illustrates the VDRE constructs used to evaluate the transcriptional activity of potential VDREs. B, Transcriptional activity of VDRE B. MC3T3-E1 cells were cotransfected with pCH110-ßgal, pcDNA-hVDR, and either ptk-luc control vector, ptk-mLRP5 VDRE A, or ptk-mLRP5 VDRE B or mutants of each, respectively. Cells were treated with either vehicle or increasing concentrations of 1,25-(OH)2D3 (10–7 M) for 24 h and then evaluated for both luciferase and ß-gal activity. Each point represents the normalized relative light unit (RLU) average ± SEM for a triplicate set of transfections. * Indicates P < 0.0001 compared with vehicle-treated sample (one-way ANOVA). C, Bandshift analysis of VDR/RXR heterodimer binding to the specific DNA sequence derived from VDRE A or VDRE B of the mLrp5-P2 region. Labeled duplex DNA probes corresponding to mLrp5-P2 VDRE A or mLrp5-P2 VDRE B were incubated with purified VDR and RXR{alpha} in 50 mM KCl (+) or in 150 mM KCl (3x) with or without 1,25-(OH)2D3 as indicated. D, Labeled duplex DNA probes corresponding to mLrp5-P2 VDRE A or mLrp5-P2 VDRE B were incubated (as in C) with increasing molar concentrations of unlabeled probe (1-, 10-, or 100-fold excess) and then subjected to bandshift analysis. Complexes were resolved on 6% nondenaturing polyacrylamide gels, dried, and visualized using autoradiography. mut, Mutant; wt, wild type.

 
VDR/RXR Binding at mLrp5-P2 Induces Modifications of Chromatin and the Recruitment of RNA Polymerase II (pol II)
ChIP analysis, together with our transcriptional and mutagenesis studies, supports the idea that 1,25-(OH)2D3 can induce Lrp5 expression via a VDRE located within the P2 region of the Lrp5 gene. These studies do not, however, preclude the possibility that mLrp5-P1 or mLrp5-P3 or both are also active in Lrp5 regulation in the context of the natural Lrp5 promoter. To the contrary, both VDR and RXR appear to bind to these regions as assessed by ChIP (see Fig. 2Go). We therefore used ChIP analysis to assess whether VDR/RXR binding to each of these regions could be correlated to changes in chromatin structure. MC3T3-E1 cells were treated for 3 h with either vehicle or 1,25-(OH)2D3 and then subjected to ChIP using antibodies to not only VDR and RXR, but tetra-acetylated histone 4, and RNA pol II as well. As expected and seen in Fig. 7AGo, both VDR and RXR bound to the P1–P3 regions of the Lrp5 gene, although binding at P2 was clearly predominant, as observed earlier. As seen in Fig. 7BGo, the time course of binding of VDR was rapid and again predominantly observed on P2. The ChIP analysis depicted in Fig. 7AGo also shows both a strong residual as well as 1,25-(OH)2D3-inducible histone 4 acetylation, which was particularly evident at mLrp5-P1 and mLrp5-P2. Because histone 4 modification is also seen in the control region, it suggests that the acetylation pattern on the Lrp5 gene is potentially very broad. The results in Fig. 7BGo show that this increase in acetylation is time dependent, and again particularly evident at mLrp5-P1, mLrp5-P2, and at the control region. Perhaps most interesting is the observation made in Fig. 7AGo, which indicates that RNA pol II levels are enhanced in response to 1,25-(OH)2D3 at mLrp5-P1–mLrp5-P3. Although the mLrp5-P1 region is located proximal to the TSS, and therefore likely to represent RNA pol II recruitment to a bona fide preinitiation complex, the appearance of RNA pol II at mLrp5-P2 and mLrp5-P3 was surprising. Taken together, these results suggest that mLrp5-P2 and mLrp5-P3, and perhaps mLrp5-P1, represent regulatory enhancer regions capable of both modifying chromatin in response to 1,25-(OH)2D3 induction and VDR/RXR binding, and acting as potential recruitment centers for increasing the RNA pol II levels necessary for enhanced transcription.


Figure 7
View larger version (28K):
[in this window]
[in a new window]
  		Fig. 7. VDR/RXR Heterodimer Binding to the mLrp5-P1–mLrp5-P3 regions of Lrp5 Enhances Chromatin Modification at Histone 4 and Induces the Recruitment of RNA pol II

A, ChIP analysis of 1,25-(OH)2D3-induced VDR and RXR binding, histone acetylation, and RNA pol II presence at the P1–P3 and control regions of the Lrp5 gene. MC3T3-E1 cells were treated with either vehicle or 1,25-(OH)2D3 (10–7 M) for 3 h and then subjected to ChIP analysis using antibodies specific to VDR, RXR, tetra-acetylated histone 4, RNA pol II, or an irrelevant IgG antibody. DNA precipitates were isolated and then subjected to PCR (30 cycles) using the primers whose locations are depicted in Fig. 2AGo. B, ChIP analysis of time-dependent VDR binding and histone acetylation in the VDR gene after 1,25-(OH)2D3 treatment. MC3T3-E1 cells were treated with 1,25-(OH)2D3 (10–7 M) for 0, 15, 30, or 60 min and then subjected to ChIP as in panel A using antibodies to VDR, tetra-acetylated histone 4, or IgG. PCR analysis was carried out as described in panel B. ctrl, Control; RNPII, RNA pol II; AcH4, tetra-acetylated histone 4.

 
1,25-(OH)2D3 Does Not Induce LRP5 in Human Cells Due to a Nonconserved VDRE in LRP5-P2
The Lrp5 gene is conserved in organization and structure across several genomes. The mLrp5-P2 region and the VDRE sequence contained within are also conserved, although key sequence elements in the human gene are not identical (see Fig. 5AGo). To explore whether 1,25-(OH)2D3 might be capable of up-regulating human (h) LRP5 expression, we treated human MG63 cells with 1,25-(OH)2D3 as a function of both dose and time and assessed the effect of these treatments on LRP5 expression by RT-PCR. As documented in Fig. 8Go, A and B, neither treatment resulted in an up-regulation of LRP5 expression. Importantly, ChIP analysis confirmed that 1,25-(OH)2D3 was likewise unable to induce either VDR binding or RNA pol II recruitment to the P2 region of the hLRP5 gene (Fig. 8CGo). Not all cell lines express LRP5, however, suggesting the possibility that the MG63 cell line was not representative of human cells. We therefore cloned the corresponding P2 fragment from the hLRP5 gene into the TK promoter, as indicated in Fig. 9AGo, and assessed the ability of this fragment to mediate 1,25-(OH)2D3 responsiveness directly after transfection into either mouse or human osteoblasts. We also cloned the individual VDREs located within the hLRP5-P2 region and examined their activity as well. As can be seen in Fig. 9Go, B and C, whereas the mLrp5-P2 region manifested its expected response to 1,25-(OH)2D3, neither the hLRP5-P2 region nor the VDREs contained within were capable of conferring hormonal response to the TK promoter. Bandshift analysis confirmed that the lack of response was due to a failure of the VDR/RXR heterodimer to bind to either element. These findings suggest that the minor sequence changes within the human VDRE abrogate the ability of the VDR to bind to the hLRP5 gene and therefore prevent 1,25-(OH)2D3 from enhancing hLRP5 gene expression though this site. Thus, the ability of 1,25-(OH)2D3 to enhance LRP5 activity may be restricted to the mouse gene.


Figure 8
View larger version (41K):
[in this window]
[in a new window]
  		Fig. 8. 1,25-(OH)2D3 Is Unable to Induce or Promote VDR Binding to the hLRP5 Gene in MG63 Cells

A and B, MG63 were treated with increasing concentrations of 1,25-(OH)2D3 (A) or with vehicle or 1,25-(OH)2D3 at 10–7 M for increasing amounts of time (B), after which total RNA was isolated and evaluated. RT-PCR analyses were carried out for both CYP24A1 (26 cycles) and hLRP5 (26 cycles) using the primers described in Materials and Methods. C, MG63 cells were treated with either vehicle or 1,25-(OH)2D3 for periods up to 24 h and then subjected to ChIP analysis using antibodies to VDR, RNA pol II (RNPII), or IgG. Immunoprecipitated DNA was isolated and subjected to PCR analysis using primers designed to detect either the proximal promoter for CYP24A1 or the P2 region of hLRP5.

 

Figure 9
View larger version (28K):
[in this window]
[in a new window]
  		Fig. 9. hLRP5-P2 Is Not Transcriptionally Responsive to 1,25-(OH)2D3 and Does Not Contain a Functional VDRE

A, Structure of the hLRP5-P2 TK reporter vector. B, Structures of the putative hLRP5-VDRE A and LRP5-VDRE B TK constructs as well as corresponding mutant versions of these VDREs. C, Transcriptional activity of hLRP5-P2 and putative hLRP5 wild-type (VDRE A and VDRE B) and mutant VDREs (mutA and mutB) in MG63 cells. Cells were transfected with 50 ng of pcDNA-hVDR and ptk-luc control vector, the mLRP5-P2, hLRP5-P2 vectors, or the various mouse or hVDRE constructs as indicated, and then treated for 24 h with either vehicle or increasing concentrations of 1,25-(OH)2D3. *, P < 0.001; **, P < 0.0001 by one-way ANOVA. D, Bandshift analysis of VDR/RXR heterodimer binding to the specific DNA sequence derived from human VDRE A or VDRE B of the mLrp5-P2 region. Labeled duplex DNA probes corresponding to hLRP5-P2 VDRE A or hLRP5-P2 P2 VDRE B were incubated with purified VDR and RXR{alpha} in the presence of 1,25-(OH)2D3 in the absence or presence of increasing concentrations of homologous unlabeled VDRE probe (1-, 10-, or 100-fold excess) and then subjected to bandshift analysis. Complexes were resolved on 6% nondenaturing polyacrylamide gels, dried, and visualized using autoradiography. mut, Mutant; RLU, relative light unit; wt, wild type; E, ptk-empty vector.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
Many of the biological effects of vitamin D on bone cells overlap with those of key osteoblast signaling pathways (8). Although the similarity of effects of vitamin D could be fortuitous and entirely independent of key extracellular signaling pathway activity, it is also possible that the related effects arise through a direct regulatory action by the steroid hormone on one or more components of these key control pathways. Indeed, vitamin D is known to regulate both signal pathway components as well as many of the transcription factors they target, making this hypothesis a plausible one. In support of this type of activity by vitamin D, we show herein that 1,25-(OH)2D3 is able to induce the expression of Lrp5 in bone cells, a regulatory component with downstream actions that are similar to those of vitamin D. Mechanistically, Lrp5 up-regulation is due to the presence of three control regions located within the gene, at least one of which contains a specific VDRE. Our studies show that 1,25-(OH)2D3 initiates activation of this gene by inducing VDR as well as RXR binding to these regions, an interaction that leads to the modification of chromatin and to the recruitment of RNA pol II. All of these actions are typical of a steroid hormone such as 1,25-(OH)2D3. Interestingly, whereas the P2 region within the mLrp5 gene was generally conserved within the human gene, critical differences were apparent within the VDRE sequence itself. Thus, it was not surprising to find that hLRP5 was not induced by 1,25-(OH)2D3 in a human osteosarcoma cell line. Despite this, our results in the mouse provide a possible secondary mechanism whereby 1,25-(OH)2D3 may impact osteoblast biology.

Our investigation was initiated by exploring the capacity of 1,25-(OH)2D3 to promote VDR and RXR binding to genes with the potential to influence the osteoblast. As described above, Lrp5 was one such candidate. We used a scanning method wherein the DNA sequences across genes of interest were tiled on a DNA microarray at 50-bp resolution and the microarray was then screened with DNA-labeled fragments obtained from ChIP using antibodies to either VDR or RXR. Our approach yielded three potential binding sites for the receptor heterodimer on the Lrp5 gene. Independent ChIP analysis confirmed that these sites were active although the mLrp5-P2 region was the most consistent in all target cells examined. ChIP-chip analysis is now being used to identify binding sites for transcription factors on specific genes as described here (39), as well as to identify regulatory binding sites on genes at a chromosome-wide (40, 41) and genome-wide level (42, 43, 44, 45, 46). We extended our findings by demonstrating that 1,25-(OH)2D3 activation and VDR/RXR binding were associated with functional consequences to the chromatin located within these regions of the Lrp5 gene. That this activity contributes to the up-regulation of Lrp5 gene expression is supported by the ability of 1,25-(OH)2D3 to induce transcription both at the level of the transfected DNA fragment and at the level of increased endogenous Lrp5 mRNA. One caveat to this approach was the finding that mLrp5-P2 was the only fragment active in transcriptional activation in vitro and therefore was the only fragment for which direct mapping studies could be conducted. It is always possible that the receptor binding observed at mLrp5-P1 and mLrp5-P3 in the initial studies could reflect inappropriate cross-linking. It is also possible, however, that although appropriate for mLrp5-P2, the context of the TK promoter was inhibitory for 1,25-(OH)2D3-inducible mLrp5-P1 and mLrp5-P3 activity when measured in the plasmid environment. This lack of context could relate to orientation, the presence or absence of additional binding sites capable of interacting with negative regulators, or to inappropriate chromatin structures within the plasmid. To resolve these discrepancies, future studies will focus on defining VDR/RXR binding sites by alternative means such as in vitro and in vivo footprinting.

The locations of the vitamin D-regulatory regions within Lrp5 gene introns were surprising, because, with a few exceptions, the bulk of the VDREs thus far identified have been located within approximately the first kilobase upstream of the TSS. Early studies identified other hormone-regulatory elements within downstream introns (47), however, suggesting that our results do not establish a new paradigm. More recent studies, however, support this concept (4). Interestingly, the regulatory regions we have identified are located both proximal to the TSS and at extended distances, one at 19.2 kb and the second at 47.5 kb downstream from the Lrp5 TSS. Our results highlight a potential role for chromatin and its reorganization in the regulation of Lrp5 expression. The use of ChIP-chip analysis, which does not manifest inherent distance restrictions, is beginning to reveal that enhancers located at unusual sites relative to the TSS are more common than previously believed and that earlier interpretations may have been limited by the techniques employed (48, 49, 50).

1,25-(OH)2D3 enhancer activity at the mLrp5-P1–mLrp5-P3 sites was also associated with the recruitment of RNA pol II. This finding suggests these regulatory regions may also function as recruitment centers for RNA pol II and perhaps other members of the basal transcriptional apparatus. Recent studies suggest that enhancers may serve this role, thereby blurring the lines between promoter and enhancer identity (51). Although the ability of an enhancer to enrich the local environment of a gene with transcription factors might facilitate transcriptional regulation, this function would seem to require a transfer system whereby such factors might be actively delivered directly to a promoter. Such a system appears to be true of the ß-globin locus where RNA pol II first accumulates at the upstream locus control region before its appearance at the promoter regions of specific genes (reviewed in Ref. 52). Our future research is now focused on delineating these potential transfer mechanisms.

In conclusion, we show that 1,25-(OH)2D3 is able to up-regulate the expression of Lrp5 transcripts in osteoblasts. This up-regulation is mediated by the VDR, which binds directly to at least one downstream intronic VDRE and induces functional consequences with respect to Lrp5 expression. Although Lrp5 expression is a critical component to the actions of the Wnts in bone development and formation, the essentiality of this component to vitamin D effects in bone cell proliferation, differentiation, and function is the subject of future studies.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Reagents
General biochemical reagents were obtained from Fisher Scientific (Pittsburgh, PA) and Sigma Chemical Co. (St. Louis, MO). 1,25-(OH)2D3 was acquired from Solvay (da Weesp, The Netherlands). Oligonucleotide primers were purchased from Integrated DNA Technologies, Inc. (Coralville, IA). Anti-VDR (H-81) and RXR ({Delta}N197) antibodies were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Antitetraactetylated histone 4 (no. 06–866) antibodies were purchased from Upstate (Charlottesville, VA). Anti-RNA pol II antibody (8WG16) was obtained from Berkley Antibody Co. (Richmond, CA). Lipofectamine Plus was purchased from Invitrogen (Carlsbad, CA). [{gamma}-32P]dATP was obtained from NEN Life Science Products, Inc. (Boston, MA).

Animal Studies
C57BL6 wild-type mice were purchased from Harlan Sprague Dawley (Indianapolis, IN). Mice (8 wk of age) were dosed by ip injection of 1,25-(OH)2D3 (10 ng/g body weight). Groups of animals (n = 3) were killed at 0, 1, 3, and 6 h, and calvarial tissue was collected for RNA isolation (see below). Experimental protocols were reviewed and approved by the Research Animal Resources Center (University of Wisconsin-Madison, Madison, WI).

Cell Culture
Calvarial mOB cells were prepared as previously described (53). MC3T3-E1 cells and mOBs were cultured in {alpha}-MEM Earle’s medium purchased from Mediatech (Herndon, VA). ST2 cells were cultured in {alpha}-MEM from Invitrogen. MG63 cells were cultured in DMEM and supplemented with 1% nonessential amino acids purchased from Invitrogen. MC3T3-E1, ST2, and MG63 cell media were supplemented with 10% heat-inactivated standard fetal bovine serum from Hyclone Laboratories (Logan, UT). mOB cultures were supplemented with 10% heat-inactivated certified fetal bovine serum from Invitrogen. All media were maintained with 1% penicillin/streptomycin obtained from Invitrogen.

ChIP Assay
ChIP assays were performed as previously described (6). Primer sets used for amplifying mLRP5 regions of interest included mLrp5-P1 (forward, CTGCTGTCGCTTTGACCTG; reverse, GCGTTTCCAACTGCTTCGT), mLrp5-P2 (forward, GCCTGGTGCCTCCTGTTA; reverse, GGGGTGCTCTGGGACATTAC), mLrp5-P3 (forward, GGTGAGCCATTCAGGCAAT; reverse, CCGAGAGAGACCGTAAACAG), mLrp5 internal control (forward, GAGGAACCCGTAGGACCAG; reverse, GTCAGGGACAGGACAGGAGT), and hLRP5-P2 (forward, GGACACAAAGCTTTCAGGGAAAACTGCTT; reverse, TAATGCGGATCCGGGTGAAGGGCTTGCCT). Primer sets used for amplifying mCyp24a1 (forward, GGTTATCTCCGGGGTGGAGT; reverse, AGTGGCCAATGAGCACGC) and hCYP24A1 (forward, CGAAGCACACCCGGTGAACT; reverse, CCAATGAGCACGCAGAGGAG) were employed as positive controls.

Tiled Oligonucleotide Microarray Analysis
ChIP-chip analysis was carried out as described by others (45). In brief, DNA was isolated by specific immunoprecipitation using the ChIP methodology outlined above and then subjected to ligation-mediated PCR (45). DNA samples immunoprecipitated during the ChIP analysis using VDR, RXR, and IgG, as well as input DNA (10 ng), were blunt-ended by incubating with T4 DNA polymerase from New England Biolabs (Ipswich, MA) for 1 h and then purified with the Qiaquick PCR purification kit from QIAGEN (Valencia, CA). Double-stranded unidirectional linkers (forward, GCGGTGACCCGGGAGATCTGAATTC; reverse, GAATTCAGATC) were ligated to the blunt-ended DNA overnight at 16 C using T4 DNA Ligase (New England Biolabs). Samples were purified using the Qiaquick PCR purification kit and then PCR amplified to create amplicon stocks. Each 50-µl PCR was performed in the presence of 1 µl of Taq polymerase and 5 µl of 10x Taq polymerase buffer from Promega Corp. (Madison, WI), 0.3 mM deoxynucleotide triphosphates, 1.5 mM MgCl2, 6.5 µl betane (Promega), and 1 µM forward linker primer. PCR was performed by heating to 55 C for 2 min, 72 C for 5 min, and 95 C for 2 min. This was followed by 15 cycles at 95 C for 0.5 min, 55 C for 0.5 min, and 72 C for 1 min, and finished at 72 C for 4 min then holding at 4 C. After each PCR, the samples were purified with the Qiaquick PCR purification kit. Amplification was repeated until 1–10 µg of each sample was generated. The resulting amplicons (~500 bp) were then labeled with Cy3 or Cy5 dyes using an indirect labeling protocol. In this method, biotinylated dUTP was first incorporated into the individual amplicons by standard procedures, and the modified DNA was labeled subsequently with either Cy3- or Cy5-conjugated streptavidin. Cy3- and Cy5-labeled DNA samples were then mixed in the presence of CoT-1 DNA, denatured, and cohybridized to a custom oligonucleotide microarray (Nimblegen Systems, Inc., Madison, WI). The microarrays were washed extensively and scanned using an Axon 4000B scanner at the appropriate wavelengths.

Custom oligonucleotide arrays were synthesized by Nimblegen Systems, Inc. The microarray probes consisted of maskless array, in situ-synthesized 50-mer oligonucleotides at 2-bp intervals representing a 132-kb screen of the mLrp5 gene from 20 kb upstream of the gene’s TSS to 10 kb downstream of the final 3'-noncoding exon. The tiled arrays were synthesized in duplicate in both the forward as well as reverse directions, providing four independent measurements at each site within the gene. In addition, each analysis was carried out using two independently derived ChIP DNA samples. Both mouse Cyp24a1 and Opn genes as well as other candidate VDR target genes (data not shown) were tiled in a similar fashion. A series of comparisons were made between 1) IgG in the presence or absence of hormone, 2) VDR in the presence or absence of hormone, 3) VDR in the presence of hormone vs. input DNA, 4) RXR in the presence or absence of hormone, and 5) RXR in the presence of hormone vs. input DNA. After sample cohybridization, the logarithmic enrichment ratio of Cy5 to Cy3 hybridization intensities (log2) was plotted as a function of chromosome nucleotide position (December 2004 Assembly). Although all the peaks representative of enhanced VDR or RXR binding, either in the presence of 1,25-(OH)2D3 or as compared with input DNA, were evident visually, a peak-finding algorithm was used to score the relative level of binding between the three regions identified (54).

RNA Isolation and Analysis
Total RNA was isolated from homogenized animal tissue or cells using Triazol reagent obtained from MRC (Cincinnati, OH). The isolated RNA was reverse transcribed using the Superscript III RNase H Reverse Transcriptase kit from Invitrogen and then subjected to PCR analysis using Real Time or standard PCR methods. The LightCycler FastStart DNA Master SYBR Green 1 kit used for real time PCR was obtained from Roche (Indianapolis, IN) whereas reactions for semiquantitative PCR were performed using Master Mix purchased from Promega. Primers used included those for m/hß-actin (forward, TGTTTGAGACCTTCAACACCC; reverse, CGTTGCCAATAGTGATGACCT), mCyp24a1 (forward, GTGCGGATTTCCTTTGTGATA; reverse, GGTAGCGTGTATTCACCCAGA), hCYP24A1 (forward, CTTTGCTTCCTTTTCCCAGAAT; reverse, CGCCGTAGATGTCACCAGTC), mLrp5 (real time) (forward, GGGAGAACCCCAAAATCG; reverse, CCAGCAQGTGTGAACCCAAA), mLrp5 (semiquantitative) (forward, CGACCTCACCATTGATTATGCCGAC; reverse, TCTTGTCCGCCCGTTCAATGCTA), hLRP5 (forward, ACCTACGGATCTCGCTGGACAC; reverse, TGCCATCGGGGTCGTTGATCTC), and mOpn (forward, CTAACTACGACCATGAGATTGGCAG; reverse, CTTTAGTTGACCTCAGAAGATGAA).

Plasmids
Full-length hVDR and hRXR{alpha} were cloned into the pET-29b vector obtained from Novagen (Darmstadt, Germany) and expressed with C-terminal 6xHis tags. The pCH110-ß-galactosidase reporter plasmid and the pcDNA-hVDR vector were previously described (55). ptk-mLrp5 P1-luc, ptk-mLrp5 P2-luc, and ptk-mLrp5 P3-luc were prepared by cloning the appropriate mLrp5 DNA fragments obtained through DNA amplification of MC3T3-E1 genomic DNA into the ptk-luc vector using the BamHI and HindIII restriction sites. The same restriction sites were used to insert duplex oligonucleotides with sequence corresponding to VDRE A and B of the mLrp5 P2 region into the ptk-luc vector. Mutagenesis of the VDREs located in the ptk-mLrp5 P2-luc vector was performed using the QuikChange Site-Directed Mutagenesis Kit from Stratagene (San Diego, CA). The human LRP5-P2 region was cloned into the ptk-luc vector by DNA amplification of human Caco2 genomic DNA and by using the BamHI and HindIII restriction sites. The same restriction sites were used to insert duplex oligonucleotides with sequence corresponding to VDRE A and B of the human LRP5-P2 region into the ptk vector.

Transfection Analysis
MC3T3-E1, ST2, mOB, and/or MG63 cells were seeded into 24-well plates (5.0 x 104 cells per well) in the appropriate complete media. Cells were transfected 24 h later with Lipofectamine Plus in serum and antibiotic-free media. Individual wells were transfected with 250 ng of a luciferase-reporter vector, 50 ng of pCH110-ßgal, and the indicated amount of pcDNA-hVDR. After transfection, the cells were cultured in complete media with or without 1,25-(OH)2D3. Cells were harvested 24 h after stimulation, and the lysates were assayed for luciferase and ß-galactosidase activities as previously described (55). Luciferase activity was normalized to ß-galactosidase activity in all cases.

siRNA Studies
All siRNA duplexes were obtained from Dharmacon RNA Technologies (Lafayette, CO). MC3T3-E1 cells were seeded into six-well plates at a concentration of 1.5 x 105 cells per well and transfected approximately 24 h later using Lipofectamine PLUS in serum and antibiotic-free medium. mVDR siRNA (20 or 50 nM) (D-058923–01) or nontargeting siRNA pool (D-001206–13) was used for transfection. After transfection, the cells were cultured in medium supplemented with 10% fetal bovine serum for 48 h before they were treated with a routine concentration of 10–7 M 1,25-(OH)2D3 for 6 h. RNA isolation, ChIP analysis, and standard PCR analysis were carried out using the primers previously documented.

EMSA
Duplex oligonucleotide probes comprised of the mLrp5 VDRE A (AGCTTTTGGTAGGTTCCATGAGTTCCTGGGGTG), mLrp5 VDRE B(AGCTTCAGCTGGGGTCATGCAGGTTCAACGTTG), hLRP5 VDRE A(AGCTTCTGGGCTCCATGGGGTTCTGG), and hLRP5 VDRE B (AGCTTTGGGGTCATTCTCATTCTGC) were end labeled using [{gamma}-32P]dATP. Probes were incubated with 10 ng of hVDR and 5 ng of hRXR{alpha} in 10 mM HEPES (pH 7.4), 1 mM EDTA, 5 mM MgCl2, 10% glycerol, 0.5 mM dithiothreitol, 0.7 mM phenylmethylsulfonylfluoride, and 50 (or 150) mM KCl buffer at room temperature for 30 min. Incubations were performed in the presence or absence of 1,25-(OH)2D3. Protein amounts were doubled when indicated. 1, 10, or 100x unlabeled probe was added to the incubations for the competition bandshift analysis. Complexes were resolved on 6% nondenaturing polyacrylamide gels, dried, and then visualized using autoradiography.

Statistical Analysis
All values are expressed as mean ± SEM. We evaluated differences between groups through one-way ANOVA or Student’s one-tailed t test.


   ACKNOWLEDGMENTS
 
We thank the members of the Pike Laboratory for their individual contributions to this work. We thank Adam Steinberg for preparation of the first figure.


   FOOTNOTES
 
This work was supported by National Institutes of Health Grant DK-72281 (to J.W.P.).

The authors state that they have nothing to declare.

First Published Online April 13, 2006

Abbreviations: ChIP, Chromatin immunoprecipitation; ChIP-chip, chromatin immunoprecipitation/DNA microarray analysis; Cyp24a1 or CYP24A1, 25-hydroxyvitamin D3-24 hydroxylase; Cy3, cyan3; Cy5, cyan5; 1,25-(OH)2D3, 1,25-dihydroxyvitamin D3; mOB, primary calvarial mouse osteoblasts; Opn, osteopontin; qRT-PCR, real-time PCR; RNA pol II, RNA polymerase II; RXR, retinoid X receptor; siRNA, small interfering RNAs; TK, thymidine kinase; TSS, transcriptional start site; VDR, vitamin D receptor; VDRE, vitamin D response element.

Received for publication March 2, 2006. Accepted for publication April 7, 2006.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Sutton AL, MacDonald PN 2003 Vitamin D: more than a "bone-a-fide" hormone. Mol Endocrinol 17:777–791[Abstract/Free Full Text]
  2. Haussler MR, Whitfield GK, Haussler CA, Hsieh JC, Thompson PD, Selznick SH, Dominguez CE, Jurutka PW 1998 The nuclear vitamin D receptor: biological and molecular regulatory properties revealed. J Bone Miner Res 13:325–349[CrossRef][Medline]
  3. Jurutka PW, Whitfield GK, Hsieh JC, Thompson PD, Haussler CA, Haussler MR 2001 Molecular nature of the vitamin D receptor and its role in regulation of gene expression. Rev Endocr Metab Disord 2:203–216[CrossRef][Medline]
  4. Zella LA, Kim S, Shevde NK, Pike JW 2006 Enhancers located within two introns of the vitamin D receptor gene mediate transcriptional autoregulation by 1,25-dihydroxyvitamin D3. Mol Endocrinol 20:1231–1247[Abstract/Free Full Text]
  5. McKenna NJ, Lanz RB, O’Malley BW 1999 Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 20:321–344[Abstract/Free Full Text]
  6. Kim S, Shevde NK, Pike JW 2005 1,25-Dihydroxyvitamin D3 stimulates cyclic vitamin D receptor/retinoid X receptor DNA-binding, co-activator recruitment, and histone acetylation in intact osteoblasts. J Bone Miner Res 20:305–317[CrossRef][Medline]
  7. Ishida H, Bellows CG, Aubin JE, Heersche JN 1993 Characterization of the 1,25-(OH)2D3-induced inhibition of bone nodule formation in long-term cultures of fetal rat calvaria cells. Endocrinology 132:61–66[Abstract/Free Full Text]
  8. Aubin JE, Heersche JNM 2005 Vitamin D and osteoblasts. In: Feldman D, Pike, JW, Glorieux FH, eds. Vitamin D. 2nd ed. Burlington, MA: Elsevier Academic Press; 649–663
  9. Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G 1997 Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 89:747–754[CrossRef][Medline]
  10. Bikle DD 1992 Clinical counterpoint: vitamin D: new actions, new analogs, new therapeutic potential. Endocr Rev 13:765–784[Abstract/Free Full Text]
  11. Staal A, van Wijnen AJ, Birkenhager JC, Pols HA, Prahl J, DeLuca H, Gaub MP, Lian JB, Stein GS, van Leeuwen JP, Stein JL 1996 Distinct conformations of vitamin D receptor/retinoid X receptor-{alpha} heterodimers are specified by dinucleotide differences in the vitamin D-responsive elements of the osteocalcin and osteopontin genes. Mol Endocrinol 10:1444–1456[Abstract/Free Full Text]
  12. Aslam F, McCabe L, Frenkel B, van Wijnen AJ, Stein GS, Lian JB, Stein JL 1999 AP-1 and vitamin D receptor (VDR) signaling pathways converge at the rat osteocalcin VDR element: requirement for the internal activating protein-1 site for vitamin D-mediated trans-activation. Endocrinology 140:63–70[Abstract/Free Full Text]
  13. Brelvi ZS, Studzinski GP 1986 Inhibition of DNA synthesis by an inducer of differentiation of leukemic cells, 1{alpha},25 dihydroxy vitamin D3, precedes down regulation of the c-myc gene. J Cell Physiol 128:171–179[CrossRef][Medline]
  14. Liu M, Lee MH, Cohen M, Bommakanti M, Freedman LP 1996 Transcriptional activation of the Cdk inhibitor p21 by vitamin D3 leads to the induced differentiation of the myelomonocytic cell line U937. Genes Dev 10:142–153[Abstract/Free Full Text]
  15. Inoue T, Kamiyama J, Sakai T 1999 Sp1 and NF-Y synergistically mediate the effect of vitamin D(3) in the p27(Kip1) gene promoter that lacks vitamin D response elements. J Biol Chem 274:32309–32317[Abstract/Free Full Text]
  16. Rubin J, Fan X, Thornton D, Bryant R, Biskobing D 1996 Regulation of murine osteoblast macrophage colony-stimulating factor production by 1,25(OH)2D3. Calcif Tissue Int 59:291–296[CrossRef][Medline]
  17. Hakim I, Bar-Shavit Z 2003 Modulation of TNF-{alpha} expression in bone marrow macrophages: involvement of vitamin D response element. J Cell Biochem 88:986–998[CrossRef][Medline]
  18. Staeva-Vieira TP, Freedman LP 2002 1,25-Dihydroxyvitamin D3 inhibits IFN-{gamma} and IL-4 levels during in vitro polarization of primary murine CD4+ T cells. J Immunol 168:1181–1189[Abstract/Free Full Text]
  19. Atkins GJ, Kostakis P, Pan B, Farrugia A, Gronthos S, Evdokiou A, Harrison K, Findlay DM, Zannettino AC 2003 RANKL expression is related to the differentiation state of human osteoblasts. J Bone Miner Res 18:1088–1098[CrossRef][Medline]
  20. Staal A, Van Wijnen AJ, Desai RK, Pols HA, Birkenhager JC, Deluca HF, Denhardt DT, Stein JL, Van Leeuwen JP, Stein GS, Lian JB 1996 Antagonistic effects of transforming growth factor-ß on vitamin D3 enhancement of osteocalcin and osteopontin transcription: reduced interactions of vitamin D receptor/retinoid X receptor complexes with vitamin E response elements. Endocrinology 137:2001–2011[Abstract]
  21. Gurlek A, Kumar R 2001 Regulation of osteoblast growth by interactions between transforming growth factor-ß and 1{alpha},25-dihydroxyvitamin D3. Crit Rev Eukaryot Gene Expr 11:299–317[Medline]
  22. Lian JB, Stein JL, Stein GS, Montecino M, van Wijnen AJ, Javed A, Gutierrez S 2001 Contributions of nuclear architecture and chromatin to vitamin D-dependent transcriptional control of the rat osteocalcin gene. Steroids 66:159–170[CrossRef][Medline]
  23. Lian JB, Stein GS 2003 The temporal and spatial subnuclear organization of skeletal gene regulatory machinery: integrating multiple levels of transcriptional control. Calcif Tissue Int 72:631–637[CrossRef][Medline]
  24. Candeliere GA, Prud’homme J, St-Arnaud R 1991 Differential stimulation of fos and jun family members by calcitriol in osteoblastic cells. Mol Endocrinol 5:1780–1788[Abstract/Free Full Text]
  25. Hartmann C 2006 A Wnt canon orchestrating osteoblastogenesis. Trends Cell Biol 16:151–158[CrossRef][Medline]
  26. Hartmann C, Tabin CJ 2001 Wnt-14 plays a pivotal role in inducing synovial joint formation in the developing appendicular skeleton. Cell 104:341–351[CrossRef][Medline]
  27. Perrimon N, McMahon AP 1999 Negative feedback mechanisms and their roles during pattern formation. Cell 97:13–16[CrossRef][Medline]
  28. Wehrli M, Dougan ST, Caldwell K, O’Keefe L, Schwartz S, Vaizel-Ohayon D, Schejter E, Tomlinson A, DiNardo S 2000 Arrow encodes an LDL-receptor-related protein essential for Wingless signalling. Nature 407:527–530[CrossRef][Medline]
  29. Zeng X, Tamai K, Doble B, Li S, Huang H, Habas R, Okamura H, Woodgett J, He X 2005 A dual-kinase mechanism for Wnt co-receptor phosphorylation and activation. Nature 438:873–877[CrossRef][Medline]
  30. Finch PW, He X, Kelley MJ, Uren A, Schaudies RP, Popescu NC, Rudikoff S, Aaronson SA, Varmus HE, Rubin JS 1997 Purification and molecular cloning of a secreted, Frizzled-related antagonist of Wnt action. Proc Natl Acad Sci USA 94:6770–6775[Abstract/Free Full Text]
  31. Kusu N, Laurikkala J, Imanishi M, Usui H, Konishi M, Miyake A, Thesleff I, Itoh N 2003 Sclerostin is a novel secreted osteoclast-derived bone morphogenetic protein antagonist with unique ligand specificity. J Biol Chem 278:24113–24117[Abstract/Free Full Text]
  32. Glinka A, Wu W, Delius H, Monaghan AP, Blumenstock C, Niehrs C 1998 Dickkopf-1 is a member of a new family of secreted proteins and functions in head induction. Nature 391:357–362[CrossRef][Medline]
  33. Mao B, Wu W, Davidson G, Marhold J, Li M, Mechler BM, Delius H, Hoppe D, Stannek P, Walter C, Glinka A, Niehrs C 2002 Kremen proteins are Dickkopf receptors that regulate Wnt/ß-catenin signalling. Nature 417:664–667[CrossRef][Medline]
  34. Little RD, Carulli JP, Del Mastro RG, Dupuis J, Osborne M, Folz C, Manning SP, Swain PM, Zhao SC, Eustace B, Lappe MM, Spitzer L, Zweier S, Braunschweiger K, Benchekroun Y, Hu X, Adair R, Chee L, FitzGerald MG, Tulig C, Caruso A, Tzellas N, Bawa A, Franklin B, McGuire S, Nogues X, Gong G, Allen KM, Anisowicz A, Morales AJ, Lomedico PT, Recker SM, Van Eerdewegh P, Recker RR, Johnson ML 2002 A mutation in the LDL receptor-related protein 5 gene results in the autosomal dominant high-bone-mass trait. Am J Hum Genet 70:11–19[CrossRef][Medline]
  35. Gong Y, Slee RB, Fukai N, Rawadi G, Roman-Roman S, Reginato AM, Wang H, Cundy T, Glorieux FH, Lev D, Zacharin M, Oexle K, Marcelino J, Suwairi W, Heeger S, Sabatakos G, Apte S, Adkins WN, Allgrove J, Arslan-Kirchner M, Batch JA, Beighton P, Black GC, Boles RG, Boon LM, Borrone C, Brunner HG, Carle GF, Dallapiccola B, De Paepe A, Floege B, Halfhide ML, Hall B, Hennekam RC, Hirose T, Jans A, Juppner H, Kim CA, Keppler-Noreuil K, Kohlschuetter A, LaCombe D, Lambert M, Lemyre E, Letteboer T, Peltonen L, Ramesar RS, Romanengo M, Somer H, Steichen-Gersdorf E, Steinmann B, Sullivan B, Superti-Furga A, Swoboda W, van den Boogaard MJ, Van Hul W, Vikkula M, Votruba M, Zabel B, Garcia T, Baron R, Olsen BR, Warman ML 2001 LDL receptor-related protein 5 (LRP5) affects bone accrual and eye development. Cell 107:513–523[CrossRef][Medline]
  36. Boyden LM, Mao J, Belsky J, Mitzner L, Farhi A, Mitnick MA, Wu D, Insogna K, Lifton RP 2002 High bone density due to a mutation in LDL-receptor-related protein 5. N Engl J Med 346:1513–1521[Abstract/Free Full Text]
  37. Holmen SL, Giambernardi TA, Zylstra CR, Buckner-Berghuis BD, Resau JH, Hess JF, Glatt V, Bouxsein ML, Ai M, Warman ML, Williams BO 2004 Decreased BMD and limb deformities in mice carrying mutations in both Lrp5 and Lrp6. J Bone Miner Res 19:2033–2040[CrossRef][Medline]
  38. Kato M, Patel MS, Levasseur R, Lobov I, Chang BH, Glass DA, 2nd, Hartmann C, Li L, Hwang TH, Brayton CF, Lang RA, Karsenty G, Chan L 2002 Cbfa1-independent decrease in osteoblast proliferation, osteopenia, and persistent embryonic eye vascularization in mice deficient in Lrp5, a Wnt coreceptor. J Cell Biol 157:303–314[Abstract/Free Full Text]
  39. Horak CE, Mahajan MC, Luscombe NM, Gerstein M, Weissman SM, Snyder M 2002 GATA-1 binding sites mapped in the ß-globin locus by using mammalian chIp-chip analysis. Proc Natl Acad Sci USA 99:2924–2929[Abstract/Free Full Text]
  40. Martone R, Euskirchen G, Bertone P, Hartman S, Royce TE, Luscombe NM, Rinn JL, Nelson FK, Miller P, Gerstein M, Weissman S, Snyder M 2003 Distribution of NF-{kappa}B-binding sites across human chromosome 22. Proc Natl Acad Sci USA 100:12247–12252[Abstract/Free Full Text]
  41. Carroll JS, Liu XS, Brodsky AS, Li W, Meyer CA, Szary AJ, Eeckhoute J, Shao W, Hestermann EV, Geistlinger TR, Fox EA, Silver PA, Brown M 2005 Chromosome-wide mapping of estrogen receptor binding reveals long-range regulation requiring the forkhead protein FoxA1. Cell 122:33–43[CrossRef][Medline]
  42. Ren B, Robert F, Wyrick JJ, Aparicio O, Jennings EG, Simon I, Zeitlinger J, Schreiber J, Hannett N, Kanin E, Volkert TL, Wilson CJ, Bell SP, Young RA 2000 Genome-wide location and function of DNA binding proteins. Science 290:2306–2309[Abstract/Free Full Text]
  43. Impey S, McCorkle SR, Cha-Molstad H, Dwyer JM, Yochum GS, Boss JM, McWeeney S, Dunn JJ, Mandel G, Goodman RH 2004 Defining the CREB regulon: a genome-wide analysis of transcription factor regulatory regions. Cell 119:1041–1054[Medline]
  44. Zhang X, Odom DT, Koo SH, Conkright MD, Canettieri G, Best J, Chen H, Jenner R, Herbolsheimer E, Jacobsen E, Kadam S, Ecker JR, Emerson B, Hogenesch JB, Unterman T, Young RA, Montminy M 2005 Genome-wide analysis of cAMP-response element binding protein occupancy, phosphorylation, and target gene activation in human tissues. Proc Natl Acad Sci USA 102:4459–4464[Abstract/Free Full Text]
  45. Oberley MJ, Farnham PJ 2003 Probing chromatin immunoprecipitates with CpG-island microarrays to identify genomic sites occupied by DNA-binding proteins. Methods Enzymol 371:577–596[Medline]
  46. Jin VX, Leu YW, Liyanarachchi S, Sun H, Fan M, Nephew KP, Huang TH, Davuluri RV 2004 Identifying estrogen receptor {alpha} target genes using integrated computational genomics and chromatin immunoprecipitation microarray. Nucleic Acids Res 32:6627–6635[Abstract/Free Full Text]
  47. Slater EP, Rabenau O, Karin M, Baxter JD, Beato M 1985 Glucocorticoid receptor binding and activation of a heterologous promoter by dexamethasone by the first intron of the human growth hormone gene. Mol Cell Biol 5:2984–2992[Abstract/Free Full Text]
  48. Kampa D, Cheng J, Kapranov P, Yamanaka M, Brubaker S, Cawley S, Drenkow J, Piccolboni A, Bekiranov S, Helt G, Tammana H, Gingeras TR 2004 Novel RNAs identified from an in-depth analysis of the transcriptome of human chromosomes 21 and 22. Genome Res 14:331–342[Abstract/Free Full Text]
  49. Bolland DJ, Wood AL, Johnston CM, Bunting SF, Morgan G, Chakalova L, Fraser PJ, Corcoran AE 2004 Antisense intergenic transcription in V(D)J recombination. Nat Immunol 5:630–637[CrossRef][Medline]
  50. Cheng J, Kapranov P, Drenkow J, Dike S, Brubaker S, Patel S, Long J, Stern D, Tammana H, Helt G, Sementchenko V, Piccolboni A, Bekiranov S, Bailey DK, Ganesh M, Ghosh S, Bell I, Gerhard DS, Gingeras TR 2005 Transcriptional maps of 10 human chromosomes at 5-nucleotide resolution. Science 308:1149–1154[Abstract/Free Full Text]
  51. Szutorisz H, Dillon N, Tora L 2005 The role of enhancers as centres for general transcription factor recruitment. Trends Biochem Sci 30:593–599[CrossRef][Medline]
  52. Cao A, Moi P 2002 Regulation of the globin genes. Pediatr Res 51:415–421[Medline]
  53. Takahashi N, Akatsu T, Udagawa N, Sasaki T, Yamaguchi A, Moseley JM, Martin TJ, Suda T 1988 Osteoblastic cells are involved in osteoclast formation. Endocrinology 123:2600–2602[Abstract/Free Full Text]
  54. Glynn EF, Megee PC, Yu HG, Mistrot C, Unal E, Koshland DE, DeRisi JL, Gerton JL 2004 Genome-wide mapping of the cohesin complex in the yeast Saccharomyces cerevisiae. PLoS Biol 2:E259
  55. Yamamoto H, Shevde NK, Warrier A, Plum LA, DeLuca HF, Pike JW 2003 2-Methylene-19-nor-(20S)-1,25-dihydroxyvitamin D3 potently stimulates gene-specific DNA binding of the vitamin D receptor in osteoblasts. J Biol Chem 278:31756–31765[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   VDR
Ligands:   Calcitriol



This article has been cited by other articles:


Home page
 IBMS BoneKEyHome page
J. W. Pike, M. B. Meyer, and M. L. Martowicz
New Techniques in Transcription Research Extend Our Understanding of the Molecular Actions of the Vitamin D Hormone
IBMS BoneKEy, May 1, 2009; 6(5): 169 - 180.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
R. D. Nerenz, M. L. Martowicz, and J. W. Pike
An Enhancer 20 Kilobases Upstream of the Human Receptor Activator of Nuclear Factor-{kappa}B Ligand Gene Mediates Dominant Activation by 1,25-Dihydroxyvitamin D3
Mol. Endocrinol., May 1, 2008; 22(5): 1044 - 1056.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. B. Meyer, L. A. Zella, R. D. Nerenz, and J. W. Pike
Characterizing Early Events Associated with the Activation of Target Genes by 1,25-Dihydroxyvitamin D3 in Mouse Kidney and Intestine in Vivo
J. Biol. Chem., August 3, 2007; 282(31): 22344 - 22352.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fretz, J. A.
Right arrow Articles by Pike, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fretz, J. A.
Right arrow Articles by Pike, J. W.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals