Molecular Endocrinology, doi:10.1210/me.2006-0498
Molecular Endocrinology 21 (10): 2503-2515
Copyright © 2007 by The Endocrine Society
Regulation of Suppressor of Cytokine Signaling 3 (SOC3) by Growth Hormone in Pro-B Cells
Johanna L. Barclay,
Stephen T. Anderson,
Michael J. Waters and
Jon D. Curlewis
School of Biomedical Sciences (J.L.B., S.T.A., M.J.W., J.D.C.) and Institute for Molecular Bioscience (M.J.W.), University of Queensland, Queensland 4072, Australia
Address all correspondence and requests for reprints to: Assoc. Prof. Jon D. Curlewis, School of Biomedical Sciences, University of Queensland, Queensland 4072, Australia. E-mail: j.curlewis{at}uq.edu.au.
 |
ABSTRACT
|
|---|
Suppressor of cytokine signaling 3 (SOCS3) is expressed by lymphoid cells and can modulate the sensitivity of these cells to cytokine stimulation through inhibition of Janus kinase (JAK)/signal transducers and activators of transcription (STAT) signaling pathways. This study employed a mouse pro-B cell line expressing the human GH receptor (BaF/3-GHR), to elucidate the signal transduction pathways used by GH to elicit SOCS3 expression. GH treatment of these cells caused a rapid, dose-dependent increase in SOCS3 mRNA expression, which was independent of de novo protein synthesis. As expected, GH treatment increased JAK-dependent STAT5 tyrosine phosphorylation, which bound to the proximal STAT response element (pSRE) on the SOCS3 promoter. This process appeared to involve STAT5b, rather than STAT5a. In addition, GH activation of the SOCS3 promoter required a nearby activator protein (AP) 1/cAMP response element (CRE), which bound cAMP response element binding protein, c-Fos, and c-Jun. Moreover, inhibitors of p38 MAPK and c-Jun N-terminal kinase prevented GH-stimulation of SOCS3 mRNA expression in these cells, suggesting a role for these kinases in SOCS3 transcription. Importantly, GH stimulation increased binding of FOXO3a to the SOCS3 promoter at a site overlapping the AP1/CRE response element, and overexpression of FOXO3a in these cells augmented SOCS3 promoter activation. In addition, we show a direct interaction between FOXO3a and STAT5 in these cells, which may provide a link between STAT5 and the AP1 transcription factors on the SOCS3 promoter. We conclude that regulation of SOCS3 expression by GH in a pro-B cell involves not only the pSRE, but also a transcriptionally active complex involving cAMP response element binding protein/c-Fos/c-Jun and FOXO3a. This study has implications for cytokine regulation of SOCS gene expression in lymphoid cells.
 |
INTRODUCTION
|
|---|
THE SUPPRESSORS OF cytokine signaling (SOCS) protein family consists of SOCS1–7 and cytokine-inducible SH2-containing protein (CIS) (1, 2), with SOCS1–3 and CIS having major roles in immune cell proliferation, differentiation, migration, and modulation of the immune response to challenge (3, 4). These proteins are expressed after cytokine stimulation, and directly interact with the Janus kinase/signal transducers and activators of transcription (JAK/STAT) signaling pathway as negative regulators, thereby modulating the responsiveness of cells to further activation (5). The JAK/STAT signaling pathway is employed by numerous cytokines, including prolactin (6), GH (7), IL-2, IL-3 (8), and the IL-6 family (9) including leukemia inhibitory factor (4) and IL-11 (10). Ligand binding of dimerized receptors causes activation of the intracellular domain, and recruitment of JAKs, which phosphorylate STATs directly, or tyrosine residues on the receptor that create docking sites for STATs. In the latter case, STATs are then phosphorylated by JAK, followed by dimerization and translocation to the nucleus where they bind to STAT response elements (SREs) on targets genes to regulate transcription. SOCS3 is a target of this signaling cascade, and acts in a negative feedback loop to inhibit STAT phosphorylation at the receptor complex (11), thereby preventing overstimulation of cytokine-responsive cells.
In lymphoid cells, the mechanisms of proliferation, differentiation and commitment to lineage, and coordination of pro- and antiinflammatory responses to challenge are regulated by cytokine stimulation. For example interaction between the proinflammatory IL-6 and the antiinflammatory IL-10 signaling cascades depends on activation of STAT1 and 3, which can be regulated by expression of SOCS3 in monocytes (12). In addition, IL-11 stimulation of proliferation in lymphoid progenitor cells, and their subsequent commitment to lineage, requires activation of the JAK/STAT pathway, specifically STAT1 and 3. This process is negatively regulated by IL-3 cross talk in BaF/3 cells, via up-regulation of SOCS3, in a MAPK kinase kinase- and p38 MAPK-dependent manner (13). GH receptor is expressed on lymphoid cells (14) and has been implicated in the survival of BaF/3-hGHR cells via phosphatidylinositol 3-kinase-dependent mechanisms, proliferation in the same cells via nuclear factor kß (15), and the commitment of precursor cells to B cell lineage (16, 17). GH is known to regulate SOCS3 expression (18), and deregulation of SOCS3 expression has been linked to T-cell lymphoma, inflammation, rheumatoid arthritis, and asthma (3). Given the extensive role of cytokine signaling in hematopoiesis, and the increasing evidence for modulation of this process by SOCS3, the transcriptional regulation of SOCS3 in these cells by GH is clearly of interest.
The SOCS3 promoter has been studied in a variety of cell models, and its regulation appears to be dependent on cell type and stimulating ligand. Most models of cytokine simulation have implicated STAT binding to the pSRE on the SOCS3 promoter as an important transcriptional enhancer (19, 20, 21, 22), although there is evidence to suggest that other binding motifs can be important for transcription (20, 23, 24). The only previous study of GH stimulation of the SOCS3 promoter showed that the SREs were not involved, and this process was entirely dependent on a guanine cytosine (GC)-rich region and an AT-rich region (25). In contrast, we report here that treatment of BaF/3-hGHR pro-B cells with GH causes rapid up-regulation of SOCS3 expression by STAT5-dependent activation of the pSRE. Furthermore, enhancement of SOCS3 expression requires activation of JNK and p38 MAPK, recruitment of c-Fos, c-Jun, and FOXO3a, which associate with constitutively bound cAMP response element binding protein (CREB) at the overlapping AP1/CRE and FOXO response elements on the promoter.
 |
RESULTS
|
|---|
GH Treatment Increases Expression of SOCS3 mRNA and Protein in BaF/3-hGHR Cells
BaF/3-hGHR cells were treated with GH and SOCS3 mRNA expression was measured by quantitative PCR (QPCR). SOCS3 mRNA expression was maximal 30 min after GH treatment, and remained elevated at 120 min (Fig. 1A
), indicating an acute response to treatment. GH significantly increased SOCS3 mRNA expression in a dose-dependent manner (Fig. 1B
). When cells were pretreated with cycloheximide, GH-stimulated SOCS3 mRNA expression was unaffected (Fig. 1C
), indicating that GH-induced SOCS3 expression in BaF/3-hGHR cells does not require de novo protein synthesis. Treatment of cells with GH caused an increase in SOCS3 protein by 60 min, which remained elevated at 90 min (Fig. 1D
).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 1. GH Stimulation of SOCS3 mRNA Expression
BaF/3-hGHR cells were stimulated with 1 µg/ml GH for times indicated (A), or treated for 30 min with increasing doses of GH (B), and SOCS3 mRNA quantitated using QPCR. Results are expressed relative to time zero and vehicle treatment, respectively. C, Cells were treated with or without 10 µM cycloheximide for 1 h followed by vehicle or 1 µg/ml GH for 30 min, and SOCS3 mRNA quantitated by QPCR. Results are expressed relative to vehicle-treated cells. Different superscripts denote significant (P < 0.01) differences, and same superscripts indicate no significant differences. D, Cells were treated with GH at 1 µg/ml for times indicated, and whole cell extracts analyzed for SOCS3 protein using Western blot. ß-Actin antibody was used to establish loading.
|
|
Responsiveness of the Murine SOCS3 Promoter to GH Stimulation
The response of the SOCS3 promoter to GH treatment was examined using a deletion series of the murine SOCS3 promoter cloned into a promoterless luciferase expression vector (pGL3), a gift from Dr. S. Melmed (Cedars Sinai Hospital, Los Angeles, CA) (Fig. 2A
) (22). The putative response elements present on the 6T3 promoter are shown in Fig. 2B
, and include a proximal SRE (pSRE) at –72/–64, a distal SRE (dSRE) at –95/–87, a GC-rich region at –58/–52, an AP1/CRE at –105/–99 and an overlapping FOXO response element at –103/–95. These constructs were transfected into BaF/3-hGHR cells, and luciferase activity in response to GH treatment was measured (Fig. 2C
). Compared with the full-length clone 6, the 5' truncated 6T3 construct showed increased basal luciferase activity and remained responsive to GH. In contrast, the 6T4 clone, which is further truncated at the 5' end of the promoter, did not respond to GH in these cells. Therefore, 6T3, representing the shortest GH-responsive promoter, was used for all subsequent studies. It is important to note that the unresponsive 6T4 promoter is truncated immediately 5' of the GC-rich region, removing all upstream motifs. In contrast to our findings, a study by Paul et al. (25) showed that this length promoter was still responsive to GH stimulation in rat hepatocytes because the GC-rich and A/T-rich regions were still present.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 2. Responsiveness of the SOCS3 Promoter to GH
A, A murine SOCS3 promoter deletion series in the promoterless luciferase reporter construct, pGL3. B, A schematic illustration of the transcriptional response elements on the murine SOCS3 promoter, showing a distal SRE (–95/–87), a proximal SRE (–71/–64), an AP1 element (–105/–99), a putative FOXO motif (–103/–95) and a GC-rich region (–58/–52). C, Luciferase activity of SOCS3 promoter deletion constructs after GH stimulation. BaF/3-hGHR cells were transfected with constructs and activity measured after 6 h of GH stimulation. Results are expressed as RLU and compared with the vehicle (Veh)-treated cells for each construct. Different superscripts denote significant (P < 0.05) differences, and same superscripts indicate no significant differences.
|
|
GH-Induced SOCS3 Expression Does Not Require the GC-Rich Region of the Promoter
The GC-rich region (–58/–52) of the SOCS3 promoter has previously been shown to be important for stimulation by GH (25), IL-6 (20), and prolactin (26). To test the involvement of this motif for GH stimulation in BaF/3-hGHR cells, a promoter was generated with a mutated GC-rich region (GCm). The activity of this promoter was compared with that of the parent 6T3 promoter after GH treatment (Fig. 3
). The GCm promoter had significantly reduced basal activity, but retained the ability to respond to GH stimulation.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 3. Involvement of the GC-Rich Region in SOCS3 Expression
Luciferase activity was measured in cells transfected with either the 6T3 promoter or a promoter that had been mutated in the GCm (wt, gggcgg; mutant, gTTcgg), followed by GH stimulation for 6 h at 1 µg/ml. Results are expressed as RLU. Different superscripts denote significant (P < 0.001) differences, and same superscripts indicate no significant differences. Veh, Vehicle.
|
|
GH Stimulates STAT5 Phosphorylation and SOCS3 mRNA Expression in a JAK-Dependent Manner
GH signaling via JAK/STATs is well established (7). However, other tyrosine kinases can phosphorylate STATs, in particular c-Src (27) (28). Here we investigated whether GH stimulates STATs in BaF/3-hGHR cells, and whether this was JAK or c-Src dependent. GH treatment caused tyrosine phosphorylation of STAT5, and this was largely inhibited by pretreatment with Jak Inhibitor I, but not by the c-Src inhibitor PP2 (Fig. 4A
). GH had no affect on tyrosine phosphorylation of either STAT1 or STAT3 in these cells (data not shown).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 4. STAT5 Activation by GH
A, Western blot analysis of STAT5 activation in response to GH. BaF/3-hGHR cells were pretreated with or without either 400 nM Jak Inhibitor I for 5 h or 10 µM PP2 for 1 h, followed by GH for 15 min at 1 µg/ml. Whole cell extracts were immunoprecipitated (IP) with STAT5 antibody, followed by Western blot using a phospho-specific STAT5-Y antibody. Membranes were stripped and reprobed with STAT5 antibody to establish loading. BaF/3-hGHR cells were pretreated with or without either 400 nM Jak Inhibitor I for 5 h (B) or 10 µM of PP2 (or PP3, the negative control inhibitor) for 1 h (C), followed by GH for 30 min at 1 µg/ml. SOCS3 mRNA was quantitated by QPCR; results are expressed relative to vehicle-treated cells. Different superscripts denote significant (P < 0.05) differences, whereas same superscripts indicate no significant differences.
|
|
We used QPCR to evaluate the effect of JAK and c-Src inhibition on GH-induced SOCS3 mRNA expression. Cells were pretreated with either Jak Inhibitor I (Fig. 4B
), or PP2 (in conjunction with the negative control inhibitor PP3) (Fig. 4C
), followed by GH stimulation. Inhibition of JAK markedly decreased the GH-induced SOCS3 mRNA expression, whereas inhibition of c-Src had no effect.
The Proximal SRE Is Required for Stimulation of the SOCS3 Promoter by GH, and STAT5b Stimulates Promoter Activation
Previous studies have shown the pSRE (–72/–64) on the SOCS3 promoter to be essential for transcriptional activation in a number of cell systems, whereas the role of the dSRE (–95/–87) appears to be less important (19, 20, 21, 22). To establish the involvement of these SREs in the current model, BaF/3-hGHR cells were transfected with promoters that had been mutated in either the dSRE (dSREm) or the pSRE (pSREm), and their activity was compared with the parent 6T3 promoter (Fig. 5
, A and B). Mutation of the dSRE had no effect on either basal or GH-stimulated luciferase activity, whereas mutation of the pSRE abolished both basal and GH-stimulated luciferase activity.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 5. Effect of STAT5 on the SOCS3 Promoter
BaF/3-hGHR cells were transfected with promoter mutated at either the dSRE (wt, ttacaagaa; mutant, tCCcaGgaa) (A) or the pSRE (wt, ttccaggaa; mutant, AtcGaCgaT) (B), and luciferase activity was compared between these mutant promoters and the 6T3 promoter, with and without GH treatment at 1 µg/ml for 6 h. Results are expressed as RLU. Different superscripts denote significant (P < 0.001) differences, and same superscripts indicate no significant differences. BaF/3-hGHR cells were cotransfected with either STAT5a wt, CA, or DN (C) or STAT5b wt, CA, or DN (D) constructs together with the 6T3 promoter, and luciferase activity was measured after GH stimulation for 6 h at 1 µg/ml. Results are expressed as RLU. Different superscripts denote significant (P < 0.05) differences, and same superscripts indicate no significant differences.
|
|
Because both STAT5a and STAT5b are capable of binding to the pSRE on the SOCS3 promoter, we attempted to determine which STAT5 isoform was more important in the current model. STAT5a or STAT5b wild type (wt), constitutively active (CA) or dominant-negative (DN) expression constructs were overexpressed with the 6T3 promoter, and luciferase activity was measured after GH treatment. Overexpression of STAT5a wt had no effect on luciferase activity, whereas surprisingly both the CA and DN STAT5a constructs abolished basal and GH-stimulated promoter activity (Fig. 5C
). In contrast, overexpression of STAT5b wt significantly increased basal luciferase activity and was unable to respond further to stimulation by GH (Fig. 5D
). The STAT5b CA construct caused an even greater increase in basal activity that was also unable to be stimulated further by GH. Overexpression of the STAT5b DN construct reduced basal activity, but the promoter was still stimulated by GH. Together, these results suggest that STAT5b, rather than STAT5a, is involved in the transcriptional activation of the SOCS3 promoter by GH in these cells. In addition, the inability of the STAT5b DN to prevent GH-stimulated promoter activation suggests that either the transactivation domain, which has been removed in this construct, is not required for promoter activation in this system, or that STAT5b has a permissive role in the activation of the promoter, and occupancy of the site is sufficient for transcription.
GH Stimulation Increases STAT5 Binding to the pSRE on the SOCS3 Promoter
To establish STAT5 binding on the SOCS3 promoter, a labeled probe encompassing the pSRE of the murine SOCS3 promoter was used in a gel shift assay, with nuclear extracts from BaF/3-hGHR cells after GH stimulation (Fig. 6A
). GH treatment increased nuclear protein binding to this probe, and the complex was shifted completely by addition of a STAT5 antibody. Pretreatment of cells with the JAK inhibitor prevented complex formation after GH treatment. Chromatin was extracted from cells and used for chromatin immunoprecipitation (ChIP) assay to confirm that GH treatment results in increased STAT5 binding to the SOCS3 promoter (Fig. 6B
).

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 6. STAT5 Binding to the pSRE on the SOCS3 Promoter
A, Gel shift assay was performed, using a labeled probe encompassing the pSRE (gcagttccaggaatcggggggc) on the murine SOCS3 promoter, and nuclear extracts from cells pretreated with or without 400 nM Jak Inhibitor I for 5 h followed by GH for 15 min at 1 µg/ml. STAT5 antibody (Ab) was used to shift the complex. B, ChIP assay was performed using chromatin from cells that had been treated with GH for 15 min at 1 µg/ml, antibodies to STAT5 or a negative control (NC) IgG, and PCR primers to the murine SOCS3 promoter.
|
|
GH-Induced SOCS3 Expression Involves p38 and JNK and the AP1/CRE Response Element
Previous studies have shown that GH treatment can result in serine phosphorylation of CREB (29), and this was examined in BaF/3-hGHR cells using immunoprecipitation and Western blotting. CREB was serine phosphorylated 15 min after GH stimulation (Fig. 7A
). Phosphorylated CREB can cause transcriptional activation by binding to CRE response elements on target promoters. Site directed mutagenesis was used to generate a SOCS3 promoter that had a mutated AP1/CRE (–105/–99) response element (AP1/CREm), and the ability of this promoter to respond to GH stimulation was compared with the parent 6T3 promoter. Mutation of this response element prevented GH-stimulated luciferase activity in these cells (Fig. 7B
). However, in addition to functioning as a CREB binding motif, this part of the SOCS3 promoter is also known to bind AP1 transcription factors (23). To establish any involvement of CREB in the activation of the SOCS3 promoter, CREB wt or A-CREB, a dominant-negative form that dimerizes with endogenous CREB and prevents subsequent DNA binding, were transfected with the 6T3 promoter construct, and luciferase activity was measured in response to GH stimulation (Fig. 7C
). Neither CREB wt nor A-CREB affected the SOCS3 promoters ability to respond to GH, indicating that CREB binding to the promoter is not essential for SOCS3 transcription. Interestingly, expression of both CREB wt and A-CREB resulted in decreased basal SOCS3 promoter activation.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 7. Involvement of CREB and AP1 Transcription Factors on SOCS3 Expression
A, BaF/3-hGHR cells were treated with GH for 15 min at 1 µg/ml, and whole cell extracts were immunoprecipitated with an antibody against CREB. Phospho-specific antibodies to CREB-S were used for Western blot, and the membrane was stripped and reprobed with a CREB antibody to establish loading. B, Luciferase activity was compared in cells transfected with either 6T3, or a promoter that had been mutated in the AP1/CRE response element (AP1m) (wt, gtgactaa; mutant, AAgCTtaa), with and without GH stimulation for 6 h at 1 µg/ml (P < 0.001). C, Luciferase activity was measured in cells that had been cotransfected with 6T3 as well as empty vector, CREB wt, or A-CREB constructs, with or without GH stimulation for 6 h at 1 µg/ml (P < 0.05). BaF/3-hGHR cells were pretreated with or without inhibitors to JNK (SP600125 for 1 h at 10 µM) (D) or p38 MAPK (SB220025 for 1 h at 1 µM) (E) followed by 30 min of GH stimulation at 1 µg/ml, and SOCS3 mRNA was quantitated using QPCR. Results are expressed relative to vehicle (Veh)-treated cells (P < 0.01). In the case of all figures, different superscripts denote significant differences, and same superscripts indicate no significant differences.
|
|
AP1 proteins, such as c-Fos and c-Jun have been shown to bind to the AP1/CRE response element (–105/–99) on the SOCS3 promoter, thereby up-regulating transcription (23). We investigated possible involvement of these transcription factors by pretreating cells with specific inhibitors of their activators, SP600125 (p38 MAPK) (Fig. 7D
) or SB220025 (JNK) (Fig. 7E
), and then measuring SOCS3 mRNA expression after GH treatment. Pretreatment of cells with inhibitors of p38 MAPK and JNK had no effect on basal SOCS3 expression, but significantly impaired the ability of BaF/3-hGHR cells to respond to GH stimulation.
FOXO3a Augments SOCS3 Promoter Activation
The FOXO proteins, or Forkhead-related proteins, are a family of transcription factors involved in cell cycle progression and apoptosis. The murine SOCS3 promoter has a possible FOXO binding motif within the minimal promoter (–103/–95), and the significance of this for SOCS3 expression was evaluated using a promoter that had been mutated in this region. This FOXOm promoter was compared with the parent 6T3 promoter for its ability to respond to GH stimulation (Fig. 8A
) and was found to have reduced basal luciferase activity, and was minimally responsive to GH stimulation. The effect of coexpression of FOXO3a wt, and constitutively active (A3) expression constructs with the parent 6T3 promoter, as well as with the mutated FOXOm promoter, was studied by measuring luciferase activity in response to GH or vehicle treatment (Fig. 8B
). Expression of FOXO3a wt and A3 increased both basal and GH-stimulated luciferase expression by the 6T3 promoter. Again, the FOXOm promoter had reduced basal luciferase activity and responded only marginally to GH stimulation, and this was not rescued by coexpression of the FOXO3a constructs.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 8. Involvement of FOXO3a on SOCS3 Expression
A, Luciferase activity was measured in cells that had been transfected with either the 6T3 promoter or a promoter that was mutated in the putative FOXO binding motif (FOXOm) (wt, gactaaacattac; mutant, gactaCCcattac) after GH stimulation for 6 h at 1 µg/ml. Results are expressed as RLU (P < 0.05). B, BaF/3-hGHR cells were cotransfected with either the 6T3 or the FOXOm promoter, as well as expression constructs for FOXO3a wt or FOXO3a A3, and luciferase activity was measured after GH stimulation for 6 h at 1 µg/ml. Results are expressed as RLU (P < 0.05). In the case of all figures, different superscripts denote significant differences, and same superscripts indicate no significant differences. The use of two superscripts indicates no significant difference of that value to two other values. Veh, Vehicle.
|
|
GH Treatment Induces c-Fos, c-Jun, and FOXO3a Binding to Elements on the SOCS3 Promoter
Due to the partial overlap of the putative FOXO (–103/–95) binding motif with the AP1/CRE (–105/–99) response element on the promoter, it is possible that each of the FOXOm and AP1/CREm mutations could interfere with transcription factor binding at overlapping sites. To address this issue, gel shift assay was performed using a labeled probe that encompassed the AP1/CRE, the FOXO, and dSRE elements on the murine SOCS3 promoter (Fig. 9A
). Interestingly, we observed complex formation with nuclear extracts from both vehicle- and GH-treated cells, and this complex was shifted in both vehicle- and GH-treated extracts by an antibody against CREB, but not by antibodies again c-Fos and c-Jun, indicating that this region of the promoter is constitutively occupied by CREB in these cells. However, upon GH stimulation the complex intensity was increased, and in addition to CREB, antibodies against c-Fos, c-Jun, and FOXO3a were able to reduce this complex.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 9. CREB, c-Fos, c-Jun, and FOXO3a Binding to the SOCS3 Promoter after GH Treatment
A, Gel shift assay using a labeled probe encompassing the AP1/CRE, FOXO and dSRE motifs on the SOCS3 promoter (gagtagtgactaaacattacaagaagaccgg) and nuclear extracts treated with GH for 15 min at 1 µg/ml. Antibodies (Ab) to c-Fos, c-Jun, CREB, FOXO3a, and STAT5 were used to shift the complex, and 200x unlabeled probe was used for cold competition. B, ChIP assay was performed on chromatin from BaF/3-hGHR cells treated with GH for 15 min at 1 µg/ml, antibodies to FOXO3a, c-Fos, c-Jun, CREB and negative control (NC) IgG, and PCR primers to the murine SOCS3 promoter.
|
|
ChIP assay was used to further evaluate the binding of these transcription factors to the SOCS3 promoter after GH stimulation (Fig. 9B
). GH treatment stimulated binding of c-Fos, c-Jun, and FOXO3a to the promoter, whereas CREB was directly bound in vehicle-treated cells and displaced after GH stimulation. This result was verified using a second CREB antibody, raised against serine phosphorylated CREB (data not shown). This is consistent with the CREB overexpression reporter assay (Fig. 7C
), which showed that SOCS3 promoter activation by GH was not dependent on CREB binding to the DNA because coexpression of A-CREB did not prevent luciferase activity after GH treatment. The apparent discrepancies between the ChIP and gel shift assays relative to CREB association with the SOCS3 promoter are addressed in the discussion.
FOXO3a and STAT5 Interact Directly in BaF/3-hGHR Cells
FOXO1a has previously been reported to interact with STAT3 (30), and so we looked for a STAT5/FOXO3a protein-protein interaction in BaF/3-hGHR cells using coimmunoprecipitation and Western blot. FOXO3a was found to bind to STAT5-Y in both vehicle- and GH-treated cells, suggesting a constitutive association (Fig. 10
).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 10. STAT5 and FOXO3a Interact Directly in BaF/3-hGHR Cells
Cells were treated with GH for 15 min at 1 µg/ml and whole cell extracts prepared. Coimmunoprecipitations were performed using a FOXO3a antibody, or a negative control IgG, for immunoprecipitation (IP). Western blot (WB) was performed using a STAT5-Y antibody, and membrane was stripped and reprobed with the FOXO3a antibody to establish equal loading.
|
|
 |
DISCUSSION
|
|---|
SOCS3 expression is stimulated by cytokine signaling, and SOCS3 acts as a negative feedback regulator to prevent overstimulation of cytokine-responsive cells. Cytokine stimulation of SOCS3 expression has been studied in a number of cell models and has been found to utilize the JAK/STAT signaling cascade, resulting in STAT binding to a pSRE on the SOCS3 promoter, initiating transcription. The only other study of GH stimulation of the SOCS3 promoter found that the STATs were not necessary for this process in rat hepatocytes, where only the integrity of the GC- and A/T-rich regions of the promoter was required (25). The current study in pro-B cells indicates that the JAK/STAT signaling pathway is indeed necessary for GH stimulation of SOCS3 expression in these cells, although it utilizes STAT5 but not STAT1 or 3, and shows a preference for STAT5b rather than STAT5a. In addition, this system showed no requirement for the GC-rich region of the SOCS3 promoter. However, as well as the classical JAK/STAT pathway, SOCS3 expression in these cells is reliant on the recruitment of c-Fos and c-Jun transcription factors to an AP1/CRE response element on the promoter, and the concurrent removal of CREB from the same motif. Furthermore, we have shown that FOXO3a is directly associated with STAT5 in these cells because it binds to a motif on the SOCS3 promoter after GH treatment, and promoter activity is augmented by FOXO3a overexpression. Together, these findings identify a novel signaling pathway with direct implications for cytokine responsiveness in immune cells.
The transcriptional regulation of SOCS3 expression appears to be largely cell and ligand specific. However, most studies of cytokine stimulation of SOCS3 show a requirement for the pSRE (–72/–64) on the promoter and STAT binding to this motif (19, 20, 21, 22). Some studies find that the pSRE alone is not sufficient for transcriptional activation, and that other response elements are necessary. For example, IL-6 stimulation of SOCS3 was shown to require Sp3 binding to the GC-rich region of the promoter (–58/–52) in addition to STAT3 at the pSRE (20). Other studies report that the pSRE is not required for cytokine stimulation of SOCS3 expression. For example, Paul et al. (25), in the only other study of GH stimulation of the SOCS3 promoter, reported that this process was independent of the SREs, and required the presence of the GC-rich and A/T-rich regions. Noncytokine stimulation of SOCS3 is equally conflicting in relation to cis elements. Insulin-induced SOCS3 expression appears to be STAT5b-dependent (24), whereas cAMP-inducing neuropeptides cause recruitment of c-Fos and c-Jun to the AP1 region of the promoter (–105/–99) in a PKA-dependent manner (23), and PGE2 treatment of T47D breast cancer cells induces expression via Sp1 binding to the GC-rich region (49).
In BaF/3-hGHR cells, GH signals by triggering JAK2 tyrosine phosphorylation of STAT5. These cells show a preference for STAT5b rather than STAT5a binding to the pSRE of the SOCS3 promoter as a requirement for transcriptional activation. Indeed, overexpression of STAT5a CA and DN prevented both basal and GH-stimulated SOCS3 promoter activation, which suggests that STAT5a may act as a repressor of SOCS3 expression in BaF/3-hGHR cells, presumably by binding to the SRE and preventing STAT5b binding. The negative regulatory effect of STAT5a is cell specific because these same STAT5a constructs coexpressed with the same SOCS3 promoter construct stimulated luciferase activity in breast cancer cells (26). The specific involvement of STAT5b signaling has been reported previously in BaF/3 cells based on the use of specific antibodies (31).
It is notable that there have been previous reports of STAT5a/STAT5b preference by some genes. For example the estrogen receptor
promoter can be stimulated by either STAT5a or STAT5b, whereas the estrogen receptor ß promoter is only responsive to STAT5b. This preference was linked to a single base difference between the SREs on these two promoters (32). However, we are not aware of any other reports that show that STAT5a can act as a repressor of transcription by competing with STAT5b, in these or any other cells. STAT5a and STAT5b show 91% homology at the amino acid level, with divergence at the amino-terminal and carboxy-terminal regions. Their DNA binding domains are also highly conserved, and they both bind to the same DNA elements. Some studies claim that certain SRE sequences are specific for certain STATs (33, 34), although the pSRE on the SOCS3 promoter is claimed equally as STAT1/3 specific (19, 20, 22) and STAT5 specific (24) by various groups. We propose that this is largely cell specific and have seen STAT1, STAT3, STAT5a, and STAT5b binding to this same element depending on cell type and stimulating ligand (26). Nevertheless, in BaF/3-hGHR cells, the pSRE appears to respond to STAT5b only.
It is important to note that overexpression of STAT5b wt and CA increase basal luciferase activity (Fig. 5D
), but this cannot be further increased by GH treatment. It is possible that the wt and CA constructs maximally stimulate the SOCS3 promoter, preventing further activation by GH. In addition, overexpression of STAT5b DN reduces basal luciferase activity but does not prevent promoter activation by GH treatment. This suggests that GH-induced stimulation of the promoter does not require the transactivation domain, which is missing from STAT5b DN. This form of STAT5b retains its ability to be tyrosine-phosphorylated after cytokine treatment, and to bind to cis response elements on the promoter, although it is not able to initiate gene transcription (35). Persistence of GH-induced SOCS3 promoter activity in the presence of STAT5b DN may suggest that STAT5b is essential for basal SOCS3 promoter activation, but has a more permissive role in GH-stimulated SOCS3 expression, and occupation of the pSRE by STAT5b is all that is required. This would suggest that the AP1 transcription factors are actually responsible for the active stimulation of SOCS3 expression but require the integrity of the pSRE and occupation of this site by STAT5b. Alternatively, STAT5b may be directly associated with a coactivator, and this complex could induce transcriptional activation in the absence of the STAT5b transactivation domain. For example, STAT5 was shown to directly associate with FOXO3a in BaF/3-hGHR cells. Previous studies have shown that STAT5 directly associates with the glucocorticoid receptor (36). This complex potentiates STAT5-induced gene transcription while inhibiting transcription of those genes dependent solely on glucocorticoid receptor activation. The ability of STAT5 to be tyrosine phosphorylated is essential for the formation of this complex, whereas truncation and removal of the STAT5 transactivation domain does not prevent complex formation, or function (37). To further elucidate these mechanisms, the employment of a mutant STAT5b that is unable to nuclear translocate may be advantageous.
In addition to STAT5b occupation of the pSRE, activation of the SOCS3 promoter in BaF/3-hGHR cells required the integrity of the AP1/CRE response element (–105/–99), which bound c-Fos and c-Jun. This region of the SOCS3 promoter was previously found to be essential for stimulation by cAMP-inducing neuropeptides (23), binding c-Fos and c-Jun, although this pathway was STAT independent. GH has been shown to induce expression of both c-Fos and c-Jun in adipocytes (38), although we have shown here that an inhibitor of protein synthesis had no effect of GH-stimulated SOCS3 mRNA expression (Fig. 1C
), indicating that transcription of new proteins is not necessary. In BaF/3-hGHR cells, GH stimulation of SOCS3 appears to involve p38 MAPK and JNK, as indicated by the use of specific inhibitors (Fig. 7
, D and E). Previous studies have shown the ability of GH to activate p38 MAPK in adipocytes (39) and Chinese hamster ovary cells (40) and JNK in NIH3T3 cells (41, 42). The ability of JNK to phosphorylate c-Jun has been established (43), and recently Tanos et al. (44) showed that this occurred concurrently with c-Fos phosphorylation by p38 MAPK in response to UV stimulation, resulting in AP1-driven transcriptional regulation.
The AP1/CRE motif on the SOCS3 promoter is also capable of binding CREB, although, despite GH treatment resulting in serine phosphorylation of CREB in BaF/3-hGHR cells (Fig. 7A
), as well as in preadipocytes (29), our results suggest that it cannot stimulate SOCS3 expression without the recruitment of c-Fos and c-Jun. Overexpression of a dominant-negative form of CREB (A-CREB), which dimerizes with endogenous CREB and prevents DNA binding, did not prevent GH-induced SOCS3 promoter activation (Fig. 7C
). Rather, overexpression of A-CREB, as well as CREB wt, caused a reduction in basal SOCS3 promoter activation suggesting that CREB may be a negative regulator of SOCS3 expression in these cells. In addition, ChIP assay revealed that CREB is displaced from the SOCS3 promoter after GH treatment (Fig. 9B
), a result that was verified using a second CREB antibody raised against serine phosphorylated CREB (data not shown). In contrast, gel shift assay show that CREB is still associated with this complex after GH treatment (Fig. 9A
). Given the inherent limitations of gel shift assays, which employ short linear DNA probes that cannot mimic the complex secondary structure of the native promoter, it is likely that this result is an artifact of an in vitro experiment. ChIP is a far more physiologically relevant in vivo assay, and this result is supported in part by the negative effect of CREB overexpression on basal promoter activation seen in Fig. 7C
. Taken together, these results are consistent with a model by which CREB is directly bound to the promoter before treatment but is displaced by c-Fos, c-Jun, and FOXO3a after GH treatment.
Further investigation of the SOCS3 promoter revealed a putative FOXO binding motif (–103/–95), and mutation of this site significantly reduced the promoters ability to respond to GH stimulation in BaF/3-hGHR cells (Fig. 8A
). In addition, both overexpression of FOXO3a wt and the constitutively active FOXO3a A3, which is mutated to prevent nuclear export, enhanced SOCS3 promoter activation (Fig. 8B
). Moreover, GH treatment caused recruitment of FOXO3a to the SOCS3 promoter (Fig. 9B
), as ascertained by ChIP assay, and gel shift assays indicated that FOXO3a binds to a motif that overlaps with AP1/CRE response element on the SOCS3 promoter (Fig. 9A
). The FOXO motif identified on the SOCS3 promoter is the only one within approximately 1200 bases of the 6T3 minimal promoter, suggesting that any interaction must occur at this site. Alternatively, FOXO3a could influence transcription via a protein-protein interaction, and indeed we saw a direct interaction between STAT5 and FOXO3a in these cells (Fig. 10
). This is the first report of such an interaction, although FOXO proteins have been shown to bind to STAT3 in other systems (30). The FOXO family of transcription factors, also known as the forkhead-related or winged helix proteins, undergo a complex system of posttranslational modifications that regulate their cellular localization and their subsequent transcriptional activity (45). They can be serine phosphorylated on specific resides by Akt, a process that interferes with DNA binding, exposes a nuclear export sequence, and induces binding to the chaperone protein 14-3-3, causing them to be shuttled out of the nucleus and targeted for proteosomal degradation. In addition, under conditions of oxidative stress, FOXO can be phosphorylated by JNK (46), which allows association with the nuclear SIRT1 (a nicotinamide adenine dinucleotide-dependent protein deacetylase) and induces transcription of genes associated with DNA repair and cell cycle arrest, such as GADD45 and p27kip. In BaF/3-hGHR cells FOXO causes transcription of the proapoptotic Bim in response to cytokine withdrawal (47). Once again, it is important to note that overexpression of FOXO3a wt and A3 increase basal luciferase activity but prevent further activation of the promoter by GH treatment (Fig. 8B
). In addition, the interaction between STAT5 and FOXO3a is not increased with GH stimulation (Fig. 10
). This may indicate a role for FOXO3a in basal SOCS3 promoter activation, but perhaps a permissive role in GH-stimulated SOCS3 expression, in that FOXO3a may be recruited to the SOCS3 promoter with STAT5, potentially linking STAT5 and the AP1 transcription factors (Fig. 11
).
This is the first study of the SOCS3 promoter to show that GH-induced activation is via the JAK/STAT signaling cascade. This leads to STAT5b activation and binding to the pSRE on the SOCS3 promoter, increasing its expression. Furthermore, our results implicate involvement of p38 MAPK and JNK, binding of c-Fos, c-Jun, and FOXO3a to the AP1/CRE and FOXO binding motifs on the proximal promoter and the concurrent displacement of CREB, and a direct interaction between STAT5 and FOXO3a. Together, this identifies a novel signaling pathway of GH-stimulated SOCS3 transcription in a pro-B cell model, which may have implications for other hematopoietic cells and their proliferation, differentiation, response to immune challenge, and the treatment of immune disorders.
 |
MATERIALS AND METHODS
|
|---|
Cell Culture
BaF/3 cells, a mouse pro-B cell line, were stably transfected with physiological levels of human GH receptor (BaF3/hGHR). Cells were maintained in RPMI 1640 with 10% fetal calf serum, 100 ng/ml recombinant GH, and gentamycin at 37 C in 5% CO2. Cells were starved in 0.5% fetal calf serum without GH for 16 h before treatment unless specified otherwise.
Materials
Recombinant human GH was prepared according to Wan et al. (48). PhosphoPlus CREB (Ser133) antibody kit was purchased from Cell Signaling (Beverly, MA). STAT5 (C-17), SOCS3, and FKHRL1 (H-144) antibodies were from Santa Cruz (Santa Cruz, CA). Anti-phosphotyrosine, clone 4G10 antibody was purchased from Upstate (Lake Placid, MY). ECL plus Western Blotting Detection System, Nick columns and Protein A Sepharose 6MB were from Amersham Biosciences (Buckinghamshire, UK). DNA-Free kit was purchased from Geneworks (Adelaide, Australia), Trizol Reagent and SuperScript First Strand kit was from Invitrogen (Carlsbad, CA). TaqMan 2x PCR Master Mix was obtained from Applied Biosystems (Foster City, CA). Complete Inhibitors were purchased from Roche Diagnostics (Mannheim, Germany) and Steady-Glo Luciferase Assay System, Lysis Buffer, Pfu DNA polymerase and JM105 competent cells from Promega (Madison, WI). Taq DNA Polymerase, deoxynucleotide triphosphates (dNTPs) and Dpn1 were from New England Biolabs (NEB) (Boston, MA), and QIAprep Spin miniprep kit was from QIAGEN (Victoria, Australia). Bicinchoninic acid (BCA) protein assay kit (Pierce, Rockford, IL) and Klenow Fragment were obtained from Quantum Scientific (Queensland, Australia). The Jak Inhibitor I was from Calbiochem (San Diego, CA), the JNK inhibitor SP600125, the p38 MAPK inhibitor SB220025, cycloheximide, ß-Actin antibody, and deoxyinosine-deoxycytosine were from Sigma (Victoria, Australia). All custom oligos were supplied by Sigma.
Expression Plasmids
The SOCS3 promoter deletion series in the luciferase expression vector pGL3 were generously donated by Shlomo Melmed (22). STAT5a and STAT5b wt, CA, and DN forms in the pCDNA3.1 expression vector were kindly donated by Toshio Kitamura (University of Tokyo, Tokyo, Japan). The CREB wt and A-CREB constructs in the pCDNA3.1 expression vector were generously donated by David Ginty (Johns Hopkins University School of Medicine, Baltimore, MD). The FOXO3a wt and FOXO3a A3 constructs in the pCDNA3.1 expression vector were a gift from Jorge Martin Perez (IIB, Perez, Spain).
Cell Stimulation and QPCR
After treatment, cells were washed in cold PBS and resuspended in Trizol reagent. RNA was extracted according to the Trizol reagent protocol, and resuspended in a minimal volume of water. RNA was quantified using a spectrophotometer, and visualized on a 1.2% agarose gel. Two micrograms of RNA were deoxyribonuclease treated followed by reverse transcription, as per kit instructions. cDNA was diluted 1:40 in water, and quantitative real-time PCR was performed using 4.5 µl cDNA, 3 µM primers, 3 µM and 2 µM TaqMan probes for Actin and SOCS3, respectively, and 13 µl TaqMan Master Mix in a 25-µl final volume. SOCS3 forward primer, cagctccaaaagcgagtacca; SOCS3 reverse primer, cggtcacgggcgctccagtaga; SOCS3 probe, 6-carboxyfluorescein-ttgcgcacggcgttcacca-6-carboxytetramethylrhodamine; ß-actin forward primer, ttcaacaccccagccatgt; actin reverse primer, ctgtggtacgaccagaggcata; ß-actin probe, 6-carboxyfluorescein-cgtagccatccagctgtgctgtccc-6-carboxytetramethylrhodamine. All experiments and QPCRs were performed in duplicate, and samples were run in triplicate. Analysis was performed by calculating the change in cycle threshold between ß-actin and SOCS3, and expressed as fold change relative to vehicle-treated cells.
Immunoprecipitation and Western Blot
Treated cells were washed in cold PBS and resuspended in tyrosine kinase (TK) lysis buffer: 50 mM HEPES (pH 7.4), 150 mM NaCl, 1% Triton X-100, 1 mM Na3VO4, 30 mM NaF, 10 mM Na4P2O7, 10 mM EDTA plus inhibitors (TK+). Protein A beads were washed twice in PBS and blocked in 1% BSA in TBS with 0.1% Tween 20 (TBST) for 1 h at room temperature with rotation. Beads were washed in PBS and in TK lysis buffer without inhibitors (TK–), and 2 µg antibody in TK– bound overnight at 4 C with rotation. Beads were washed in PBS and twice in TK–, and protein in TK+ buffer was bound for 2 h at 4 C with rotation. Beads were washed three times in TK+, liquid removed from the beads, bound proteins and eluted in sample buffer [15 mM Tris-HCl (pH 6.8), 2% sodium dodecyl sulfate (SDS), 10% glycerol, 10 mM dithiothreitol (DTT)] at 100 C for 5 min. Samples were loaded onto 8% SDS-PAGE gels, transferred onto nitrocellulose membranes, blocked in 2% BSA in TBST for 1 h at room temperature, and primary antibody bound over night at 4 C in blocking buffer with rocking. Membranes were washed three times for 5 min each in TBST, and secondary antibody bound for 2 h at room temperature with rocking. Membranes were washed as before, and ECL plus reagent used as per manufacturers instructions to develop signal.
For Western blots, not requiring immunoprecipitation, treated cells in 12-well dishes were lysed in 100 µl TK+ buffer, and 15 µl loaded onto SDS-PAGE gels.
Site-Directed Mutagenesis
Mutant primers were used at 10 µM in a 50 µl PCR with Pfu DNA polymerase, 10 mM dNTPs, and 40 ng template (6T3 promoter construct). PCR was performed at 95 C for 30 sec, followed by 16–20 cycles of 96 C for 30 sec, 55–65 C for 60 sec, and 68 C for 10 min, then followed by a 4 C hold. NEB reaction buffer 4 (5.5 µl), and 1 µl Dpn1 was added to each PCR, and samples were digested at 37 C for 2 h. Two microliters of this digestion were transformed into chemically competent JM105 cells. Colonies were picked from plates, DNA was prepared by miniprep and sequenced by standard procedures.
Transfection and Reporter Assay
The 1–1.5 x 107 cells in 500 µl complete culture media with 10 µg luciferase construct DNA, and 10 µg expression constructs where applicable, were electroporated at 350 V, 950 µF. Cells were allowed to recover in complete media for 24 h before being aliqoted into 24-well plates in starve media. After 16 h, cells were treated with vehicle or GH for 6 h, and lysed in lysis buffer. Luciferase activity was measured using a BMG Labtech (Offenburg, Germany) FLUOstar OPTIMA microplate reader. Results were normalized to protein concentration determined by BCA assay, and expressed as relative luciferase units (RLU).
Gel Shift Assay
Treated cells were washed in cold PBS, scraped, and centrifuged at 13,000 rpm for 1 min at 4 C. Pellets were resuspended in 400 µl Buffer A [10 mM HEPES (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 1 mM sodium vanadate and Complete Inhibitors] and incubated on ice for 30 min. Cells were vortexed, centrifuged at 13,000 rpm for 1 min at 4 C, and the pellet was resuspended in 100 µl cold Buffer C [20 mM HEPES (pH 7.9), 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 1 mM sodium vanadate, and Complete Inhibitors]. Nuclei were incubated on ice for 30 min, vortexed, and centrifuged at 13,000 rpm for 5 min at 4 C. Protein concentration of the supernatant was determined by BCA assay, and 5–10 µg nuclear extracts were used in each reaction. Synthetic oligonucleotides were annealed using 1µg of each strand with 4 µl NEB buffer 2, in a 40-µl reaction, boiled for 2 min in a water bath and cooled slowly with stirring. Four-microliter annealed oligos with 3 µl each of 5 µM deoxy (d) GTP, dATP, and dTTP, 5 µl NEB buffer 2, and 1 µl Klenow fragment were labeled with 4 µl 32P-dCTP (250 µCi, 9.25 Mbq stock) in a 50-µl reaction at room temperature for 1 h. Reactions were purified on Nick columns, counted, and diluted to 25,000–35,000 cpm/µl. Binding reaction was prepared with 5x binding buffer [50 mM Tris (pH 8.0), 200 mM KCl, 30% glycerol, 5 mM DTT, 0.25% Nonidet P40, to 10 ml with dH2O], 4 µg poly deoxyinosine-deoxycytosine, 100 ng denatured salmon sperm DNA, 100 ng nonspecific single-stranded oligo, 10 µg BSA, 5–10 µg nuclear extract, with or without antibody or 200x excess unlabeled probe in a 20-µl reaction, and incubated on ice for 20 min. Three microliters (
100,000 cpm) of labeled probe were added and incubated for 10 min at room temperature. The reaction was loaded onto a 5% 0.5 x TBE nondenaturing polyacrylamide gel and run for 1.5–2 h at 150 V at room temperature. The gel was dried onto filter paper, and exposed to film for 18–48 h.
ChIP Assay
Treated cells were cross-linked using 1% formaldehyde on a rocking platform for 10 min at room temperature. Cross-linking was stopped by the addition of 0.125 M glycine for 5 min, cells were washed 2x cold PBS, and lysed in 1 ml lysis buffer [1% SDS, 10 mM EDTA, 50 mM Tris (pH 8.0)]. Chromatin was sonicated on ice to an average length of 600 bp using a sonicator at 30% capacity for four times each with 30-sec pulses. Chromatin was centrifuged at 14,000 rpm for 10 min at 4 C, supernatant collected and diluted [0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl (pH 8.1), 167 mM NaCl]. Chromatin was precleared with 40 µl Protein A Sepharose (50% slurry), 2 µg sonicated salmon sperm DNA, and 20 µl preimmune rabbit serum for 1 h at 4 C. After gentle centrifugation to pellet beads, antibodies (2–4 µg) were added and bound at 4 C overnight with rotation. Forty-five microliter Protein A Sepharose was added and further rotated for 1 h, and beads were washed for 10 min in each of TSI [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl (pH 8.1), 150 mM NaCl, protease inhibitors], TSII [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl (pH 8.1), 500 mM NaCl, protease inhibitors] and TSIII [0.25 M LiCl, 1% Nonidet P40, 1% deoxycholate, 1 mM EDTA, 10 mM Tris-HCl (pH 8.1), protease inhibitors]. Beads were washed 2x TE buffer and eluted three times for 15 min each on a vortex in elution buffer (1% SDS, 0.1 M NaHCO3) followed by centrifugation at 12,00 rpm for 3 min. Eluates were pooled, 8 µl 5 M NaCl added, and heated to 65 C for 5 h to reverse cross-linking. Samples were purified using QIAGEN PCR Purification Kit, eluted in 30 µl water and used for PCR. PCR primers were designed specifically for the mouse SOCS3 promoter (forward gttccaggaatcggggggcggg, reverse ccccctctggcttcgctgctcc) and PCR (2 U Taq polymerase, 1x ThermoPol Buffer, 400 µM dNTP, 500 µM primers and 2.5% dimethyl sulfoxide) was performed as follows: 94 C for 2 min, 35 cycles of 94 C for 30 sec, 70 C for 30 sec, and 72 C for 30 sec, and 72 C for 2 min.
Analysis of Results
Data were log transformed to remove heterogeneity of variance, and ANOVA was used to identify significant main events and interactions. Post hoc Newman-Keuls multiple comparison test was performed to determine significance between treatments. Significance between individual values was highlighted on graphs through the use of different superscripts, and same superscripts denote no significance. Where a value is not significantly different from two other distinct values, it was labeled with both of these superscripts.
 |
FOOTNOTES
|
|---|
This work was supported by the Australian Research Council (ARC) and National Health and Medical Research Council (NH&MRC) Dora LushPostgraduate Research Scholarship.
Declaration: The authors have nothing to declare.
First Published Online July 3, 2007
Abbreviations: AP1, Activator protein; BCA, Bicinchoninic acid; CA, constitutively active; ChIP, chromatin immunoprecipitation; CRE, cAMP response element; CREB, cAMP response element binding protein; DN, dominant negative; dNTPs, deoxynucleotide triphosphates; dSRE, distal SRE; DTT, dithiothreitol; GC, guanine cytosine; GCm, mutated GC-rich region; hGHR, human GH receptor; JAK, Janus kinase; JNK, c-Jun N-terminal kinase; MEK, MAPK kinase kinase; mdSRE, mutated form of dSRE; mpSRE, mutated form of pSRE; pSRE, proximal SRE; QPCR, quantitative PCR; RLU, relative luciferase units; SOCS, suppressors of cytokine signaling; SRE, STAT response element; STAT, signal transducers and activators of transcription; TK, tyrosine kinase; wt, wild type.
Received for publication November 28, 2006.
Accepted for publication June 25, 2007.
 |
REFERENCES
|
|---|
- Krebs DL, Hilton DJ 2000 SOCS: physiological suppressors of cytokine signaling. J Cell Sci 113:2813–2819[Abstract]
- Alexander WS, Starr R, Metcalf D, Nicholson SE, Farley A, Elefanty AG, Brysha M, Kile BT, Richardson R, Baca M, Zhang JG, Willson TA, Viney EM, Sprigg NS, Rakar S, Corbin J, Mifsud S, DiRago L, Cary D, Nicola NA, Hilton DJ 1999 Suppressors of cytokine signaling (SOCS): negative regulators of signal transduction. J Leukoc Biol 66:588–592[Abstract]
- Alexander WS, Hilton DJ 2004 The role of suppressors of cytokine signaling (SOCS) proteins in regulation of the immune response. Annu Rev Immunol 22:503–529[CrossRef][Medline]
- Auernhammer CJ, Melmed S 2001 The central role of SOCS-3 in integrating the neuro-immunoendocrine interface. J Clin Invest 108:1735–1740[CrossRef][Medline]
- Wormald S, Hilton DJ 2004 Inhibitors of cytokine signal transduction. J Biol Chem 279:821–824[Abstract/Free Full Text]
- Chikanza IC 1999 Prolactin and neuroimmunomodulation: in vitro and in vivo observations. Ann NY Acad Sci 876:119–130[CrossRef][Medline]
- Greenhalgh CJ, Alexander WS 2004 Suppressors of cytokine signalling and regulation of growth hormone action. Growth Horm IGF Res 14:200–206[CrossRef][Medline]
- Reddy EP, Korapati K, Chaturvedi P, Rane S 2000 IL-3 signaling and the role of Src kinases, JAKs and STATs: a covert liaison unveiled. Oncogene 19:2532–2547[CrossRef][Medline]
- Heinrich PC, Behrmann I, Haan S, Hermanns HM, Muller-Newen G, Schaper F 2003 Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem J 374:1–20[CrossRef][Medline]
- Rane SG, Reddy EP 2002 JAKs, STATs and Src kinases in hematopoiesis. Oncogene 21:3334–3358[CrossRef][Medline]
- Ram PA, Waxman DJ 1999 SOCS/CIS protein inhibition of growth hormone-stimulated STAT5 signaling by multiple mechanisms. J Biol Chem 274:35553–35561[Abstract/Free Full Text]
- Cheon H, Rho YH, Choi SJ, Lee YH, Song GG, Sohn J, Won NH, Ji JD 2006 Prostaglandin E2 augments IL-10 signaling and function. J Immunol 177:1092–1100[Abstract/Free Full Text]
- Magrangeas F, Bond HM, Denis S, Jacques Y, Minvielle S 2001 Negative cross-talk between interleukin-3 and interleukin-11 is mediated by suppressor of cytokine signalling-3 (SOCS-3). Biochem J 15:223–230
- Badolato R BH, Valerio G, Petrella A, Morrone G, Waters MJ, Venuta S, Tenore A 1994 Differential expression of surface membrane growth hormone receptor on human peripheral blood lymphocytes detected by dual fluorochrome flow cytometry. J Clin Endocrinol Metab 79:984–990[Abstract]
- Jeay S, Sonenshein GE, Kelly PA, Postel-Vinay M-C, Baixeras E 2001 Growth hormone exerts antiapoptotic and proliferative effects through two different pathways involving nuclear factor-
B and phosphatidylinositol 3-kinase. Endocrinology 142:147–156[Abstract/Free Full Text] - Sumita K, Hattori N, Inagaki C 2005 Effects of growth hormone on the differentiation of mouse B-lymphoid precursors. J Pharmacol Sci 97:408–416[CrossRef][Medline]
- Baixeras E, Jeay S, Kelly PA, Postel-Vinay M-C 2001 The proliferative and antiapoptotic actions of growth hormone and insulin-like growth factor-1 are mediated through distinct signaling pathways in the Pro-B Ba/F3 cell line. Endocrinology 142:2968–2977[Abstract/Free Full Text]
- Adams TE, Hansen JA, Starr R, Nicola NA, Hilton DJ, Billestrup N 1998 Growth hormone preferentially induces the rapid, transient expression of SOCS-3, a novel inhibitor of cytokine receptor signaling. J Biol Chem 273:1285–1287[Abstract/Free Full Text]
- Gatto L, Berlato C, Poli V, Tininini S, Kinjyo I, Yoshimura A, Cassatella MA, Bazzoni F 2004 Analysis of SOCS-3 promoter responses to interferon gamma. J Biol Chem 279:13746–13754[Abstract/Free Full Text]
- Ehlting C, Haussinger D, Bode JG 2005 Sp3 is involved in the regulation of SOCS3 gene expression. Biochem J 387:737–745[CrossRef][Medline]
- He B, You L, Uematsu K, Matsangou M, Xu Z, He M, McCormick F, Jablons DM 2003 Cloning and characterization of a functional promoter of the human SOCS-3 gene. Biochem Biophys Res Commun 301:386–391[CrossRef][Medline]
- Auernhammer CJ, Bousquet C, Melmed S 1999 Autoregulation of pituitary corticotroph SOCS-3 expression: characterization of the murine SOCS-3 promoter. Proc Natl Acad Sci USA 96:6964–6969[Abstract/Free Full Text]
- Bousquet C, Chesnokova V, Kariagina A, Ferrand A, Melmed S 2001 cAMP neuropeptide agonists induce pituitary suppressor of cytokine signaling-3: novel negative feedback mechanism for corticotroph cytokine action. Mol Endocrinol 15:1880–1890[Abstract/Free Full Text]
- Emanuelli B, Peraldi P, Filloux C, Sawka-Verhelle D, Hilton D, Van Obberghen E 2000 SOCS-3 is an insulin-induced negative regulator of insulin signaling. J Biol Chem 275:15985–15991[Abstract/Free Full Text]
- Paul C, Seiliez I, Thissen JP, Le Cam A 2000 Regulation of expression of the rat SOCS-3 gene in hepatocytes by growth hormone, interleukin-6 and glucocorticoids mRNA analysis and promoter characterization. Eur J Biochem 267:5849–5857[Medline]
- Barclay JL, Anderson ST, Waters MJ, Curlewis JD 2006 Regulation of SOCS3 expression by prolactin in breast cancer cells. Proc COMBIO2006 Annual Conference, Gold Coast, Australia, 2006, Sym-04-03, P40
- Zhu T, Ling L, Lobie PE 2002 Identification of a JAK2-independent pathway regulating growth hormone (GH)-stimulated p44/42 mitogen-activated protein kinase activity. GH activation of Ral and phospholipase D is Src-dependent. J Biol Chem 277:45592–45603[Abstract/Free Full Text]
- Manabe N, Kubota Y, Kitanaka A, Ohnishi H, Taminato T, Tanaka T 2006 Src transduces signaling via growth hormone (GH)-activated GH receptor (GHR) tyrosine-phosphorylating GHR and STAT5 in human leukemia cells. Leuk Res 30:1391–1398[CrossRef][Medline]
- Yarwood SJ, Kilgour E, Anderson NG 1998 Cyclic AMP potentiates growth hormone-dependent differentiation of 3T3–F442A preadipocytes: possible involvement of the transcription factor CREB. Mol Cell Endocrinol 138:41–50[CrossRef][Medline]
- Kortylewski M, Feld F, Kruger K-D, Bahrenberg G, Roth RA, Joost H-G, Heinrich PC, Behrmann I, Barthel A 2003 Akt modulates STAT3-mediated gene expression through a FKHR (FOXO1a)-dependent mechanism. J Biol Chem 278:5242–5249[Abstract/Free Full Text]
- Behncken SN, Billestrup N, Brown R, Amstrup J, Conway-Campbell B, Waters MJ 2000 Growth hormone (GH)-independent dimerization of GH receptor by a leucine zipper results in constitutive activation. J Biol Chem 275:17000–17007[Abstract/Free Full Text]
- Frasor J, Park K, Byers M, Telleria C, Kitamura T, Yu-Lee LY, Djiane J, Park-Sarge OK, Gibori G 2001 Differential roles for signal transducers and activators of transcription 5a and 5b in PRL stimulation of ER
and ERß transcription. Mol Endocrinol 15:2172–2181[Abstract/Free Full Text] - Boucheron C, Dumon S, Santos SCR, Moriggl R, Hennighausen L, Gisselbrecht S, Gouilleux F 1998 A single amino acid in the DNA binding regions of STAT5A and STAT5B confers distinct DNA binding specificities. J Biol Chem 273:33936–33941[Abstract/Free Full Text]
- Vidal OM, Merino R, Rico-Bautista E, Fernandez-Perez L, Chia DJ, Woelfle J, Ono M, Lenhard B, Norstedt G, Rotwein P, Flores-Morales A 2007 In vivo transcript profiling and phylogenetic analysis identifies SOCS2 as a direct STAT5b target in liver. Mol Endocrinol 21:293–311[Abstract/Free Full Text]
- Moriggl R, Gouilleux-Gruart V, Jahne R, Berchtold S, Gartmann C, Liu X, Hennighausen L, Sotiropoulos A, Groner B, Gouilleux F 1996 Deletion of the carboxyl-terminal transactivation domain of MGF-Stat5 results in sustained DNA binding and a dominant negative phenotype. Mol Cell Biol 16:5691–5700[Abstract]
- Stocklin E, Wissler M, Gouilleux F, Groner B 1996 Functional interactions between Stat5 and the glucocorticoid receptor. Nature 383:726–728[CrossRef][Medline]
- Pfitzner E, Jahne R, Wissler M, Stoecklin E, Groner B 1998 p300/CREB-binding protein enhances the prolactin-mediated transcriptional induction through direct interaction with the transactivation domain of Stat5, but does not participate in the Stat5-mediated suppression of the glucocorticoid response. Mol Endocrinol 12:1582–1593[Abstract/Free Full Text]
- Sumantran VN, Tsai ML, Schwartz J 1992 Growth hormone induces c-fos and c-jun expression in cells with varying requirements for differentiation. Endocrinology 130:2016–2024[Abstract/Free Full Text]
- Xu A, Wong LC, Wang Y, Xu JY, Cooper GJS, Lam KSL 2004 Chronic treatment with growth hormone stimulates adiponectin gene expression in 3T3-L1 adipocytes. FEBS Lett 572:129–134[CrossRef][Medline]
- Zhu T, Lobie PE 2000 Janus kinase 2-dependent activation of p38 mitogen-activated protein kinase by growth hormone. Resultant transcriptional activation of ATF-2 and CHOP, cytoskeletal re-organization and mitogenesis. J Biol Chem 275:2103–2114[Abstract/Free Full Text]
- Ling L, Zhu T, Lobie PE 2003 Src-CrkII-C3G-dependent activation of Rap1 switches growth hormone-stimulated p44/42 MAP kinase and JNK/SAPK activities. J Biol Chem 278:27301–27311[Abstract/Free Full Text]
- Zhu T, Goh ELK, LeRoith D, Lobie PE 1998 Growth hormone stimulates the formation of a multiprotein signaling complex involving p130Cas and CrkII. Resultant activation of c-Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK). J Biol Chem 273:33864–33875[Abstract/Free Full Text]
- Guha M, Mackman N 2001 LPS induction of gene expression in human monocytes. Cell Signal 13:85–94[CrossRef][Medline]
- Tanos T, Marinissen MJ, Leskow FC, Hochbaum D, Martinetto H, Gutkind JS, Coso OA 2005 Phosphorylation of c-Fos by members of the p38 MAPK family: role in the AP-1 response to UV light. J Biol Chem 280:18842–18852[Abstract/Free Full Text]
- Vogt PK, Jiang H, Aoki M 2005 Triple layer control: phosphorylation, acetylation and ubiquitination of FOXO proteins. Cell Cycle 4:908–913[Medline]
- Essers MA, Weijzen S, de Vries-Smits AM, Saarloos I, de Ruiter ND, Bos JL, Burgering BM 2004 FOXO transcription factor activation by oxidative stress mediated by the small GTPase Ral and JNK. EMBO J 23:4802–4812[CrossRef][Medline]
- Dijkers PF, Medema RH, Lammers J-WJ, Koenderman L, Coffer PJ 2000 Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the forkhead transcription factor FKHR-L1. CurrBiol 10:1201–1204[CrossRef][Medline]
- Wan Y, McDevitt A, Shen B, Smythe ML, Waters MJ 2004 Increased site 1 affinity improves biopotency of porcine growth hormone: evidence against diffusion dependent receptor dimerization. J Biol Chem 279:44775–44784[Abstract/Free Full Text]
- Barclay JL, Anderson ST, Waters MJ, Curlewis JD 2007 Characterization of the SOCS3 promoter response to prostaglandin E2 in T47D cells. Mol Endocrinol 21:2516–2528[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
J. L. Barclay, S. T. Anderson, M. J. Waters, and J. D. Curlewis
Characterization of the SOCS3 Promoter Response to Prostaglandin E2 in T47D Cells
Mol. Endocrinol.,
October 1, 2007;
21(10):
2516 - 2528.
[Abstract]
[Full Text]
[PDF]
|
 |
|