help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2007-0176
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Quignodon, L.
Right arrow Articles by Flamant, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Quignodon, L.
Right arrow Articles by Flamant, F.
Molecular Endocrinology 21 (10): 2350-2360
Copyright © 2007 by The Endocrine Society

A Point Mutation in the Activation Function 2 Domain of Thyroid Hormone Receptor {alpha}1 Expressed after CRE-Mediated Recombination Partially Recapitulates Hypothyroidism

Laure Quignodon, Séverine Vincent, Harald Winter, Jacques Samarut and Frédéric Flamant

Institut de Génomique Fonctionnelle de Lyon (L.Q., S.V., J.S., F.F.), Université Lyon 1, Ecole Normale Supérieure de Lyon, Unité Mixte de Recherche (UMR), Centre National de la Recherche Scientifique 5242-Institut National de la Recherche Agronomique 1288, F-69364 Lyon, France; and University of Tübingen (H.W.), Tübingen Hearing Research Centre, Laboratory of Molecular Neurobiology, 72074 Tübingen, Germany

Address all correspondence and requests for reprints to: Frédéric Flamant, Institut de Génomique Fonctionnelle, Ecole Normale Supérieure de Lyon, 46 allée d’Italie, 69364 Lyon Cedex 07, France. E-mail: Frederic.Flamant{at}ens-lyon.fr.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Thyroid hormones act directly on transcription by binding to TR{alpha}1, TRß1, and TRß2 nuclear receptors, regulating many aspects of postnatal development and homeostasis. To analyze precisely the implication of the widely expressed TR{alpha}1 isoform in this pleiotropic action, we have generated transgenic mice with a point mutation in the TR{alpha}1 coding sequence, which is expressed only after CRE/loxP-mediated DNA recombination. The amino acid change prevents interaction between TR{alpha}1 and histone acetyltransferase coactivators and the release of corepressors. Early expression of this dominant-negative receptor deeply affects postnatal development and adult homeostasis, recapitulating many aspects of congenital and adult hypothyroidism, except in tissues and cells where TRß1 and TRß2 are predominantly expressed. Both respective abundance and intrinsic properties of TR{alpha}1 and TRß1/2 seem to govern specificity of action.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THYROID HORMONES (THs) consist in T3 and its precursor T4, which displays a weaker biological activity. Both molecules are secreted by thyroid gland follicles, but most of T3 synthesis results from T4 deiodination in other organs. T3 binds to nuclear receptor (TRs) present as three different isoforms, TR{alpha}1, TRß1, and TRß2 encoded by the two THRA and THRB genes. TRs bind in a ligand-independent manner to specific response elements, mainly as RXR heterodimers, which are widespread in the genome. Unliganded TRs recruit transcription corepressors. Among these, nuclear receptor corepressor 1 (NcoR1) and silencing mediator for retinoid and TH receptors function as platforms for the recruitment of histone deacetylases. T3 binding results in a displacement of the C-terminal helix of TR, which contains activation function 2 (AF-2). This permits the recruitment of several coactivators complexes, some of them, like steroid receptor coactivator (SRC) 1 and SRC2, having a histone acetyl-transferase activity (1, 2) and destabilizes interactions with histone deacetylase corepressors.

TH signaling exerts multiple effects on postnatal development and the maintenance of homeostasis in adults by directly regulating target gene transcription (3). Previous investigations used various strategies to decrease TH levels. Among several animal models, transgenic mice recently gained popularity, at the expense of thyroidectomized or pharmacologically manipulated rats. In Pax8–/– knockout mice, the only reported primary defect is the absence of thyroid follicular cells (4). Although these animals can receive maternal TH through placenta during fetal development, they usually die within 3 wk after birth, unless they are rescued by TH treatment. The direct and indirect effects of congenital hypothyroidism are difficult to unravel. TR knockouts mice offered new possibilities to solve this problem and allowed attributing specific function to each receptor isoform (5). The broadly expressed TR{alpha}1 appears to be the main regulator of development during the first 3 wk of postnatal, pre-weaning development. This period, somewhat reminiscent of amphibian metamorphosis (6), is marked by a transient increase in TH circulating level. At this time, liganded TR{alpha}1 regulates intestinal remodeling (7), cerebellum development (8), spleen erythropoiesis (9) and bone growth (10). TR{alpha}1 has a later role in setting cardiac function (11) and thermogenesis. TRß1 and TRß2 expression pattern is more restricted. These isoforms are the main regulators of liver function, inner ear development, retinal cones differentiation, and feedback regulation of the hypothalamic-pituitary-thyroid axis.

Surprisingly the deletion of all TR isoforms, obtained by the combination of THRA and THRB knockouts, is not lethal and only partially recapitulates the postnatal consequences of congenital hypothyroidism observed in Pax8–/– mice (12, 13). Several studies support the hypothesis that this discrepancy is due to the negative effect exerted by the unliganded TR{alpha}1 present in hypothyroid Pax8–/– mice, but not in THRA/THRB knockout mice. In line with this, the consequences of TH depletion are attenuated when THRA is deleted (8, 14). Furthermore the consequences of THRA knockout are limited compared with those of THRA knock-in mutations. Three germline knock-in mutations have been introduced in the ligand binding domain of TR{alpha}1. The reading frame mutations have different consequences on ligand binding and cofactor interactions, but all preserve DNA binding and reduce the transcriptional activation ability of TR{alpha}1. Mice heterozygous for these mutations display many features of congenital hypothyroidism, suggesting a constitutive repression of TH target genes (15, 16, 17, 18). The hypothesis that congenital hypothyroidism is mainly due to the negative action of unliganded TR{alpha}1 remains however controversial for several reasons. First, the rescue of Pax8–/– mice by THRA knockout is only partial, and not observed with all THRA alleles (19). Another difficulty is that the consequences of the three THRA knock-in mutations are not identical. For example, obesity has been reported in only one case. For these reasons, several additional hypothesis have been proposed, including the intervention in hypothyroid mice of unliganded TRß (20), of TR{alpha}2, a THRA encoded isoform that is unable to bind T3 (19), or of TH nongenomic effects (21, 22).

We describe here the construction of a new mouse allele for the THRA gene, encoding a TR{alpha}1 receptor with an AF-2 mutation (L400R). According to structural data, the mutation fills a cavity at the surface of the ligand binding domain that is required for histone acetyl transferase coactivators interaction. The mutation prevents histone acetyl transferase recruitment and favors the permanent recruitment of corepressors. This is responsible for a dominant-negative activity exerted on both TR{alpha}1 and TRß receptors in transient expression assays. The genetic construct introduced by homologous recombination in the THRA locus possesses an upstream floxed cassette, allowing for a spatio-temporal expression control of TR{alpha}1L400R expression, using the Cre/loxP recombination system. The phenotypic consequences of an early embryonic recombination of this THRA allele on development and homeostasis closely resemble those of congenital and adult hypothyroidism, except in tissues where THRB function is predominant. We conclude that, although hypothyroidism manifestations mainly results from to the negative action of the ubiquitous unliganded TR{alpha}1, unliganded TRß also contribute in several tissues.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Construction of the TR{alpha}AMI Allele
We introduced in the AF-2 domain of the mouse TR{alpha}1 receptor a point mutation converting a leucine into an arginine (L400R) equivalent to the L454R mutation previously created in the human TRß1 (23, 24). It has been shown previously that this TRß1 mutation fully prevents interaction with the histone acetyl transferase coactivators while preserving interaction with histone deacetylase corepressors (25), resulting in a very strong dominant-negative activity on TR-mediated transactivation. Recently, this mutation has also been shown to prevent an interaction between AF-2 and the hinge region, but the functional significance of this interaction remains unclear (26). We verified, using a proteolysis sensitivity assay, that ligand binding was not abolished by the mutation (data not shown). We used yeast two-hybrid assays to confirm that, whether T3 is present or not, TR{alpha}1L400R interacts with the NcoR histone deacetylase corepressor but not with the SRC1 or SRC2 histone acetyl transferase coactivators (Fig. 1AGo). We then introduced the TR{alpha}1L400R cDNA between two cassettes. The downstream IRESTaulacZ cassette encodes a ß-galactosidase targeted to the cytoskeleton, translated from an encephalomyocarditis virus (ECMV) internal ribosomal entry site (IRES). We placed the entire construct downstream to a CMV transcription promoter (Fig. 1BGo) to perform transient expression assays. The upstream PGKNeoRpolyA cassette confers G418 resistance to eukaryotic cells and contains a simian virus 40 (SV40) polyadenylation signal, which arrests most transcription and prevents any TR{alpha}1L400R translation. Because the upstream PGKNeoRpolyA cassette is flanked by two tandem loxP sequences, CRE-mediated recombination is required to produce a bicistronic mRNA encoding both TR{alpha}1L400R and ß-galactosidase. This design was expected to favor the detection of recombination events in mouse tissues by Xgal staining. Transient expression results confirm that synthesis of both TR{alpha}1L400R protein (Fig. 1CGo) and ß-galactosidase (data not shown) requires previous excision of the PGKNeoRpolyA cassette. TR{alpha}1L400R was not able to activate transcription via a T3 response elements (2xDR4), and exerted a strong dominant-negative effect on transcriptional activation mediated by the wild-type liganded TR{alpha}1 receptor (Fig. 1DGo). A similar dominant-negative action was observed when TRß1 or TRß2 was used for transactivation (data not shown). All these observations lead to the conclusion that the L400R mutation places the TR{alpha}1 receptor in a conformation, equivalent to the unliganded state, that exert a constitutive dominant-negative effect on TR target genes expression.


Figure 1
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 1. Properties of the TR{alpha}1L400R Mutated Receptor

A, Two-hybrid interactions in yeast show that TR{alpha}1L400R can only interact with corepressors. Unlike liganded TR{alpha}1, TR{alpha}1L400R does not interact with SRC1 and SRC2 histone acetyl transferase coactivators. The interaction with the NcoR corepressor is ligand sensitive for TR{alpha}1 but constitutive for TR{alpha}1L400R. B, CMV and phospho-glycerate-kinase (PGK) promoters generate transcripts terminated by the SV40 polyadenylation signal present in the PGKNeoRpolyA cassette. The bicistronic TR{alpha}1L400R and TaulacZ cDNA, located downstream to the SV40 polyadenylation signal, cannot be expressed. Because the PGKNeoRpolyA cassette is flanked by two loxP sequences, CRE-mediated deletion enables TR{alpha}1L400R and TaulacZ synthesis. C, TR{alpha}1L400R expression requires CRE-mediated deletion. Western blotting of mammalian COS7 cells transfected with the CMV construct encoding for TR{alpha}1L400R (1 2 ) or the empty CMV construct (3 ). When the floxed PGKNeoRpolyA cassette is present (1 ), only a nonspecific band is detected, reflecting the absence of TR{alpha}1L400R expression. The CRE-deleted construct (2 ) encodes the expected 44 kDa TR{alpha}1L400R protein. D, TR{alpha}1L400R acts as a dominant-negative receptor. Transient luciferase expression in transfected COS7 cells show that, unlike wild-type TR{alpha}1, TR{alpha}1L400R cannot transactivate a DR4-TK-luc construct in the presence of T3. TR{alpha}1-mediated transactivation is antagonized by increasing amount of TR{alpha}1L400R. A 1/1 ratio leads to a complete inhibition of T3 response.

 
The TR{alpha}1L400R reading frame flanked by the upstream PGKNeoRpolyA and the downstream IRESTaulacZ cassettes, was introduced in the mouse THRA locus by homologous recombination (Fig. 2Go, A and B). In the resulting TR{alpha}AMI allele (AF-2 Mutation, Inducible), the mutation is silent. CRE recombination is required to express TR{alpha}1L400R from its natural promoter, at a level similar to the endogenous TR{alpha}1 receptor. To address the ability of ES cells to express TR{alpha}1L400R after CRE recombination, CRE was transiently expressed in TR{alpha}AMI/+ ES cells and RT-PCR was performed to amplify the 3' part of the TR{alpha}1 cDNA. Because TR{alpha}1L400R cDNA differs from its wild-type counterpart by the presence of a SacII restriction site we digested the PCR product with SacII and confirmed by gel electrophoresis the presence of both type of mRNA in TR{alpha}AMI/+ ES cells after CRE recombination (Fig. 2CGo). ES cells carrying an intact TR{alpha}AMI allele were injected into blastocytes to produce mouse chimeras. After germline transmission, TR{alpha}AMI/+ mice, which express only one intact THRA allele, were obtained. They displayed, as expected, a normal growth and fertility and an apparently normal phenotype. TR{alpha}AMI/TR{alpha}AMI animals, which do not express any THRA isoforms, were obtained at the next generation. These homozygous animals, whose phenotype was not investigated, were able to develop and breed normally, like other THRA knockout mice.


Figure 2
View larger version (36K):
[in this window]
[in a new window]

  		Fig. 2. Generation of the TR{alpha}AMI Allele by Homologous Recombination in Mouse Embryonic Stem Cells

A, Structure of the THRA locus after homologous recombination. From 5' to 3': THRA sequences absent from the recombination vector (black line) 6.5 kb of THRA genomic sequences extending to the noncoding part of exon2 (nucleotide 279 on GenBank No. NC_000077 dark gray box); the PGKNeoRpolyA cassette, providing G418 resistance to ES cells, flanked by two tandem loxP for CRE-mediated deletion; TR{alpha}1L400R encoding sequence; ECMV-IRES element for internal ribosomal entry; TaulacZ coding sequence; 2.9 kb of THRA, starting in exon 9 (nucleotide 22889 on GenBank No. NC_000077 dark gray box), 3' genomic sequences absent from the recombination vector (black line). White arrows indicate the position and orientation of oligonucleotides used for PCR amplification. The SacII restriction site covers the L400R encoding codon. CRE-mediated recombination results in the deletion of the floxed selection cassette, allowing for transcription and translation of the downstream TR{alpha}1L400R and TaulacZ reporter protein. B, PCR confirmation of homologous recombination in the THRA locus in ES cells. Primers a and c amplify a 10.8-kb fragment (2 ), whereas h and j amplify 3.3 kb (4 ) after homologous recombination but not after random DNA integration (1 and 3). C, CRE-mediated recombination in TR{alpha}AMI/+ ES cells triggers TR{alpha}1L400R expression. RT-PCR of RNA purified from ES cells (primers f and g) amplifies 274 bp of TR{alpha}1 cDNA (*) and a nonspecific product (***). SacII digestion releases two fragments (135 bp + 139 bp; **) in ES cells carrying one CRE-deleted TR{alpha}AMI allele (3 ). TR{alpha}1L400R expression is not detected in ES cells carrying wild-type alleles (1 ) or one intact TR{alpha}AMI allele (2 ).

 
Early and Ubiquitous Expression of TR{alpha}1L400R Leads to a Hypothyroid-Like Phenotype
To trigger a broad expression of TR{alpha}1L400R we crossed TR{alpha}AMI/+ mice with SYCP1CRE transgenic mice. These mice have been reported to express the CRE recombinase only during male spermatogenesis (27). We thus expected TR{alpha}AMI/+xSYCP1CRE males to give rise to progenies where a deleted TR{alpha}AMI allele would be in all cells from the beginning of development, and TR{alpha}1L400R expressed ubiquitously. Unlike previous reports, we found that complete excision did not occur in all cases, some TR{alpha}AMI/+xSYCP1CRE males giving rise to offspring with no or partial excision. To circumvent this problem, probably due to variegation in CRE expression, we selected favorable TR{alpha}AMI/+xSYCP1CRE males for further experiments and only considered pups with excision efficiency, as evaluated by PCR, superior to 90% (Fig. 3AGo). We will call these heterozygous mice, which express TR{alpha}1L400R in most tissues, TR{alpha}AMIxS. We performed RT-PCR to demonstrate the presence of a SacII containing TR{alpha}1L400R cDNA in several tissues (data not shown). Q-RT-PCR was also used to evaluate the total expression level of TR{alpha}1 (TR{alpha}1L400R + wild type) in TR{alpha}AMIxS mice. The expression level at P15 was similar to the one observed in wild-type animal in liver with a 3-fold increase in the cerebellum (Table 1Go) and brain (data not shown). This slight augmentation could result from the absence of alternate splicing in the TR{alpha}AMI locus, a phenomenon that normally diverts part of the THRA transcription to produce TR{alpha}2, an isoform which does not bind T3. ß-Galactosidase activity was very weak or undetectable, probably due to low expression level of the THRA locus, and perhaps to limited efficiency of translation initiation at the IRES element.


Figure 3
View larger version (55K):
[in this window]
[in a new window]

  		Fig. 3. Phenotype of TR{alpha}AMIxS Mice

A, TR{alpha}AMIxS mice have lost the PGKNeopolyA cassette. PCR was performed on tail DNA with primers b, d, e (Fig. 2Go) amplifying either 1200 bp (b + e) for the full-length TR{alpha}AMI allele or 800 bp (d + e) for the CRE deleted TR{alpha}AMI allele. Due to the presence of intronic sequences, the intact THRA locus cannot be amplified in these conditions. B, Body growth reduction in TR{alpha}AMIxS mice compared with wild-type littermates. Body weight (g) was measured during 80 d (n = 22). C, Alizarine staining, performed on whole mount skeleton, reveals delayed ossification of long bones (arrow) in TR{alpha}AMIxS mice at P15, clearly visible in posterior limbs. D, Delayed cerebellum development in TR{alpha}AMIxS mice: sagittal section shows the persistence of the external granular layer (arrows) at P21 in TR{alpha}AMIxS cerebellum (hematoxylin staining) but not in control littermates. E, Cold tolerance test: the body temperature of 5 TR{alpha}AMIxS 5-month-old adult females (black lines) and four control female littermate (gray lines) was recorded during 8 h of cold exposure. Three of five animals failed to maintain their body temperature within this time period. F, Purkinje cells dendritic arborization, revealed by calbindin-D28k staining, is visible above cell nuclei. The number and size of dendritic spines is reduced at P15 in TR{alpha}AMIxS cerebellum.

 

View this table:
[in this window]
[in a new window]

  		Table 1. Physiological Parameters of Mice Expressing TR{alpha}1L4004

 
At P15 the fraction of TR{alpha}AMIxS in litters was close to the expected 50% ratio. It seems therefore that expression of the TR{alpha}1L400R expression is compatible with prenatal and early postnatal development of heterozygous mice. By contrast later development was deeply affected, and 48% of the TR{alpha}AMIxS pups did not reach the adult age (n = 61). The development of surviving mice was strongly delayed. Eye opening did not occur before P25, compared with an average of P15 for wild-type littermates. Body growth was greatly reduced (Fig. 3BGo). This correlated with delayed ossification of long bones (Fig. 3CGo), and reduced GH gene expression level in pituitary gland (Table 1Go). After weaning, the body weight of the surviving mutant mice increased, but the adults suffered from permanent and disproportioned dwarfism. Measurement of body fat content by nuclear magnetic resonance did not reveal any increase in adiposity (Table 1Go) also ip content in white adipose tissues was found to be strongly reduced, when 4-wk- and 3-month-old animals where dissected. TR{alpha}AMIxS females were sterile, without obvious histological defects in ovaries (data not shown).

In addition to dwarfism, TR{alpha}AMIxS animals displayed several other features of congenital hypothyroidism. This was the case in the spleen (Table 1Go), whose weight was highly reduced at P15. In the cerebellum, the external granular layer, a transient structure that normally disappears at earlier stage, persisted at P21 (Fig. 3DGo). The expression level of genes sensitive to hypothyroidism, Hairless in granular neurons and Pcp2 in Purkinje cells was significantly reduced (Table 1Go). Signs of cerebellar defect were also observed in adult TR{alpha}AMIxS mice, which displayed a characteristic ataxia bearing, spreading their hindlimbs to maintain their posture. Adult TR{alpha}AMIxS mice had reduced heart rate (Table 1Go) and sometimes displayed cardiac arythmia. This cardiac phenotype correlated with a decreased expression at P15 for two T3 target genes, the potassium channel encoding genes HCN2 and KCNB1 (Table 1Go). The body temperature was usually close to normal in TR{alpha}AMIxS mice (Table 1Go). However, a cold tolerance test revealed, like in mice lacking all TR isoforms (28) a defect in thermogenesis ability, the body temperature of TR{alpha}AMIxS mice dropping within few hours after cold exposure for a fraction of animals (Fig. 3EGo). T3 and T4 levels were not changed in TR{alpha}AMIxS mice (Table 1Go). The previously observed phenotypic alterations, which are all reminiscent of hypothyroidism, are thus not indirect consequences of a central deregulation of TH secretion but consequences of peripheral TR{alpha}1L400R expression.

TRß-Expressing Cells Are Less Sensitive to TR{alpha}1L400R Expression
Previous genetic analysis underlined a predominant function of TRß1 and TRß2 receptors in several TH functions, including feedback regulation of TSH secretion from pituitary thyrotropes and metabolic control in hepatocytes. TRß1 is also involved in inner ear hair cells, retina cones, and cerebellum Purkinje cells differentiation. Whether this results from predominant expression of THRB over THRA in these cell types or from intrinsic properties of TRß receptors is unclear. Circulating level of TSH (data not shown) and TSHß expression in pituitary (Table 1Go) were not significantly affected at P15 in TR{alpha}AMIxS mice. In liver, Q-RT-PCR failed to demonstrate a significant change in expression level for two TH target genes at P15: Dio1, encoding type 1 deiodinase and malic enzyme 3, encoding the NADP-dependent malic enzyme (Table 1Go). Similarly, Q-RT-PCR measurement of opsin gene expression failed to reveal a loss of M-Opsin cones in retina (data not shown), suggesting that, unlike TRß knockout mice, TR{alpha}AMIxS are not color blind. Purkinje cells differentiation was addressed by observing dendritic arborization after calbindin-D28k immunostaining and by measuring Pcp2 mRNA level in cerebellum. These two parameters revealed a defect in differentiation at P15 (Fig. 3FGo and Table 1Go). However, unlike what is reported for hypothyroid animals, this was followed by an apparent recovery at P21 (data not shown). TRß1 function was also analyzed in the inner ear. Interestingly, it has been shown previously that, in outer hair cells, TR{alpha}1 and TRß1 can fulfill distinct functions. TR{alpha}1 regulates Kcnq4 a potassium channel, whereas TRß1 activates Slc26a5 expression, a gene encoding a motor protein called prestin (29). In line with this, immunocytochemistry revealed that the level of KCNQ4, but not of prestin, was highly reduced in TR{alpha}AMIxS mice (Fig. 4Go). All these observations reveal that TR{alpha}AMIxS mice do not display all the features of acute congenital hypothyroidism and that some TRß prevalent functions are preserved.


Figure 4
View larger version (22K):
[in this window]
[in a new window]

  		Fig. 4. Inner Ear Phenotype of TR{alpha}AMIxS Mice

Immunohistochemistry reveals the presence of both prestin and KCNQ4 (red) in wild-type outer hair cells (OHC) at P15. The same observation was performed on three TR{alpha}AMIxS mice and four wild-type mice. Small arrows underline basolateral staining for prestin, and perinuclear staining for KCNQ4. Vertical arrows indicate the positions of cells nuclei, counterstained with 4',6-diamidino-2-phenylindole (DAPI, blue). Although prestin staining is maintained, perinuclear KCNQ4 staining is lost in TR{alpha}AMIxS mice (*).

 
Tamoxifen Induction of TR{alpha}1L400R Expression
To evaluate the possibility to perform a kinetic study of TR{alpha}1L400R effect on development, we crossed TR{alpha}AMI/+ mice with CagCreERTM mice, that broadly express a modified CRE recombinase, which enzymatic activity is inducible by tamoxifen (30). The resulting heterozygous conditional mutants (TR{alpha}AMIxC) were treated at embryonic d 17.5 (E17.5) with tamoxifen. This resulted in the excision of the PGKNeoRpolyA cassette in most tissues. The excision efficiency varied from one tissue to the other (Fig. 5AGo). In general the phenotype of tamoxifen-treated TR{alpha}AMIxC animals was similar to the one of TR{alpha}AMIxS, but less severe. This conclusion was based on observations of growth curves (Fig. 5BGo), ossification at P15 (Fig. 5CGo), cerebellum histology (Fig. 5DGo), adult heart rate, expression level at P15 of KCNB1 and HCN2 in heart, and Hairless and Pcp2 in cerebellum (Table 1Go). This demonstrates that expression of TR{alpha}1L400R, even when started at a late fetal stage, is sufficient to affect postnatal development. The relatively mild phenotype of tamoxifen-treated TR{alpha}AMIxC pups, compared with TR{alpha}AMIxS, might only reflect the incomplete excision of the floxed cassette. We also performed tamoxifen treatment in adult TR{alpha}AMIxC mice, to overcome detrimental effect of early TR{alpha}1L400R expression. This treatment did not have any visible effect in the short term cold tolerance assay, either because recombination efficiency was not sufficient in brown adipose tissue, or because the thermosensitive phenotype observed in TR{alpha}AMIxS might result from a developmental alteration. Nevertheless, tamoxifen treatment of adult TR{alpha}AMIxC males induced a significant reduction in heart rate (Fig. 3EGo), indicating that at least this last alteration is not a long-term consequence of some developmental defect. TR{alpha}AMIxC mice therefore appear as a suitable model to separate between the developmental and adult homeostatic function of TR{alpha}.


Figure 5
View larger version (57K):
[in this window]
[in a new window]

  		Fig. 5. Phenotype of TR{alpha}AMIxC Mice

A–D, Phenotype of TR{alpha}AMIxC pups born from females treated with tamoxifen at gestational d 17.5. A, Deletion of the PGKNeoRpolyA cassette after tamoxifen treatment at E17.5, analyzed by PCR at P15 (primers b, d, e Fig. 2Go) reveals the presence of an 800-bp fragment (*) corresponding to the CRE deleted TR{alpha}AMI allele in cerebellum (cb) whole brain (wb) and small intestine (si) in TR{alpha}AMIxC mice (+), but not in control littermates without CRE transgene (–). The upper 1200-bp band corresponds to the full-length TR{alpha}AMI allele. B, Body weight (g) was measured during 138 d (n = 10). Body growth is less affected in TR{alpha}AMIxC mice than in TR{alpha}AMIxS mice (Fig. 3BGo) but significantly reduced compared with TR{alpha}AMI/+ littermates, which do not express the mutation. C, Alizarine staining performed on whole mount skeleton reveals delayed ossification of long bones in TR{alpha}AMIxC mice at P15. The defect, marked by arrows, is less pronounced than for TR{alpha}AMIxS mice (Fig. 3CGo). D, Persistence of external granular layer in cerebellum at P21. Unlike what is found in wild-type controls, granular precursor cells (black arrow, here in the groove between lobe IV and lobe V) are still present in TR{alpha}AMIxC, but less abundant than in TR{alpha}AMIxS. E, Tamoxifen treatment of 8-wk-old adult males induces a significant decrease (P = 0.01 Student’s t test) of heart rate, measured 1 wk later, in TR{alpha}AMIxC (n = 7) compared with age-matched wild-type controls (n = 7), also treated with tamoxifen. TR{alpha}AMIxS data (n = 4) are given for comparison.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
In this report, we describe for the first time a CRE inducible system able to express a dominant-negative mutation of TR{alpha}1L400R. TR{alpha}1L400R is equivalent to an unliganded TR{alpha}1 receptor, as it prevents interactions with histone acetyl transferase transcription coactivators in a highly specific manner, without compromising interaction with corepressors. The first practical advantage of CRE-dependent expression is to permit an easy production of mutant offspring, because the mutated receptor is not expressed in breeding animals. This also rules out that the maternal expression of the mutation indirectly influences the development of pups. This is expected for example for neuronal migration in the cortex (31). This experimental design also opens a broad field for new investigations of TH signaling in mice, because the use of tissue-specific promoter and of an inducible version of the CRE will permit to control the expression of TR{alpha}1L400R during development and in adults. This will permit to separate between the direct and indirect effects of TH signaling, as illustrated here for the cardiac function. Because a large number of mice expressing CRE or an inducible version of CRE have been already generated worldwide (32), this appears as a highly flexible method to create new animals models. These animals will be specifically affected in one or several of the functions sensitive to TR{alpha}1L400R expression, within only one generation time. These functions include, in addition to those studied above, lipid storage in white adipose tissue (33), intestinal maturation (34), early postnatal erythropoiesis (9), lymphopoiesis (25) muscle function (35), myelin formation (36) and regeneration (37), hearing onset (38), adult brainstem cell proliferation (39, 40), and anxiety control and memory (41).

Three other THRA knock-in mutations have been reported before, which affect the TR{alpha}1 ligand-binding domain in different manner. Unlike the TR{alpha}1L400R mutation, whose design was based on structural considerations, the changes in the TR{alpha}1 reading frame were copied from THRB germline mutations found in patients with resistance to thyroid hormone. Comparisons between TR{alpha}AMIxS and the previously reported THRA knock-in mouse strains enable to define constant features among the multiple consequences of expressing a dominant-negative TR{alpha}1. As far as we can tell, the TR{alpha}AMIxS mice phenotype appears to be very similar to those reported for mice carrying the TR{alpha}1R384C, which reduces the affinity of the ligand binding domain for T3 (15) and the TR{alpha}1PV mutation, a frameshift mutation resulting in the loss of the N-terminal AF-2 domain (16, 42, 43). The fourth reported knock-in mutation, TR{alpha}1P398H, is the only one that induces obesity and not dwarfism. From our data, we can rule out that this peculiar phenotype results from the inability of TR{alpha}1P398H to recruit histone acetyl transferase coactivators or release corepressors. It has been suggested that TR{alpha}1P398H/+ obesity rather results from a cross talk between TR{alpha}1P398H and PPAR{alpha} in liver (44). However, a similar cross talk with PPAR{gamma} in white adipocytes has been proposed to explain the opposite phenotype in TR{alpha}1PV/+ mice (42). Many human germline point mutations that prevent histone acetyl transferase recruitment have been reported for THRB, but not for THRA. From these studies, we can predict that an AF-2 mutation in the human TR{alpha}1 receptor would have dramatic consequences on development even at the heterozygous state.

The phenotypic similarities between TR{alpha}AMIxS and Pax8–/– hypothyroid mice demonstrate that the ligand-mediated recruitment of histone acetylase coactivators and/or release of corepressors by TR{alpha}1 is crucial for postnatal development. This strengthens the previous conclusion that congenital hypothyroidism is mainly a manifestation of the negative action of unliganded TR{alpha}1 (14). However, differences are found between TR{alpha}AMIxS and Pax8–/– animals, suggesting a more complex situation. For example, the majority of TR{alpha}AMIxS survive beyond weaning, whereas Pax8–/– mice usually die within 3 wk after birth. Our data suggest that in cells where THRB is highly expressed, like thyrotropes, hepatocytes, and retina cones, liganded TRß can balance the down-regulation exerted by TR{alpha}1L400R. Such a compensation cannot take place in hypothyroid mice, where unliganded TRß receptors might instead participate to negative gene regulation and further compromise postnatal development. The presence of liganded TRß in TR{alpha}AMIxS can explain all the differences observed with Pax8–/– hypothyroid mice, leaving little place for the proposed intervention of the antagonist TR{alpha}2 isoform (19) or of an hypothetical TR-independent TH signaling pathway (21, 46). It seems therefore that unliganded TR{alpha}1, and to a lesser extent unliganded TRß, can account for all the detrimental effects of hypothyroidism in juveniles and in adults.

One important question that our data can help to clarify is whether the individual functions of TR{alpha}1 and TRß1/2 isoforms in a given cell type are dictated by their respective abundance or by differences in their intrinsic properties. A vast amount of in vitro data suggest that TR{alpha}1 and TRß1/2 are, at least at first sight, functionally equivalent. Knockout observations strengthen this hypothesis because the phenotypic differences observed between THRA and THRB individual knockouts mainly reflect their contrasting expression patterns. Combinations of THRA and THRB knockout mutations also suggest functional redundancy, as several phenotypic alterations augmented (3, 47). As expected TR{alpha}1L400R exerts in transient expression assays a dominant-negative action both on TR{alpha}1 and TRß1. Accordingly, most features of the TR{alpha}AMIxS phenotype can be predicted from the respective abundance of THRA and THRB encoded receptors in a given cell type. First, we failed to detect any phenotypic alteration in cell types known to express THRB at much higher level than THRA. This includes retina cones, hepatocytes and thyrotrope cells. Second, TRß receptors appear sensitive to the TR{alpha}1L400R dominant-negative effect in tissues where the stochiometry is less favorable to THRB. Previous genetic studies have shown that compound knockout mice devoid of all receptors have a reduced body temperature and are much more sensitive to cold exposure than THRA knockout mice (28, 48, 49). Thus, despite pharmacological evidences indicating only partial overlap (50), the functions of the two receptors seem to be redundant for cold resistance, correlating with the concomitant presence of TR{alpha}1 and TRß1 in brown adipose tissue (51). The fact that TR{alpha}AMIxS are highly sensitive to cold exposure therefore suggests that TR{alpha}1L400R can interfere with both TR{alpha}1 and TRß1 functions in brown adipocytes. A similar interpretation can be proposed for Purkinje cells. Hypothyroidism results in a permanent reduction in dendritic arborization and a disorganization of the cells alignment (52). In situ hybridization reveals a predominant THRB expression in these cells after birth (53), and their differentiation is deeply affected by a TRß knock-in mutation (20). However, in vitro differentiation of purified Purkinje precursors rather suggests a predominant function for TR{alpha}1 over TRß1 (54). We show here that TR{alpha}1L400R, like TR{alpha}1R384C (41) has only a transient effect on Purkinje dendrites arborization. A possible explanation would be that, as THRB expression increases over time in this cell type (55), TRß1 progressively accumulates, overcomes the transcription repression exerted by TR{alpha}1L400R and eventually unlocks differentiation. In conclusion, expression patterns clearly influence the respective in vivo function of TR{alpha}1 and TRß1/2. TR stochiometry is however unlikely to be the only explanation for the maintenance of several TRß1/2-dependent functions in TR{alpha}AMIxS mice. Some our results also suggest that TR{alpha}1 and TRß1/2 intrinsic properties, and the set of target genes that they control, are different. For example, the resting body temperature of most TR{alpha}AMIxS animals is normal, unlike what is reported for compound THRA/THRB knockout mice, suggesting that part of the activation by TRß1 is preserved in brown adipocytes. Most importantly, the inner ear phenotype provides compelling evidence that TR{alpha}1 and TRß1 intrinsic properties are different. Within outer hair cells, TR{alpha}1L400R appears to antagonize TR{alpha}1 driven transactivation of KCNQ4 without compromising TRß1-mediated regulation of prestin. It seems therefore that in vertebrates, divergent evolution of the paralogous THRA and THRB genes increased the variety of cellular responses to TH.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Plasmids and Transient Expression Assays
The L400R mutation was introduced in the TR{alpha}1 reading frame present in the pBIRDTR{alpha}1 construct (56) using for PCR mutagenesis an oligonucleotide containing a SacII restriction site at the mutation site: 5' CC CCG CGG TTC CTG GAG GTC TTT GAG 3'. The entire cDNA structure was confirmed by DNA sequencing. The mutated cDNA was inserted between a floxed PGKNeoRpolyA (57) able to stop transcription, and an IRESTaulacZ sequence (58) to create a bicistronic mRNA encoding both the mutated receptor TR{alpha}1L400R and the reporter Tau-ß-galactosidase fusion protein targeted to the cytoskeleton. The completed construct was transferred as a PacI restriction fragment into the pBK-CMV expression vector (Stratagene, San Diego, CA) (Fig. 1BGo) or between two large genomic fragments (Fig. 2AGo) cloned into the Supercos1 cosmide vector (Stratagene) for homologous recombination. An identical pBK-CMV derivative was made for the intact TR{alpha}1 cDNA for control experiments. For transient expression, Cos-7 cells, maintained in TH depleted medium, were transfected with Exgen reagent (Fermentas, Burlington, Ontario, Canada). pTK-DR4(2x)-luc was used as a reporter construct (59) and pRL-CMV (Promega, Madison, WI), encoding Renilla luciferase, as an internal standard. T3 (10–7 M) was eventually added to the medium 24 h before the quantification of luciferase activity (Promega; Dual Luciferase Assay). The full-length TR{alpha}1 and TR{alpha}1L400R reading frames were transferred into pAS2.1 (CLONTECH, Palo Alto, CA) to perform two-hybrid assays in yeast cells. Two-hybrid interactions were tested by plating AH109 yeast cells on selective medium and quantified by measuring ß-galactosidase activity in Y187 yeast cells, using orthonitrophényl-ß-D-galactopyrannoside as a substrate.

Generation of Mutant Mice
The oligonucleotides used for vector construct, screening and TR{alpha} expression analysis are the following (positions on Fig. 2Go). a, 5'GCGATACCGTAAAGCACGAG; b, 5'GCCTTCTATCGCCTTCTTGACG; c, 5'CGTCTGGAGAAGAGTTGG d, 5' TCCACAGGTATCTCCAGACAGG; e, 5' GATTCTTCTGGATTGTGCGGCG; f, ACCGCAAACACAACATTCCGCACTTCTGGC; g, 5' GAGGAAGGAGAGAAGAGATG GGGGTTC; h, 5' CGGTCGCTACCATTACC AGTTG; i, 5' TTATGGATGGACGGACGG; and j, 5' AGTCTACGGCAAGGCAACACCAAG. The 5 x 106 129/Sv mouse embryonic stem cells (13) were electroporated with 40 µg of linear plasmid and selected with G418 (250 µg/ml; Invitrogen, Carlsbad, CA). Cell clones were picked 10 d later and screened by PCR amplification of junction fragment, using Long expand Taq polymerase (Roche, Indianapolis, IN) (a + c for the 5' side, h + j for the 3' side). Three of 310 clones carried the mutant allele called TR{alpha}AMI (AF-2 Mutation, Inducible). After further PCR characterization of the recombinant allele, cells were injected into C57/Bl6 blastocysts to generate chimeras. After germline transmission, transgenic mice were routinely screened by PCR directed on the lacZ-exon 9 junction (h + i). TR{alpha}AMI xS and TR{alpha}AMI xC mice were produced by crossing TR{alpha}AMI/+ mice with SYCP1CRE transgenic mice (27) and CagCreERTM (30), respectively, and identified by PCR (5'TTACCGGTCGATGCAACG3'+5'CCAGCCACCAGCTTGCAT3' for CRE). When indicated, TR{alpha}AMI /C mice received 1 (pregnant E17 mothers) or 5 (adults) daily ip injection of tamoxifen (Sigma, St. Louis, MO; T-5648, 50 mg/kg) dissolved in corn oil. CRE-mediated deletion was identified by PCR (b + d + e). All animal experiments were performed under Animal care procedures and conducted in accordance with the guidelines set by the European Community Council Directives (86/609/EEC).

Phenotype Analysis
RNA were extracted from tissues of eight to 10 mice per group and purified using RNeasy (QIAGEN) or RNA Nanoprep (Stratagene) extraction kits, including a deoxyribonuclease I treatment. RNA quality controls were performed by gel electrophoresis (2100 Bioanalyzer; Agilent, Santa Clara, CA). cDNA were prepared from 1 µg RNA using mouse Moloney leukemia virus reverse transcriptase (Promega) and random 6-oligomer primers. After 1/40 dilution, 2 µl of cDNA were used for quantitative PCR (Stratagene Mx3000P QPCR System), using either Platinum Quantitative PCR SuperMix (Invitrogen) or Taqman Assay-on-Demand (Applied Biosystems, Foster City, CA). Quantitation was performed in duplicates using the HPRT and TBP housekeeping genes as internal standards (or ARBP for pituitary) and the 2–{Delta}Ct method for data analysis (60). Paraffin sections were prepared from tissues fixed with 4% paraformaldehyde. Purkinje cells were stained with a rabbit anti-calbindin-D-28k antibody (Swant, Bellinzona, Switzerland; CB38a, 1/5000 dilution). Serum T4, T3, and TSH levels were measured as described previously (45). Cold tolerance assays were performed with a telemetry system as previously described (48) in a 4 C room. Body temperature was measured every 15 or 30 min during 8 h, and mice were removed from the cold room when their body temperature dropped below 35 C. Inner ear immunocytochemistry was performed as described previously (29).


   ACKNOWLEDGMENTS
 
We thank Peggy Del Carmine and Michel Beylot from the ANIPHY facility (Lyon, France), for performing electocardiograms, Nadine Aguilera [Plateau de Biologie Expérimentale de la Souris (PBES), Lyon, France], and the PBES breeding facility group for mouse breeding. We also thank Marlies Knipper (University of Tübingen) and Karine Gauthier (Institut de Génomique Fonctionnelle de Lyon) for helpful discussion and critical reading of the manuscript; Roy Weiss (University of Chicago, Chicago, IL) for TSH measurement; and Martin Privalsky (University of California, Davis, CA), Richard Axel (Columbia University, New York, NY), Denis Duboule (National Research Centre ''Frontiers in Genetics,'' Geneva, Switzerland), and Nathalie Billon (Institut de Recherche, Signalisation, Biologie du Développement et Cancer, Nice, France) for plasmid gifts.


   FOOTNOTES
 
This work was supported by the CASCADE European network of excellence and the CRESCENDO European integrated project. L.Q. was supported by Fondation pour la Recherche Médicale.

Disclosure of Potential Conflict of Interest Form: Authors have nothing to declare.

First Published Online July 10, 2007

Abbreviations: AF, Activation function; CMV, cytomegalovirus; E17.5, embryonic d 17.5; IRES, internal ribosome entry site; NcoR1, nuclear receptor corepressor 1; Q-RT-PCR: quantitative RT-PCR; SRC1, steroid receptor coactivator; SV40, simian virus 40; TH, thyroid hormone 1; TR, nuclear receptor.

Received for publication April 6, 2007. Accepted for publication July 5, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Yen PM 2001 Physiological and molecular basis of thyroid hormone action. Physiol Rev 81:1097–1142[Abstract/Free Full Text]
  2. Zhang J, Lazar MA 2000 The mechanism of action of thyroid hormones. Annu Rev Physiol 62:439–466[CrossRef][Medline]
  3. Flamant F, Gauthier K, Samarut J 2007 Thyroid hormones signaling is getting more complex: STORMs are coming. Mol Endocrinol 21:321–333[Abstract/Free Full Text]
  4. Mansouri A, Chowdhury K, Gruss P 1998 Follicular cells of the thyroid gland require Pax8 gene function. Nat Genet 19:87–90[CrossRef][Medline]
  5. Flamant F, Samarut J 2003 Thyroid hormone receptors: lessons from knockout and knock-in mutant mice. Trends Endocrinol Metab 14:85–90[CrossRef][Medline]
  6. Tata JR 2006 Amphibian metamorphosis as a model for the developmental actions of thyroid hormone. Mol Cell Endocrinol 246:10–20[CrossRef][Medline]
  7. Plateroti M, Gauthier K, Domon-Dell C, Freund JN, Samarut J, Chassande O 2001 Functional interference between thyroid hormone receptor {alpha} (TR{alpha}) and natural truncated TR{delta}{alpha} isoforms in the control of intestine development. Mol Cell Biol 21:4761–4772[Abstract/Free Full Text]
  8. Morte B, Manzano J, Scanlan T, Vennstrom B, Bernal J 2002 Deletion of the thyroid hormone receptor {alpha} 1 prevents the structural alterations of the cerebellum induced by hypothyroidism. Proc Natl Acad Sci USA 99:3985–3989[Abstract/Free Full Text]
  9. Angelin-Duclos C, Domenget C, Kolbus A, Beug H, Jurdic P, Samarut J 2005 Thyroid hormone T3 acting through the thyroid hormone {alpha} receptor is necessary for implementation of erythropoiesis in the neonatal spleen environment in the mouse. Development 132:925–934[Abstract/Free Full Text]
  10. O’Shea P J, Bassett JH, Cheng SY, Williams GR 2006 Characterization of skeletal phenotypes of TR{alpha}1 and TRß mutant mice: implications for tissue thyroid status and T3 target gene expression. Nucl Recept Signal 4:e011
  11. Gloss B, Trost S, Bluhm W, Swanson E, Clark R, Winkfein R, Janzen K, Giles W, Chassande O, Samarut J, Dillmann W 2001 Cardiac ion channel expression and contractile function in mice with deletion of thyroid hormone receptor {alpha} or ß. Endocrinology 142:544–550[Abstract/Free Full Text]
  12. Gothe S, Wang Z, Ng L, Kindblom JM, Barros AC, Ohlsson C, Vennstrom B, Forrest D 1999 Mice devoid of all known thyroid hormone receptors are viable but exhibit disorders of the pituitary-thyroid axis, growth, and bone maturation. Genes Dev 13:1329–1341[Abstract/Free Full Text]
  13. Gauthier K, Chassande O, Plateroti M, Roux JP, Legrand C, Pain B, Rousset B, Weiss R, Trouillas J, Samarut J 1999 Different functions for the thyroid hormone receptors TR{alpha} and TRß in the control of thyroid hormone production and post-natal development. EMBO J 18:623–631[CrossRef][Medline]
  14. Flamant F, Poguet AL, Plateroti M, Chassande O, Gauthier K, Streichenberger N, Mansouri A, Samarut J 2002 Congenital hypothyroid Pax8(–/–) mutant mice can be rescued by inactivating the TR{alpha} gene. Mol Endocrinol 16:24–32[Abstract/Free Full Text]
  15. Tinnikov A, Nordstrom K, Thoren P, Kindblom JM, Malin S, Rozell B, Adams M, Rajanayagam O, Pettersson S, Ohlsson C, Chatterjee K, Vennstrom B 2002 Retardation of post-natal development caused by a negatively acting thyroid hormone receptor {alpha}1. EMBO J 21:5079–5087[CrossRef][Medline]
  16. Itoh Y, Esaki T, Kaneshige M, Suzuki H, Cook M, Sokoloff L, Cheng SY, Nunez J 2001 Brain glucose utilization in mice with a targeted mutation in the thyroid hormone {alpha} or ß receptor gene. Proc Natl Acad Sci USA 98:9913–9918[Abstract/Free Full Text]
  17. Kaneshige M, Suzuki H, Kaneshige K, Cheng J, Wimbrow H, Barlow C, Willingham MC, Cheng Sy S 2001 A targeted dominant negative mutation of the thyroid hormone {alpha} 1 receptor causes increased mortality, infertility, and dwarfism in mice. Proc Natl Acad Sci USA 98:15095–15100[Abstract/Free Full Text]
  18. Liu YY, Tachiki KH, Brent GA 2002 A targeted thyroid hormone receptor {alpha} gene dominant-negative mutation (P398H) selectively impairs gene expression in differentiated embryonic stem cells. Endocrinology 143:2664–2672[Abstract/Free Full Text]
  19. Mittag J, Friedrichsen S, Heuer H, Polsfuss S, Visser TJ, Bauer K 2005 Athyroid Pax8–/– mice cannot be rescued by the inactivation of thyroid hormone receptor {alpha}1. Endocrinology 146:3179–3184[Abstract/Free Full Text]
  20. Hashimoto K, Curty FH, Borges PP, Lee CE, Abel ED, Elmquist JK, Cohen RN, Wondisford FE 2001 An unliganded thyroid hormone receptor causes severe neurological dysfunction. Proc Natl Acad Sci USA 98:3998–4003[Abstract/Free Full Text]
  21. Farwell AP, Dubord-Tomasetti SA, Pietrzykowski AZ, Leonard JL 2006 Dynamic non-genomic actions of thyroid hormone in the developing rat brain. Endocrinology 147:2567–2574[Abstract/Free Full Text]
  22. Davis PJ, Davis FB, Cody V 2005 Membrane receptors mediating thyroid hormone action. Trends Endocrinol Metab 16:429–435[CrossRef][Medline]
  23. Darimont BD, Wagner RL, Apriletti JW, Stallcup MR, Kushner PJ, Baxter JD, Fletterick RJ, Yamamoto KR 1998 Structure and specificity of nuclear receptor-coactivator interactions. Genes Dev 12:3343–3356[Abstract/Free Full Text]
  24. Feng W, Ribeiro RC, Wagner RL, Nguyen H, Apriletti JW, Fletterick RJ, Baxter JD, Kushner PJ, West BL 1998 Hormone-dependent coactivator binding to a hydrophobic cleft on nuclear receptors. Science 280:1747–1749[Abstract/Free Full Text]
  25. Arpin C, Pihlgren M, Fraichard A, Aubert D, Samarut J, Chassande O, Marvel J 2000 Effects of T3R {alpha} 1 and T3R {alpha} 2 gene deletion on T and B lymphocyte development. J Immunol 164:152–160[Abstract/Free Full Text]
  26. Nascimento AS, Dias SM, Nunes FM, Aparicio R, Ambrosio AL, Bleicher L, Figueira AC, Santos MA, de Oliveira Neto M, Fischer H, Togashi M, Craievich AF, Garratt RC, Baxter JD, Webb P, Polikarpov I 2006 Structural rearrangements in the thyroid hormone receptor hinge domain and their putative role in the receptor function. J Mol Biol 360:586–598[CrossRef][Medline]
  27. Chung SS, Cuzin F, Rassoulzadegan M, Wolgemuth DJ 2004 Primary spermatocyte-specific Cre recombinase activity in transgenic mice. Transgenic Res 13:289–294[CrossRef][Medline]
  28. Golozoubova V, Gullberg H, Matthias A, Cannon B, Vennstrom B, Nedergaard J 2004 Depressed thermogenesis but competent brown adipose tissue recruitment in mice devoid of all hormone-binding thyroid hormone receptors. Mol Endocrinol 18:384–401[Abstract/Free Full Text]
  29. Winter H, Braig C, Zimmermann U, Geisler HS, Franzer JT, Weber T, Ley M, Engel J, Knirsch M, Bauer K, Christ S, Walsh EJ, McGee J, Kopschall I, Rohbock K, Knipper M 2006 Thyroid hormone receptors TR{alpha}1 and TRß differentially regulate gene expression of Kcnq4 and prestin during final differentiation of outer hair cells. J Cell Sci 119:2975–2984[Abstract/Free Full Text]
  30. Hayashi S, McMahon AP 2002 Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation/inactivation in the mouse. Dev Biol 244:305–318[CrossRef][Medline]
  31. Lavado-Autric R, Auso E, Garcia-Velasco JV, Arufe Mdel C, Escobar del Rey F, Berbel P, Morreale de Escobar G 2003 Early maternal hypothyroxinemia alters histogenesis and cerebral cortex cytoarchitecture of the progeny. J Clin Invest 111:1073–1082[CrossRef][Medline]
  32. Garcia-Otin AL, Guillou F 2006 Mammalian genome targeting using site-specific recombinases. Front Biosci 11:1108–1136[Medline]
  33. Gullberg H, Rudling M, Salto C, Forrest D, Angelin B, Vennstrom B 2002 Requirement for thyroid hormone receptor ß in T(3) regulation of cholesterol metabolism in mice. Mol Endocrinol 16:1767–1777[Abstract/Free Full Text]
  34. Plateroti M, Chassande O, Fraichard A, Gauthier K, Freund JN, Samarut J, Kedinger M 1999 Involvement of T3R{alpha}- and ß-receptor subtypes in mediation of T3 functions during postnatal murine intestinal development. Gastroenterology 116:1367–1378[CrossRef][Medline]
  35. Johansson C, Lannergren J, Lunde PK, Vennstrom B, Thoren P, Westerblad H 2000 Isometric force and endurance in soleus muscle of thyroid hormone receptor-{alpha}(1)- or -ß-deficient mice. Am J Physiol Regul Integr Comp Physiol 278:R598–R603
  36. Rodriguez-Pena A, Ibarrola N, Iniguez MA, Munoz A, Bernal J 1993 Neonatal hypothyroidism affects the timely expression of myelin-associated glycoprotein in the rat brain. J Clin Invest 91:812–818[Medline]
  37. Voinesco F, Glauser L, Kraftsik R, Barakat-Walter I 1998 Local administration of thyroid hormones in silicone chamber increases regeneration of rat transected sciatic nerve. Exp Neurol 150:69–81[CrossRef][Medline]
  38. Knipper M, Zinn C, Maier H, Praetorius M, Rohbock K, Kopschall I, Zimmermann U 2000 Thyroid hormone deficiency before the onset of hearing causes irreversible damage to peripheral and central auditory systems. J Neurophysiol 83:3101–3112[Abstract/Free Full Text]
  39. Lemkine GF, Raj A, Alfama G, Turque N, Hassani Z, Alegria-Prevot O, Samarut J, Levi G, Demeneix BA 2005 Adult neural stem cell cycling in vivo requires thyroid hormone and its {alpha} receptor. FASEB J 19:863–865[Abstract/Free Full Text]
  40. Montero-Pedrazuela A, Venero C, Lavado-Autric R, Fernandez-Lamo I, Garcia-Verdugo JM, Bernal J, Guadano-Ferraz A 2006 Modulation of adult hippocampal neurogenesis by thyroid hormones: implications in depressive-like behavior. Mol Psychiatry 148:1206–1217
  41. Venero C, Guadano-Ferraz A, Herrero AI, Nordstrom K, Manzano J, de Escobar GM, Bernal J, Vennstrom B 2005 Anxiety, memory impairment, and locomotor dysfunction caused by a mutant thyroid hormone receptor {alpha}1 can be ameliorated by T3 treatment. Genes Dev 19:2152–2163[Abstract/Free Full Text]
  42. Ying H, Araki O, Furuya F, Kato Y, Cheng SY 2007 Impaired adipogenesis caused by a mutated thyroid hormone {alpha} 1 receptor. Mol Cell Biol
  43. Esaki T, Suzuki H, Cook M, Shimoji K, Cheng SY, Sokoloff L, Nunez J 2003 Functional activation of cerebral metabolism in mice with mutated thyroid hormone nuclear receptors. Endocrinology 144:4117–4122[Abstract/Free Full Text]
  44. Liu YY, Heymann RS, Moatamed F, Schultz JJ, Sobel D, Brent GA 2006 A mutant thyroid hormone receptor {alpha} antagonizes PPAR{alpha}-signaling in vivo and impairs fatty acid oxidation. Endocrinology 146:1208–1217
  45. Weiss RE, Forrest D, Pohlenz J, Cua K, Curran T, Refetoff S 1997 Thyrotropin regulation by thyroid hormone in thyroid hormone receptor ß-deficient mice. Endocrinology 138:3624–3629[Abstract/Free Full Text]
  46. Farwell AP, Dubord-Tomasetti SA, Pietrzykowski AZ, Stachelek SJ, Leonard JL 2005 Regulation of cerebellar neuronal migration and neurite outgrowth by thyroxine and 3,3',5'-triiodothyronine. Brain Res Dev Brain Res 154:121–135[Medline]
  47. Forrest D, Vennstrom B 2000 Functions of thyroid hormone receptors in mice. Thyroid 10:41–52[Medline]
  48. Marrif H, Schifman A, Stepanyan Z, Gillis MA, Calderone A, Weiss RE, Samarut J, Silva JE 2005 Temperature homeostasis in transgenic mice lacking thyroid hormone receptor {alpha} gene products. Endocrinology 146:2872–2884[Abstract/Free Full Text]
  49. Wikstrom L, Johansson C, Salto C, Barlow C, Campos Barros A, Baas F, Forrest D, Thoren P, Vennstrom B 1998 Abnormal heart rate and body temperature in mice lacking thyroid hormone receptor {alpha}1. EMBO J 17:455–461[CrossRef][Medline]
  50. Ribeiro MO, Carvalho SD, Schultz JJ, Chiellini G, Scanlan TS, Bianco AC, Brent GA 2001 Thyroid hormone-sympathetic interaction and adaptive thermogenesis are thyroid hormone receptor isoform-specific. J Clin Invest 108:97–105[CrossRef][Medline]
  51. Hernandez A, Obregon MJ 1996 Presence and mRNA expression of T3 receptors in differentiating rat brown adipocytes. Mol Cell Endocrinol 121:37–46[CrossRef][Medline]
  52. Nicholson JL, Altman J 1972 The effects of early hypo- and hyperthyroidism on the development of the rat cerebellar cortex. II. Synaptogenesis in the molecular layer. Brain Res 44:25–36[CrossRef][Medline]
  53. Bradley DJ, Young 3rd WS, Weinberger C 1989 Differential expression of {alpha} and ß thyroid hormone receptor genes in rat brain and pituitary. Proc Natl Acad Sci USA 86:7250–7254[Abstract/Free Full Text]
  54. Heuer H, Mason CA 2003 Thyroid hormone induces cerebellar Purkinje cell dendritic development via the thyroid hormone receptor {alpha}1. J Neurosci 23:10604–10612[Abstract/Free Full Text]
  55. Forrest D, Hallbook F, Persson H, Vennstrom B 1991 Distinct functions for thyroid hormone receptors {alpha} and ß in brain development indicated by differential expression of receptor genes. EMBO J 10:269–275[Medline]
  56. Billon N, Jolicoeur C, Tokumoto Y, Vennstrom B, Raff M 2002 Normal timing of oligodendrocyte development depends on thyroid hormone receptor {alpha} 1 (TR{alpha}1). EMBO J 21:6452–6460[CrossRef][Medline]
  57. Kmita M, Tarchini B, Duboule D, Herault Y 2002 Evolutionary conserved sequences are required for the insulation of the vertebrate Hoxd complex in neural cells. Development 129:5521–5528[Abstract/Free Full Text]
  58. Mombaerts P, Wang F, Dulac C, Chao SK, Nemes A, Mendelsohn M, Edmondson J, Axel R 1996 Visualizing an olfactory sensory map. Cell 87:675–686[CrossRef][Medline]
  59. Lee S, Privalsky ML 2005 Heterodimers of retinoic Acid receptors and thyroid hormone receptors display unique combinatorial regulatory properties. Mol Endocrinol 19:863–878[Abstract/Free Full Text]
  60. Livak JL, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method. Methods 25:402–408[CrossRef][Medline]

NURSA Molecule Pages Link:

Nuclear Receptors:   TRα  |  TRβ
Coregulators:   SRC-1  |  GRIP1  |  NCOR
Ligands:   Thyroid hormone



This article has been cited by other articles:


Home page
 EndocrinologyHome page
M. Vujovic, K. Nordstrom, K. Gauthier, F. Flamant, T. J. Visser, B. Vennstrom, and J. Mittag
Interference of a Mutant Thyroid Hormone Receptor {alpha}1 with Hepatic Glucose Metabolism
Endocrinology, June 1, 2009; 150(6): 2940 - 2947.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
J H D. Bassett and G. R Williams
The skeletal phenotypes of TR{alpha} and TR{beta} mutant mice
J. Mol. Endocrinol., April 1, 2009; 42(4): 269 - 282.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
H. Winter, L. Ruttiger, M. Muller, S. Kuhn, N. Brandt, U. Zimmermann, B. Hirt, A. Bress, M. Sausbier, A. Conscience, et al.
Deafness in TR{beta} Mutants Is Caused by Malformation of the Tectorial Membrane
J. Neurosci., February 25, 2009; 29(8): 2581 - 2587.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
V. Giguere
Transcriptional Control of Energy Homeostasis by the Estrogen-Related Receptors
Endocr. Rev., October 1, 2008; 29(6): 677 - 696.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Quignodon, L.
Right arrow Articles by Flamant, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Quignodon, L.
Right arrow Articles by Flamant, F.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals