help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2007-0081
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
21/10/2565    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ben-Shlomo, A.
Right arrow Articles by Melmed, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ben-Shlomo, A.
Right arrow Articles by Melmed, S.
Molecular Endocrinology 21 (10): 2565-2578
Copyright © 2007 by The Endocrine Society

Selective Regulation of Somatostatin Receptor Subtype Signaling: Evidence for Constitutive Receptor Activation

Anat Ben-Shlomo, Oxana Pichurin, Nicole J. Barshop, Kolja A. Wawrowsky, John Taylor, Michael D. Culler, Vera Chesnokova, Ning-Ai Liu and Shlomo Melmed

Department of Medicine (A.B.-S., O.P., N.J.B., K.A.W., V.C., N.-A.L., S.M.), Cedars Sinai Research Institute, David Geffen School of Medicine at UCLA, Los Angeles, California 90048; and Ipsen Group (J.T., M.D.C.), Milford, Massachusetts 01757

Address all correspondence and requests for reprints to: Shlomo Melmed, M.D., Cedars-Sinai Medical Center, 8700 Beverly Boulevard, Academic Affairs, Room 2015, Los Angeles, California 90048. E-mail: Melmed{at}csmc.edu.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Anterior pituitary hormone secretion is under tonic suppression by hypothalamic somatostatin signaling through somatostatin receptor subtypes (SSTs). Because some hormonal axes are known to be abnormally regulated by ligand-independent constitutively active G protein-coupled receptors, we tested pituitary SSTs for selective constitutive signaling. We therefore differentially silenced endogenous SST2, SST3, and SST5 in somatostatin-sensitive ACTH-secreting mouse AtT-20 pituitary corticotroph cells using small inhibitory RNA (siRNA) and analyzed downstream SSTs-regulated pathways. Transfection with siRNA reduced specific receptor subtype mRNA expression up to 82%. Specificity of receptor silencing was validated against negative controls with different gene-selective siRNAs, concordance of mRNA and cAMP changes, reduced potency of receptor-selective agonists, and phenotype rescue by overexpression of the silenced receptor. Mouse SST3 > SST5 > SST2 knockdown increased basal cAMP accumulation (up to 200%) and ACTH secretion (up to 60%). SST2- and SST5-selective agonist potencies were reduced by SST3- and SST5-silencing, respectively. SST5 > SST2 = SST3 silencing also increased basal levels of ERK1/2 phosphorylation. SST3- and SST5-knockdown increased cAMP was only partially blocked by pertussis toxin. The results show that SST2, SST3, and SST5 exhibit constitutive activity in mouse pituitary corticotroph cells, restraining adenylate cyclase and MAPK activation and ACTH secretion. SST3 mainly inhibits cAMP accumulation and ACTH secretion, whereas SST5 predominantly suppresses MAPK pathway activation. Therefore, SST receptor subtypes control pituitary cell function not only through somatostatin binding to variably expressed cell membrane receptor subtypes, but also by differential ligand-independent receptor-selective constitutive action.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PITUITARY HORMONE SECRETION is under dual stimulatory and inhibitory hypothalamic control. Hypothalamic hormones including GHRH, CRH, GnRH, and somatostatin (SRIF) traverse the portal system and bind specific anterior pituitary cell surface receptors to elicit complex patterns of pituitary hormone release (1, 2). Although basal pituitary trophic hormone secretion is also tonically controlled by peripheral hormonal feedback systems and paracrine growth factors, the role of intrinsic non-ligand-dependent hypothalamic hormone receptor signaling for constitutive control is not known.

SRIF binds to the somatostatin receptor family (SST) comprising 5 subtypes, SST1, SST2, SST3, SST4, and SST5, each of which is encoded by a different gene, and each exhibiting differing ligand-specific binding affinities. These guanine nucleotide binding protein (Gi)-coupled receptors (GPCR) signal through multiple intracellular pathways (3, 4, 5, 6, 7). Using selective agonists, neutral antagonists and selective-receptor subtype-transfected cells, signal transduction pathways have been elucidated for these receptors. These include inhibition of adenylate cyclase activity and (i.e. cAMP) accumulation, regulation of calcium and potassium channel transport, sodium/hydrogen exchange, phospholipase C and A2 activity, phosphinositol 3 kinase, nitric oxide synthases, tyrosine kinases, stimulation of tyrosine phosphatase activity, and MAPK activity. cAMP is decreased by SST2 and SST5, whereas MAPK activity is either increased or decreased by SST2 and decreased by SST5 signaling (4). The functional profile and cell surface distribution of SST subtype expression is cell type specific, as are downstream signaling pathways. For example, pituitary hormone-secreting cells express mostly SST2 and SST5 (8), human pancreatic islet cells express multiple SSTR subtypes, with ß-cells expressing predominantly SSTR1 and SSTR5, {alpha}-cells SSTR2, and {delta}-cells SSTR5 (6), whereas nonendocrine pancreatic cells express mostly SST4 and SST5 (9). Cellular responses are therefore determined by both the relative surface abundance of the respective receptor subtype, as well as downstream signaling pathway profiles.

The anterior pituitary gland is an important target tissue for hypothalamic SRIF, which determines secretory patterns of GH, TSH (10), and ACTH (11, 12). The five somatostatin receptor subtypes (SSTs) exhibit differential binding properties and responses to receptor subtype-specific ligands (3, 4, 5, 6). We have shown that in ACTH-secreting AtT-20 cells, SST2 primarily determines ligand-induced inhibition of cAMP accumulation and calcium fluxes, whereas SST5 enhances intracellular calcium fluxes and modulates SST2 action (13). We have now used these cells to further determine the selective function of respective SSTs.

Several GPCRs have been shown to exhibit varying degrees of ligand-independent constitutive activity including adrenoreceptors, muscarinic, histamine, dopamine, angiotensin, and oxytocin receptors (14, 15, 16). Moreover, some naturally occurring constitutively active mutant (CAM) receptors have been identified as causing human disease including the FSH CAM receptor causing ovarian hyperstimulation syndrome, LH CAM receptor causing male precocious puberty, and TSH CAM receptor causing nonautoimmune hyperthyroidism and thyroid adenoma (15). However, the SRIF receptor family has not heretofore been shown to exhibit ligand-independent endogenous properties, including constitutive receptor action.

To evaluate the selective signaling of SSTs we chose to specifically knock down endogenous levels of each respective receptor subtype expression in AtT-20 cells using small inhibitory RNA (siRNA), and assess subsequent changes in SST signaling pathways. We demonstrate here that partial silencing of respective receptor subtypes reveals constitutive receptor activity as exhibited by receptor-selective constitutive signaling differences on adenylate cyclase, MAPK activity, and ACTH secretion.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Selective Silencing of Endogenous SSTs in AtT-20 Cells
Using qualitative PCR we confirmed that the clones used in our experiments (AtT-20/D16-F2) express SST subtypes 2a, 2b, 3, and 5, but not SST1 or SST4 mRNA (Fig. 1AGo). Table 1Go summarizes earlier work (13, 17, 18) showing AtT-20 cell SST subtype profile as assessed by specific SST mRNA levels, selective ligand binding, and selective ligand-induced cAMP inhibition. The unavailability of mouse SST3 or SST5 antibodies and competent mouse SST2 antibodies precluded us from analyzing SST subtypes by Western blot. Mouse AtT-20 cells do not express endogenous SRIF as shown by qualitative PCR (Fig. 1BGo).


Figure 1
View larger version (19K):
[in this window]
[in a new window]

  		Fig. 1. AtT-20 Cell SST Profile

Panel A, RT-PCR of AtT-20 cell RNA demonstrates expression of three SST receptor subtypes, including the alternatively spliced SST2 (2a and 2b). SST1 and SST4 mRNA is not expressed. L, Ladder. Panel B, RT-PCR of RNA demonstrates absence of somatostatin in AtT-20 cells and presence in H727 cells. C, Control without added cDNA. Panel C, Increasing concentrations (up to 1 µM) of the selective SST3 antagonist BN82675 or the selective SST2 antagonist BIM23454 do not alter cAMP levels in AtT-20 cells, and are therefore neutral antagonists for the receptors. At higher concentrations (≥10 nM) the SST3 antagonist mildly reverses SRIF 28 (100 pM) inhibition of forskolin-induced cAMP. Cells were treated with incremental concentrations of BN82675 with or without SRIF28 (100 pM) in the presence of forskolin for 30 min. Forskolin-treated cells serve as control (first point on the graph).

 

View this table:
[in this window]
[in a new window]

  		Table 1. Somatostatin Receptor Subtype Expression Profile in AtT20 Cells

 
BN82675 and BIM53454 are neutral antagonists for SST3 and SST2, respectively, in AtT-20 cells and do not alter cAMP levels (Fig. 1CGo). However, concentrations of antagonist above 1 nM mildly overrode SRIF 28 (100 pM) inhibition of cAMP (Fig. 1BGo). BIM53454 (500 nM) was previously shown to inhibits SRIF28 suppression of cAMP (13). The results suggest that endogenous SST3 receptor subtype is expressed at low levels in AtT-20 cell membranes, and may be less involved in ligand activation than SST2.

Selective siRNA transfection of AtT-20 cells was performed using predesigned commercially available siRNAs. Using fluorescent confocal microscopy of transfected cells, abundant expression of tagged scrambled control siRNA (SCR-3' Alexa 488) and tagged mouse SST5 siRNA (msiSST5-1-3' Alexa 488) (Fig. 2AGo) was observed.


Figure 2
View larger version (44K):
[in this window]
[in a new window]

  		Fig. 2. AtT-20 Cell siRNA Transfections

A, Fluorescent confocal microscopy images of AtT-20 cells transfected with either control siRNA (SCR-3' Alexa 488; upper panel) or mouse SST5 siRNA (Mouse siSST5-1-3' Alexa 488; lower panel) tagged with a C-terminal fluorophore. Tubulin {alpha} is in red, nucleus is in blue and tagged siRNA is in green. B, Flow cytometry analysis shows approximately 95% transfection efficiency for both control and receptor siRNA with equal intensity per cell. Cells were transfected for 24 h, collected and fixed with 50% methanol. Number of cells expressing the tag and intensity of fluorescence were measured by flow cytometry. The experiment was repeated twice in duplicate.

 
Flow cytometry analysis showed equal (~95%) transfection efficiency for both siRNA molecules with similar intensities per cell (Fig. 2BGo). Equally high transfection efficiencies permitted us to assign similar baseline conditions for knockdown efficiencies of siRNA.

SST2, SST3, and SST5 mRNA levels were assessed by real-time PCR and showed partial silencing of selective SST receptor subtype expression (Fig. 3AGo). For further confirmation, both custom and commercial TaqMan gene assays detected similar suppression of receptor subtype mRNA levels. Both siSST2-2 and siSST2-3 (silencing both SST2a and SST2b sub-subtypes) suppressed SST2 mRNA levels by approximately 82%, siSST3-1 suppressed SST3 by approximately 70% and was more active than siSST3-3 (22%), and siSST5-1 and siSST5-2 suppressed SST5 by approximately 65–80%. There was no difference in mRNA or cAMP levels between SCR (Fig 3BGo) and SCR-AllStar siRNA-negative controls (not shown). Transfection of AtT-20 cells with siRNA directed against human somatostatin (sihSST-1) served as an additional negative control for these murine transfections, and these results did not differ from the scrambled siRNA-negative control. Optimal transfection effects on mRNA levels and cAMP accumulation were observed after 24 h. In parallel experiments (Fig. 3BGo) cAMP levels were shown to increase with suppressed SST mRNA levels in the absence of added ligand. For SST3 (P < 0.001) and SST5 (P < 0.001) silencing, intracellular cAMP levels were a mirror image of receptor gene expression inhibition, supporting the functional validity of siRNA action. Although siRNA suppressed SST2 mRNA most strongly, only modest increases (P < 0.01) in cAMP levels were observed in these transfectants. Control silencing by human siSST-1 did not alter cAMP levels.


Figure 3
View larger version (20K):
[in this window]
[in a new window]

  		Fig. 3. Selective Knockdown of SST Subtypes in AtT-20 Cells Differentially Regulates Intracellular cAMP Accumulation

A, Each receptor subtype was silenced with two siRNAs that hybridize to different mRNA sites. siSST2-2 and siSST2-3 were equally efficient, siSST3-1 was more efficient than siSST3-3, and siSST5-1 was as efficient as siSST5-2 in selective SST subtype reduction of mRNA. siRNA directed against human somatostatin mRNA (sihSST-1) did not differ from control. Mean inhibition of mRNA levels for receptor subtypes is significant for all siRNAs compared with scrambled siRNA: a, P < 0.001; b, P < 0.01. Cells were plated in six-well plates and receptor mRNA levels analyzed using both custom and commercially available TaqMan gene expression assays with real-time PCR. Bars depict the mean (±SEM) percent decrease from control scramble siRNA and include six separate experiments. B, Intracellular cAMP levels were increased in cells transfected with siSST3-1 > siSST5-1 > siSST2-2 or siSST2-3. siSST3-3 did not efficiently suppress mSST3 receptor mRNA and did not affect cAMP accumulation. Both siSST5-1 and siSST5-2 reduced mSST5 mRNA, but siSST5-1 was more effective in increasing cAMP levels than siSST5-2. Cells were plated in 48-well plates and cAMP levels analyzed by RIA. Bars depict the mean concentration of intracellular cAMP in pmol/liter (±SEM) of six separate experiments. cAMP levels in cells transfected with sihSST-1 did not differ from SCR siRNA transfected cells. a, P < 0.001; b, P < 0.01; c, P < 0.05. C, Interferon pathway in AtT-20 cells transfected with 12.5 nM siRNA was assessed by OAS1 mRNA levels using real-time PCR. No change from SCR siRNA was observed for all receptor-selective siRNAs. The experiment was repeated twice.

 
To test for nonspecific siRNA stimulation of the interferon pathway (19, 20), oligoadenylate synthase-1 (OAS1) mRNA levels were assessed by real-time PCR and shown to be unchanged (Fig. 3CGo). Cell numbers were not altered between the different receptor-subtype knockdown experiments.

To confirm the specificity of receptor silencing effects on cAMP levels, we sought to reverse this action by rescue experiments. Reexpression of hemagglutinin (HA)-hSST2 or SST3 or SST5 in SST2- or SST3- or SST5-knockdown cells, respectively (Fig. 4AGo), reversed the knockdown-action on intracellular cAMP levels, thereby rescuing AtT-20 cells from receptor knockdown effects. HA-hSST2 and HA-hSST5 were verified previously (13) and HA-hSST3 was verified by sequencing, membranal trafficking and internalization with SRIF 28 treatment (Fig. 4BGo). HA-hSST2 (90% homology to mouse SST2) overexpression modestly reduced forskolin induction of cAMP. Surprisingly, overexpression of both HA-hSST3 (85% homology to mouse SST3) and HA-hSST5 (81% homology to mouse SST5) increased cAMP levels to the same extent as receptor knockdown. Mean (±SEM) cAMP levels in control wells (SCR siRNA, pcDNA3.1, or both) were 123 ± 33, 157 ± 16, and 167 ± 51 pmol/liter, respectively.


Figure 4
View larger version (29K):
[in this window]
[in a new window]

  		Fig. 4. Expression of hSST Receptor Subtypes in Respective SST-Knockdowns Rescues cAMP Increase

A, Coexpression of HA-hSSTs and siRNA blocks cAMP increase by selective receptor knockdown. Bars depict percent change in cAMP levels compared with respective controls (siRNA group is corrected to SCR siRNA cAMP levels; HA-hSSTs group to pcDNA3.1 vector; and the combination group to both SCR siRNA and pcDNA3.1 cotransfection). Each experiment was repeated three times. a, P < 0.001. B, HA-hSST3 is expressed in AtT-20 cell membrane and internalizes upon treatment with SRIF28 (100 nM). Sections overlay in the upper panels and cross sections in lower panel. Cells were transfected on coverslips and imaged by fluorescent confocal microscopy.

 
Selective SST Receptor Subtype Silencing Differentially Increases Intracellular cAMP Accumulation and ACTH Secretion
cAMP accumulation and ACTH secretion are both similarly suppressed by somatostatin agonist treatment of these cells (13). Figure 5AGo shows that selective knockdown of SST subtypes differentially regulated adenylate cyclase responses. Baseline intracellular cAMP levels increased up to 30% for SST2, 100% for SST3 (P < 0.001), and 60% when SST5 (P < 0.01) was knocked down in different experiments 30 min after added forskolin (10 µM), as compared with SCR siRNA transfected cells. The rank order of magnitude for siRNA action on cAMP levels after 24 h of siRNA exposure in the absence of serum components was: siSST3-1 > siSST5-1 > siSST2-1. In other experiments not included in this figure (see figures below) up to 200% increases in cAMP were observed, likely reflective of varying knockdown efficiencies in these transient transfections. Concordant increases in ACTH levels [60% (P < 0.001), 40% (P < 0.01), and 20%, respectively] were observed in response to 1 h treatment with forskolin (Fig. 5BGo). These results suggest that AtT-20 cells expressing less abundant SST receptor subtypes (for example, SST3) would likely have a more active adenylate cyclase pathway and secrete higher baseline ACTH levels.


Figure 5
View larger version (14K):
[in this window]
[in a new window]

  		Fig. 5. Forskolin-Induced cAMP Accumulation and ACTH Secretion Are Equally Affected by Selective Receptor-Knockdown in the Absence of Added Ligands

A, Intracellular cAMP levels increase after 30 min of 10 µM forskolin treatment after 24 h siRNA transfection and in the absence of serum by the following rank orders of magnitude: siSST3-1 > siSST5-1 > siSST2-2. Results represent percent change from SCR siRNA transfected control cells. Cells were plated in 48-well plates; the experiment was repeated three times. Results are presented as mean (±SEM). a, P < 0.001; b, P < 0.01. B, After 24 h of siRNA transfection and in the absence of serum, ACTH secretion is increased after 1 h of 10 µM forskolin treatment in the following rank order of magnitude: siSST3-1 > siSST5-1 > siSST2-1. Results represent percent change from SCR. Cells were plated in 48-well plates, and the experiment was performed three times. Results depicted as mean (±SEM). a, P < 0.001; b, P < 0.01.

 
To further assess signaling pathways of constitutive receptor action on adenylate cyclase, transfected cells were pretreated for 7 h with 100 ng/ml pertussis toxin (PTX), a G{alpha}i/o protein inhibitor, followed by 30 min treatment with forskolin and assayed for cAMP levels. In the SCR group, PTX increased cAMP levels 2-fold (P < 0.001) (Fig. 6AGo), approximately the same extent as siRNA selective receptor knockdown. When corrected for SCR siRNA cAMP levels (Fig. 6BGo), SST knockdown-related cAMP increases were blocked by PTX treatment (P < 0.001), however, only partially by both SST3 or SST5 knockdown and maintaining significant differences between SCR and both receptor knockdowns (P < 0.001). These results suggest different mechanisms of constitutive action for SST2, SST3, and SST5, implying that the latter two subtypes constitutively suppress adenylate cyclase through G{alpha}i/o and other related proteins not inhibited by PTX.


Figure 6
View larger version (13K):
[in this window]
[in a new window]

  		Fig. 6. Inhibition of Gi/o{alpha} Protein by PTX Differentially Reverses Receptor Knockdown-Related cAMP Increase

cAMP levels were measured in siRNA-transfected cells treated with 100 ng/ml PTX for 7 h before 10 µM forskolin for 30 min, and compared with untreated cells. A, In SCR siRNA transfected cells cAMP levels doubled (P < 0.001). B, Receptor knockdown groups (SCR, siSST2-2, siSST3-1, siSST5-1) were normalized to their relevant SCR controls [either without PTX treatment (–PTX) or with PTX treatment (+PTX)]. Knockdown of all receptors increased cAMP levels (a1,P < 0.001); PTX inhibited this increase in all groups (a2,P < 0.001); however, a significant difference from control was maintained for SST3 and SST5 (a3, P < 0.001). The experiment was repeated twice.

 
An SST2-selective agonist, SST5-selective agonist, and octreotide (SST2 > SST5-selective agonist) dose dependently inhibited intracellular cAMP accumulation (Fig. 7Go). Knockdown of SST3>SST5>SST2 resulted in adenylate cyclase increase. Reduced ligand potency was observed only for the SST3-knockdown effect on SST2-selective agonist activity (18-fold decrease in potency), implying a cross talk between these two receptors, and an SST5-knockdown effect on the SST5-selective agonist (23-fold decreased potency) further verifying the specificity of siSST5 to SST5 action (Table 2Go). Other selective SST subtype knockdown did not affect receptor subtype-selective agonist potencies for cAMP inhibition, and for all ligands, maximum cAMP inhibition did not differ.


Figure 7
View larger version (17K):
[in this window]
[in a new window]

  		Fig. 7. Selective SST Receptor Subtype Knockdown Effects on cAMP Inhibition by Selective SRIF Agonists

For each of the nine graph sets presented, the x-axis depicts intracellular cAMP levels (pmol/liter); y-axis, agonist concentration [-(log M)]. In each graph set, control SCR dose-response curve (dashed line) vs. selective receptor-knockdown transfectant (siSST2-2 or siSST3-1 or siSST5-1) dose-response curve (full line) are shown for the following ligands (from left to right): SST2-selective agonist (BIM 23120), SST5-selective agonist (BIM 23206), and the SST2>SST5 agonist (octreotide). Each experiment was repeated three or more times and analyzed by normalization and calculation of fitted midpoints (log IC50) of the two curves.

 

View this table:
[in this window]
[in a new window]

  		Table 2. Summary of Potencies (IC50) of Somatostatin Receptor-Selective Agonist after Selective Receptor Subtype Knockdown in AtT-20 Cells

 
The results depicted in Fig. 8Go further emphasize the ligand independency of SST3 signaling. To examine whether a higher affinity SST3 ligand impacts the SST3 contribution to cAMP inhibition we chose to treat SST3-knockdown cells with BIM 23A779. This ligand is a pan-SST subtype agonist that exhibits the highest affinity to SST3 (570 pM) compared with other ligands in our possession. It also binds with high affinity to SST2 (320 pM), SST5 (560 pM), and with lower affinity to SST1 (2.5 nM) and SST4 (20.5 nM). SST3 knockdown enhanced intracellular cAMP levels. Despite high affinity to SST3, selective SST3-silencing did not alter ligand potency (SCR; 460 pM and siSST3-1; 450 pM), further supporting very weak activation of SST3 by its ligands.


Figure 8
View larger version (15K):
[in this window]
[in a new window]

  		Fig. 8. SST3 Knockdown Does Not Reduce BIM 23A779 Potency to Inhibit cAMP Accumulation

Top, Absolute levels of cAMP SCR siRNA transfected (dashed line) vs. cAMP siSST3-1 transfected (full line) AtT-20 cells, treated with increasing concentrations of BIM 23A779 (first point is forskolin alone). Bottom, Curves from part A were normalized and calculated for fitted midpoints (log IC50) of the two curves. No change in IC50 was observed (18 pM vs. 22 pM, respectively). Each experiment was repeated twice.

 
To investigate whether the observed cAMP increase was specific for AtT-20 cells, we tested selective SST receptor silencing in mouse TtT-GF folliculo-stellate cells derived from a pituitary thyrotropic pituitary tumor. These cells express SST2a, SST2b and SST3 (Fig. 9AGo), and probably very low levels of SST5 because only a very faint SST5 band could be visualized and the amplicon detected only at 34 cycles (100 ng cDNA) by real-time PCR (data not shown) These cells do not express somatostatin (Fig. 9AGo). Relative to AtT-20 cells, TtT-GF cells expressed 3000-fold less SST2, 9000-fold less SST3, and 25,000-fold less SST5 mRNA levels as calculated by real-time PCR. siRNA selective for SST2 and SST3 inhibited respective receptor mRNA –75 ± 3% (P < 0.001) and –33 ± 4% (P < 0.05) vs. SCR. (Fig. 9BGo). Intracellular cAMP levels increased inversely to mRNA suppression by 48 ± 3% (P < 0.001), 20 ± 2.5% (P < 0.001) and 9 ± 2% (P < 0.05), respectively (Fig. 9CGo). Although modest induction of cAMP was observed by silencing SST5, the receptor itself was only barely detectable by real-time PCR. These results support a constitutive action for these receptors in another pituitary cell type.


Figure 9
View larger version (17K):
[in this window]
[in a new window]

  		Fig. 9. SST Activity in TtT-GF Folliculo-Stellate Cells

A, RT-PCR of SST products in TtT-GF cells. Upper panel: Ladder (L), SST2a, SST2b, SST3, SST5 receptor subtypes, and SRIF. B, Effect of specific siRNA attenuation on SST mRNA levels. mRNA levels decrease for SST receptor subtypes: SST2 (P < 0.001) > SST3 (P < 0.05). C, Forskolin-induced intracellular cAMP accumulation in TtT-GF cells after SST receptor silencing. Increase of cAMP is inversely related to mRNA suppression: SST2 (P < 0.001) > SST3 (P < 0.001). Cells were cultured in DMEM supplemented with 10% fetal bovine serum, 2 mM glutamine, 1% penicillin/streptomycin. For RNA extraction 100,000 cells were plated in 6-cm dish and for cAMP measurements, 10,000 cells were plated per well in a 48-well plate the day before transfection. Each experiment was repeated twice, in triplicate.

 
Selective SST Receptor Subtype Silencing Regulates MAPK Signaling
To determine additional downstream effects of SST receptor-subtype knockdown, we analyzed MAPK signaling in the transfectants. SST receptor-subtype knockdown differentially altered baseline levels of phosphorylated MEK1/2 and ERK1/2 as measured by Western blot utilizing phospho-MEK1/2 (Ser217/221) or phospho-p44/42 MAPK (Thr202/Tyr204) antibodies. Fourteen hours after transfection, cells were serum deprived for a further 7 h and cytoplasmic and nuclear proteins separated and analyzed. Receptor knockdown of SST5 > SST2 = SST3-induced MAPK in the absence of added ligand (Fig. 10AGo). A summary of six different Western blot intensity analyses are depicted in Fig. 10BGo. The range of ERK1/2 phosphorylation differed between the different blots, hence the large variances. However, as compared with SCR, moderately increased ERK1/2 phosphorylation was observed for SST2- and SST3-knockdown transfectants (22 ± 11 and 24 ± 9, respectively) and a larger increase (58 ± 14; P < 0.01) observed with SST5 knockdown. Total ERK1/2 levels were unaltered (data not shown).


Figure 10
View larger version (32K):
[in this window]
[in a new window]

  		Fig. 10. Selective Knockdown of SST Subtypes in AtT-20 Cells Differentially Regulates MAPK Signaling

Knockdown of SST5 induces MEK1/2 and ERK1/2 phosphorylation (p) more than SST2 or SST3 knockdown. A, Western blot of selective receptor knockdown cells as compared with SCR transfectants, analyzed for MEK1/2 and ERK1/2 phosphorylation and ß-actin. B, Quantitative analysis of six different experiments under the same conditions. Both phospho-ERK1 and 2 intensities were corrected to ß-actin, and ratios corrected to SCR pERK1/2 to calculate relative change. Cells were plated in six-well plates, transfected for 24 h and serum deprived for 7 h. a, P < 0.01.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
The results show that selective silencing of SST receptor subtypes cause specific intracellular signaling changes including increased cAMP and ACTH levels and ERK1/2 phosphorylation, suggesting that the endogenous receptors signal constitutively to restrain adenylate cyclase activity, ACTH secretion, and MAPK signaling. It is unclear whether this action is due to non-ligand-dependent receptor dimerization (21) or receptor interaction with downstream proteins. We document effects of selective SST2, SST3, and SST5 endogenous receptor knockdown using siRNA in vitro in AtT-20 cells that express only these three receptor subtypes and are highly responsive to SRIF. Similar results were observed with another pituitary cell line, TtT-GF, which exhibits the same receptor profile albeit at lower expression levels. Other GPCRs exhibit different levels of constitutive action as assessed by receptor mutational analysis, use of inverse agonists or autoantibodies, and naturally occurring CAM that cause human disease (15). Even though complete silencing of these receptors with 24 h of siRNA transient transfection was not achieved, submaximal selective receptor silencing revealed novel SST functions, as well as confirmed established actions.

The siRNA system used was validated by several criteria. siRNAs suppressed selective SST receptor-subtype mRNA as compared with two different negative scrambled controls and an unexpressed mRNA control in AtT-20 cells. For SST2, SST3 and SST5, a concordance between the degree of mRNA inhibition by two different receptor-selective siRNAs and cAMP level increase was shown. SST5 knockdown reduced the potency of an SST5-selective agonist, whereas SST3 knockdown reduced potency of an SST2-selective agonist. SST2 and SST3 have been shown to functionally interact (22). Finally, expression of human SST2, SST3, or SST5 in SST2, SST3, or SST5 knockdown AtT-20 cells, respectively, prevented higher levels of cAMP induced by receptor silencing.

Several factors need to be considered when interpreting these results. Importantly, we could not assess SST receptor protein levels. Even though experiments were performed with approximately 95% transfection efficiency for all siRNAs, silencing efficiency of the receptor protein 24 h after transfection is unknown. The receptor mRNA knockdown effect peaked at about 24 h after transfection after which it gradually declined, likely because of either rapid replication of AtT-20 cells that diluted the knockdown effect or due to up-regulation of SST receptor subtype protein. Twenty-four hours of silencing would be less likely to be associated with longer term cell adjustment mechanisms such as other receptor up-regulation, than would stable receptor silencing conditions in these cells which also typically change their characteristics after several subcultures. Intensity of signaling pathway responses observed in transiently transfected cells vary, depending on cell number, confluence, age after recovery, and serum deprivation, limiting quantification of exact fold-changes of an effect.

The ligand-dependent SST2, SST3, and SST5 regulation of these pathways is well established. SST receptor subtypes inhibit adenylate cyclase upon ligand binding and receptor activation and inhibit ACTH secretion (4, 6, 13). We show here that without added ligand, activated SST3 > SST5 > SST2 constitutively restrain cAMP accumulation and ACTH secretion under nonselective adenylate cyclase stimulation, participating in an endogenous cellular homeostasis. These observations imply that ACTH secreting cells chronically secrete more of the hormone in the absence constitutively active SST3.

Because forskolin stimulates most adenylate cyclase subtypes (23), we do not currently know what isoforms are controlled by SST receptor subtype constitutive action and what is their importance in the signaling pathway other than hormonal secretion in these cells. Moreover, chronic increase of intracellular cAMP can have multiple downstream effects including up-regulation of SST2 and SST5 gene expression (6), cell-specific growth and differentiation (24).

Ligand activation of SST2 either stimulates or inhibits ERK phosphorylation, whereas ligand activation of SST3 and SST5 inhibit ERK phosphorylation (4). We demonstrate that SST5 > SST2 = SST3 constitutively restrain ERK1/2 phosphorylation under basal conditions. Because ERK1/2 phosphorylation reflects different biological activities in different cells at different times, and MAPK activity regulates multiple cell functions including growth, division, differentiation, and apoptosis (25) we cannot currently predict other downstream implications of sustained phospho-ERK1/2 inhibition in AtT-20 cells by SST signaling.

Selective SST silencing did not have a major effect on ligand potency to inhibit cAMP accumulation except for SST5 and SST3 knockdown inhibition of selective SST5 and selective SST2 agonists potencies, respectively, even though increased baseline levels of cAMP were observed. This may relate to the mass of available membranal receptors required to execute ligand-dependent signaling pathways. Because we could not knock out all receptors, there are probably sufficient residual receptors to signal upon ligand receptor activation, especially for SST2. Another possibility is that ligand activation of receptor pathway signaling differs from the constitutively activated pathway, thereby overcoming the partial silencing effect. This would imply that receptor constitutive action and ligand activation are additive.

When treated with PTX, G{alpha}i/o proteins are nonselectively deactivated, affecting all SSTs. Moreover, some degree of receptor expression is present in the cells because we could not achieve complete mRNA silencing with siRNA. These limitations impose challenges when interpreting the results. Nevertheless, the PTX experiments demonstrate differences between pathways through which selective receptor subtypes constitutively regulate cAMP and suggest that SSTs operate through proteins other than G{alpha}i/o. GPCRs interact with more than one type of G protein (26), as for human ß2 adrenergic (27) and human TSH receptor (28) that interact with both Gi and Gs proteins. Whereas Gi proteins generally inhibit adenylate cyclase, Gs proteins are stimulatory (29). In addition, the Gß{gamma} unit liberated from the G{alpha}i/o unit stimulates or inhibits adenylate cyclase, ion channels, phosphatidylinositol 3 kinase, or phospholipase C (29, 30). GPCRs also signal through pathways not connected to G proteins (31, 32). Several lines of evidence suggest that SST3 and SST5 constitutively regulate not only G{alpha}i/o but also other G protein units (G{alpha} or Gß{gamma}) or other proteins in AtT-20 cells. We showed that low-dose SST5-selective ligand induced increased intracellular calcium oscillations rather than inhibition as shown with an SST2-selective agonist (13). We now show that both SST3 and SST5 knockdown increase cAMP levels, an effect that is significantly but not completely, reversed by PTX-related G{alpha}i/o inhibition. These results are less prominent than those observed for SST2-knockdown-related increase in cAMP that was completely abolished by PTX treatment. We also show here that human SST3 and human SST5 but not hSST2 overexpression increase cAMP levels. Even though these are human receptors expressed in mouse cells, similarities in function of the respective mouse and human receptor would be expected because mouse and human SST receptor subtype are highly homologous: SST2, 90%; SST3, 85%; and SST5, 81% homology (www.ncbi.nlm.nih.gov). Because we could not control the amount of expressed receptor required to replenish cells that underwent SST3 or SST5 knockdown, overexpression could create new conformational changes affecting receptor signaling, either exacerbating existing mechanisms or creating novel ones.

The function of SST3 in controlling ACTH remains enigmatic. Previous studies (17, 18) showed that even though the nonpeptide SST3 agonist L-796,778 exhibits high affinity to hSST3-transfected cells, binding, potency and efficacy in AtT-20 cells are weak, even at concentrations of at least 1 µM. SST3 therefore is likely expressed at low abundance in AtT-20 cell membranes. Our results support these observations, showing that an SST3-selective antagonist (binding affinity to SST3 is 600 pM) reduces SRIF potency at higher concentrations (>10 nM), as compared with the action of an SST2 antagonist (binding affinity to SST2 is 31 nM), which reduces SRIF potency more significantly at the same concentrations. In addition, knockdown of SST3 does not affect BIM23A779 inhibition of cAMP. However, SST3 mRNA is readily expressed in AtT-20 cells, transfection of tagged hSST3 exhibits membranal distribution with receptor internalization, and the nonpeptide SST3 antagonist exhibits approximately 1 nM affinity to both mouse and human SST3 in transfected Chinese hamster ovary cells. A possible explanation for these findings is that endogenous SST3 expression in AtT-20 cells is mostly intracytoplasmic and to a lesser extent membranal. An example for such GPCR function is the GnRH receptor that is mostly retained in the cytoplasm and does not consistently route to the plasma membrane (33). Furthermore, human SST3 exhibits submembranal distribution in pheochromocytoma tissue (34). These lines of evidence support the hypothesis that SST3 function in AtT-20 cells is dedicated to constitutive action rather than for agonist binding, unlike the SST2 receptor, which is the major ligand responder. This interpretation of our results also explains why the endogenous ligands SRIF14 and SRIF28 exhibits lower affinity for SST3 than for SST2 or SST5.

The effect of selective SST receptor silencing on intracellular cAMP levels in folliculo-stellate TtT-GF pituitary cells indicates that the observed constitutive activity is not limited to AtT-20 cells but is also manifest in another cell type expressing these receptors. These are nonsecretory cells of pituitary origin and exhibit higher baseline cAMP levels upon attenuation of SST receptor expression. Importantly, we chose these cells because they do not express endogenous SRIF which could confound the observed ligand-independent SST activity.

Why is ligand-independent SST constitutive action important? Basal pituitary hormone secretion could be under tonic control of constitutively active SRIF receptors in addition to endocrine actions of hypothalamic SRIF on its receptor subtype cell-specific expression. Hormonal regulation of selective SST expression in different tissues affects SRIF-related cellular functions without SRIF presence as observed for GHRH and GH (35), glucocorticoids, and estrogen (6) regulation of SST2 and SST5. Receptor mutations or SST single nucleotide polymorphisms (SNPs) could underlie modulation of constitutive action (16) that potentially impacts ACTH secretion, corticotroph growth and differentiation. Even silent SNP mutations could alter receptor folding and function (36) and therefore receptor constitutive action. Human SST3 contains several coding region SNPs (37), and human SSTR5 genotype polymorphisms were found to correlate with bipolar affective disorders (38). A human SST5 variant correlated with basal IGF-I levels in patients with acromegaly (39). Finally, development of an SST receptor subtype inverse agonist would facilitate detection or treatment of human disease accompanied by somatostatin-like hyperactivity.

In conclusion, we provide evidence supporting constitutive action of SST receptor subtypes in ACTH secreting mouse pituitary corticotroph cells, suggesting that SST2, SST3, and SST5 have differential restraining actions on adenylate cyclase action, MAPK activation, and ACTH secretion.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Materials
Peptide compounds were obtained from Biomeasure Inc. (Milford, MA). BIM 23120 is a selective SST2 agonist, BIM 23206 a SST5 selective agonist (13), BIM 23A779 is a multireceptor subtype peptide with high affinities to SST2, 3, 5, and 4 (40). BIM 23454 is a selective SST2 antagonist (13), and BN 82675 is a nonpeptide SST3-selective antagonist (Biomeasure Inc., Milford, MA). Stock solutions (1 mM) of compounds were prepared in 0.01 M acetic acid and 0.1% BSA. Octreotide, SRIF 14 and SRIF 28 (Phoenix Pharmaceuticals Inc., Belmont, CA) were diluted in sterile H2O as 1 mM or 100 µM stocks. All ligand solutions were stored at –20 C until used within 6 months, and thawed once. PTX was purchased from Sigma-Aldrich (St. Louis, MO).

Cells
AtT-20/D16-F2 mouse ACTH-secreting pituitary cells (CRL-1795; American Type Culture Collection, Manassas, VA; 2003) were grown in low glucose DMEM (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (Omega Scientifics, Tarzana, CA), 2 mM glutamine and a mix of 1% penicillin G sodium (100 U/ml) with streptomycin sulfate (100 µg/ml) (Invitrogen), in 6% CO2, in a 37 C humidified incubator. Only 2 to 10 week post-thawed cells were used. Cells were plated one day before transfection or treatment. If serum deprivation was required, cells were suspended in low-glucose DMEM with 0.3% BSA and antibiotics before collection for 6–7 h. All drug treatments were carried out in serum-deprived medium. For the different experiments, cells were plated as follows: 2 x 103 cells/well in 48-well plates, 2.0 x 105 cells/well in 12-well plates, 3.5 x 105 cells/well in six-well plates, and 106 cells/well in a 10-cm dish. Cells were counted using Beckman Z1D Coulter (Beckman Coulter, Fullerton, CA). H727 are human lung bronchus carcinoid cell line (American Type Culture Collection; 2004) grown in RPMI 1640 (Invitrogen) with 10% FBS and 1% penicillin/streptomycin at similar conditions to AtT-20 cells.

TtT-GF folliculo-stellate cells (41) originating from a pituitary thyrotropic pituitary tumor were a kind gift from Prof. Günter K. Stalla (Max Planck Institute of Psychiatry, Munich, Germany). Cells were cultured in DMEM supplemented with 10% fetal bovine serum, 2 mM glutamine, 1% penicillin/streptomycin. For RNA extraction 100,000 cells were plated in 6-cm dish and for cAMP measurements, 10,000 cells were plated per well in a 48-well plate the day before transfection. siRNA transient transfections were performed as for AtT-20 cells.

Transient Transfections
siRNA was purchased from QIAGEN (Valencia, CA). Several predesigned HiPerformance siRNAs were chosen randomly for each receptor subtype and for negative controls (www1.qiagen.com/GeneGlobe/Default.aspx). Scrambled siRNA and Mm_Sstr5_1 HP were also modified on their C terminus with Alexa 488 fluorophore (Table 3AGo). Receptor subtype selective siRNA action was compared with two nonsilencing negative control siRNAs (QIAGEN), and human somatostatin (hSST-1) that is not detectable in murine AtT-20 cells. Cells were transiently transfected with siRNA using HiPerFect transfection Reagent (QIAGEN). Maximal mRNA silencing in AtT-20 cells was achieved at 24 h after transfection with 12.5 nM siRNA concentration for all transfectants. For fluorescent confocal microscopic analysis of fluorophore-tagged siRNA, cells were plated on 18-mm coverslips coated with 10 µg/ml poly D-Lysine (Sigma-Aldrich) a day before transfection. Cells were treated as depicted 24 h after siRNA transfection.


View this table:
[in this window]
[in a new window]

  		Table 3A. siRNA Description (QIAGEN)

 
Human SST2, SST3, and SST5 were tagged with three molecules of 3x HA on their N terminus and cloned into pcDNA3.1 vector were purchased from UMR (www.cdna.org). After sequence validation, plasmids were transfected and membranal trafficking verified by plating cells on 18-mm coverslips coated with 10 µg/ml poly D-lysine 1 d before transfection with 400 ng/ml of the relevant receptor- containing plasmid. Twenty-four hours later, cells were fixed and immunostained with anti-HA antibody as described (13). HA-hSST2 and HA-hSST5 have previously been validated (13), and HA-hSST3 was now validated for the correct sequence, traffic to the membrane and internalization upon 100 nM SRIF 28 treatment visualized by confocal microscopy. For rescue experiments, cells were transfected with either siRNA or HA-hSSTs or both respectively (SCR with pcDNA3.1; siSST2-2 with HA-hSST2, siSST3-1 with HA-hSST3, and siSST5-1 and HA-hSST5) in the following manner: siRNA was first transfected; 6 h later all wells were washed of the transfection agent and relevant wells transfected with plasmids. siRNA transfection duration was 28 h, and plasmid transfection was for 22 h, after which cells were stimulated with 10 µM forskolin for 30 min and assessed for intracellular cAMP levels.

Qualitative and Quantitative PCR
Cells were plated in six-well plates and transfected with relevant siRNA for 24 h. RNA was collected with RNeasy Mini Kit (QIAGEN) and treated with deoxyribonuclease (QIAGEN) to eliminate genomic DNA. One microgram of purified total RNA was reverse-transcribed into first-strand cDNA using oligo (deoxythymidine) primers, with (+RT) or without (–RT) SuperScript II reverse transcriptase to check for DNA contaminants (Invitrogen). Primers for qualitative PCR (Invitrogen) were designed (Table 3BGo) and 35-cycle PCRs carried out at 57 C annealing temperature. Somatostatin primers were designed to hybridize both human and mouse somatostatin (forward primer GAACTGGCCAAGTACTTCTTG, reverse primer CATAATCTCACCATAATTTTAT; product length is 361 bp). ß-Actin primers-mix (Ambion, Austin, TX) product length is 295 bp. Thirty-eight-cycle PCR was carried out with annealing temperature of 56 C. Highly sensitive and specific TaqMan Gene expression assays for receptor subtype primers were purchased from Applied Biosystems (Foster City, CA). In addition to the commercially available Mm00436684_m1 for mouse SST2 and Mm00436695_s1 for mouse SST3 and Mm01307775_s1 for mouse SST5 sequences we used custom made TaqMan primers for mouse SST3 (forward primer TGCCTGTGGTTGTGTTCTCA; reverse primer GCTCTGGCCACTGCATGT; probe ACGTGCTCATGCCCC), for mouse SST5 (forward primer GCTGCCGTCTGGGTCTTC; reverse primer GACATCCGCAAAGACCAAGAG; probe TCGCTGCTCATGTCTCT), and for mouse mOAS1 (forward primer AGTGAAGTTTGAGGTCCACAGTTT; reverse primer GGGCGCTCAGCTTGAAG, probe: CCAAC-TCCCGGGCTCT). Amplicons were detected using the relevant probes tagged with MGB quencher and FAM (carboxyfluorescein) dye. TaqMan rodent glyceraldehyde-3-phosphate dehydrogenase endogenous control expression assay with probe tagged with MGB and VIC (Applied Biosystems) was used as active reference. After confirming the absence of genomic DNA contamination, real-time PCR was carried out in a MicroAmp Optical 96-well plate in ABI Prism 7700 Sequence Detector (Applied Biosystems). Twenty-microliter reactions included 15-µl TaqMan Universal PCR Master Mix (Applied Biosystems) optimized for 5' nuclease assay and 5 µl cDNA. Standard curves (dilutions ranged from 0.01 to 100 ng cDNA) for the specific receptor subtype TaqMan Gene expression assay and for the calibrator alongside the relevant samples examined were set for each experiment so that curves and samples were analyzed simultaneously in one plate. Both commercial and custom primers exhibited approximately 100% efficiency, and the data reported was analyzed from experiments exhibiting standard curve slopes of –3.32 ± 0.03. Thermal cycling conditions for real-time PCR were 50 C for 2 min, 95 C for 10 min, and 40 cycles of melting (95 C, 15 sec) and annealing/extension (60 C, 60 sec). Signals obtained from each sample were normalized to parallel values obtained for the calibrator. A comparative threshold cycle method was used for relative quantification of gene expression (fold change) between test (selective receptor siRNA) and control (scramble siRNA) samples.


View this table:
[in this window]
[in a new window]

  		Table 3B. Primers for PCR (Invitrogen)

 
RIAs
For cAMP measurements, cells were treated with forskolin (10 µM) (Sigma-Aldrich) with or without the ligand of interest for 30 min in low glucose DMEM supplemented with 0.3% BSA and 1% antibiotics. cAMP was extracted (42) and measured by RIA (measurable range 2.5–1000 fmol) using cAMP, 2'-O-succiny [125I] iodotyrosine methyl ester (PerkinElmer Life Sciences, Foster City, CA) and rabbit anti-cAMP antibody (Fitzgerald, Concord, MA). Secreted ACTH concentrations in culture medium were measured by RIA with a measurable range of 10–1000 pg/ml (ICN Pharmaceuticals, Inc., Costa Mesa, CA).

Western Blot Analysis
About a million AtT-20 cells were plated in 10-cm dishes, transfected for 24 h, and serum starved before treatment for 7 h. Cells were collected by trypsinization and kept at –80 C. Cytoplasmic and nuclear separation was achieved with a NE-PER kit (Pierce Biotechnology, Rockford, IL). Lysis buffer contained a Protease Inhibitors Cocktail (Pierce Biotechnology). Western blot analysis was performed using NuPage Bis-Tris Electrophoresis System (Invitrogen). Cellular proteins were separated on pre-made 4–12% Bis-Tris gels (Invitrogen) under reducing conditions, transferred to a polyvinylidene difluoride membrane, and immunoblotted with mouse monoclonal anti-ß-actin (Sigma-Aldrich) or antimouse phospho-p44/42 MAPK (Thr202/Tyr204) or phospho-MEK1/2 (Ser217/221) (Cell Signaling, Danvers, MA) first antibodies. Protein bands were detected using horseradish peroxidase-linked whole antibody followed by ECL enhanced chemiluminescence Western Blotting Detection reagent (Amersham, GE Healthcare, Buckinghamshire, UK). A BenchMark Protein ladder was loaded on each membrane (Invitrogen), blots scanned using Epson V750 PRO and transferred to Adobe Photoshop Elements 3.0. Intensity analysis was performed with ImageJ Software [Rasband, W.S.; ImageJ, National Institutes of Health (Bethesda, MD); http://rsb.info.nih.gov/ij/, 1997–2006].

Confocal Fluorescent Microscope Analysis
Images were acquired with a Leica (Mannheim, Germany) TCS SP confocal microscope. Alexa (Eugene, OR) fluorophores 488 and 568 were detected using Ar laser 488 and ArKr laser 568, respectively. Cells were imaged with a narrow spectral detection window to exclude auto-fluorescence, and the pinhole was set to 1.0 Airy unit for best resolution. The depicted images represent maximum intensity projections of confocal stacks.

Statistical Analysis
Dose response curves and statistical analysis were generated with GraphPad (San Diego, CA) Prism 4.0. Analysis was performed using mean ± SEM, with one- or two-way ANOVA with Bonferroni posttest. For statistical comparison of dose response curves, data were normalized and Prism 4.0 instructed to compare fitted midpoints (log IC50) of the two curves (http://www.graphpad.com/Support/support.cfm).


   ACKNOWLEDGMENTS
 
We thank Dr. Song-Guang Ren in our laboratory for excellent technical support.


   FOOTNOTES
 
Disclosure Statement: Supported by a research grant from Biomeasure Inc. (Ipsen Group) to S.M. and A.B. O.P., N.J.P., K.A.W., V.C., and N.L. have nothing to declare. J.T. and M.C. are employees of Ipsen Group.

First Published Online July 3, 2007

Abbreviations: CAM, Constitutively active mutant; Gi, guanine nucleotide; hSST, human somatostatin; GPCR, G protein-coupled receptors; HA, hemagglutinin; OAS1, oligoadenylate synthase-1; PTX, pertussis toxin; SCR, scrambled control siRNA; SRIF, somatostatin; SNP, single nucleotide polymorphism; SSTs, somatostatin receptor subtypes.

Received for publication February 13, 2007. Accepted for publication June 28, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Melmed S 2003 Mechanisms for pituitary tumorigenesis: the plastic pituitary. J Clin Invest 112:1603–1618[CrossRef][Medline]
  2. Smith RG 2005 Development of growth hormone secretagogues. Endocr Rev 26:346–360[Abstract/Free Full Text]
  3. Low MJ 2004 Clinical endocrinology and metabolism. The somatostatin neuroendocrine system: physiology and clinical relevance in gastrointestinal and pancreatic disorders. Best Pract Res Clin Endocrinol Metab 18:607–622[CrossRef][Medline]
  4. Lahlou H, Guillermet J, Hortala M, Vernejoul F, Pyronnet S, Bousquet C, Susini C 2004 Molecular signaling of somatostatin receptors. Ann NY Acad Sci 1014:121–131[Abstract/Free Full Text]
  5. Weckbecker G, Lewis I, Albert R, Schmid HA, Hoyer D, Bruns C 2003 Opportunities in somatostatin research: biological, chemical and therapeutic aspects. Nat Rev Drug Discov 2:999–1017[CrossRef][Medline]
  6. Patel YC 1999 Somatostatin and its receptor family. Front Neuroendocrinol 20:157–198[CrossRef][Medline]
  7. Elberg G, Hipkin RW, Schonbrunn A 2002 Homologous and heterologous regulation of somatostatin receptor 2. Mol Endocrinol 16:2502–2514[Abstract/Free Full Text]
  8. Thodou E, Kontogeorgos G, Theodossiou D, Pateraki M 2006 Mapping of somatostatin receptor types in GH or/and PRL producing pituitary adenomas. J Clin Pathol 59:274–279[Abstract/Free Full Text]
  9. Taniyama Y, Suzuki T, Mikami Y, Moriya T, Satomi S, Sasano H 2005 Systemic distribution of somatostatin receptor subtypes in human: an immunohistochemical study. Endocr J 52:605–611[CrossRef][Medline]
  10. Shimon I, Taylor JE, Dong JZ, Bitonte RA, Kim S, Morgan B, Coy DH, Culler MD, Melmed S 1997 Somatostatin receptor subtype specificity in human fetal pituitary cultures. Differential role of SSTR2 and SSTR5 for growth hormone, thyroid-stimulating hormone, and prolactin regulation. J Clin Invest 99:789–798[Medline]
  11. Hofland LJ, Lamberts SW 2004 Somatostatin receptors in pituitary function, diagnosis and therapy. Front Horm Res 32:235–252[Medline]
  12. van der Hoek J, Lamberts SW, Hofland LJ 2004 The role of somatostatin analogs in Cushing’s disease. Pituitary 7:257–264[CrossRef][Medline]
  13. Ben-Shlomo A, Wawrowsky KA, Proekt I, Wolkenfeld NM, Ren SG, Taylor J, Culler MD, Melmed S 2005 Somatostatin receptor type 5 modulates somatostatin receptor type 2 regulation of adrenocorticotropin secretion. J Biol Chem 280:24011–24021[Abstract/Free Full Text]
  14. Costa T, Cotecchia S 2005 Historical review: Negative efficacy and the constitutive activity of G-protein-coupled receptors. Trends Pharmacol Sci 26:618–624[CrossRef][Medline]
  15. Smit MJ, Vischer HF, Bakker RA, Jongejan A, Timmerman H, Pardo L, Leurs R 2007 Pharmacogenomic and structural analysis of constitutive G protein-coupled receptor activity. Annu Rev Pharmacol Toxicol 47:53–87[CrossRef][Medline]
  16. Bond RA, Ijzerman AP 2006 Recent developments in constitutive receptor activity and inverse agonism, and their potential for GPCR drug discovery. Trends Pharmacol Sci 27:92–96[CrossRef][Medline]
  17. Cervia D, Nunn C, Fehlmann D, Langenegger D, Schuepbach E, Hoyer D 2003 Pharmacological characterisation of native somatostatin receptors in AtT-20 mouse tumour corticotrophs. Br J Pharmacol 139:109–121[CrossRef][Medline]
  18. Strowski MZ, Dashkevicz MP, Parmar RM, Wilkinson H, Kohler M, Schaeffer JM, Blake AD 2002 Somatostatin receptor subtypes 2 and 5 inhibit corticotropin-releasing hormone-stimulated adrenocorticotropin secretion from AtT-20 cells. Neuroendocrinology 75:339–346[CrossRef][Medline]
  19. Cullen BR 2006 Enhancing and confirming the specificity of RNAi experiments. Nat Methods 3:677–681[CrossRef][Medline]
  20. Sledz CA, Holko M, de Veer MJ, Silverman RH, Williams BR 2003 Activation of the interferon system by short-interfering RNAs. Nat Cell Biol 5:834–839[CrossRef][Medline]
  21. Rocheville M, Lange DC, Kumar U, Sasi R, Patel RC, Patel YC 2000 Subtypes of the somatostatin receptor assemble as functional homo- and heterodimers. J Biol Chem 275:7862–7869[Abstract/Free Full Text]
  22. Pfeiffer M, Koch T, Schroder H, Klutzny M, Kirscht S, Kreienkamp HJ, Hollt V, Schulz S 2001 Homo- and heterodimerization of somatostatin receptor subtypes. Inactivation of sst(3) receptor function by heterodimerization with sst(2A). J Biol Chem 276:14027–14036[Abstract/Free Full Text]
  23. Sunahara RK, Taussig R 2002 Isoforms of mammalian adenylyl cyclase: multiplicities of signaling. Mol Interv 2:168–184[Abstract/Free Full Text]
  24. Houslay MD, Kolch W 2000 Cell-type specific integration of cross-talk between extracellular signal-regulated kinase and cAMP signaling. Mol Pharmacol 58:659–668[Free Full Text]
  25. Luttrell DK, Luttrell LM 2003 Signaling in time and space: G protein-coupled receptors and mitogen-activated protein kinases. Assay Drug Dev Technol 1:327–338[CrossRef][Medline]
  26. Tucek S, Michal P, Vlachova V 2002 Modelling the consequences of receptor-G-protein promiscuity. Trends Pharmacol Sci 23:171–176[CrossRef][Medline]
  27. Kilts JD, Gerhardt MA, Richardson MD, Sreeram G, Mackensen GB, Grocott HP, White WD, Davis RD, Newman MF, Reves JG, Schwinn DA, Kwatra MM 2000 ß(2)-adrenergic and several other G protein-coupled receptors in human atrial membranes activate both G(s) and G(i). Circ Res 87:705–709[Abstract/Free Full Text]
  28. Laugwitz KL, Allgeier A, Offermanns S, Spicher K, Van Sande J, Dumont JE, Schultz G 1996 The human thyrotropin receptor: a heptahelical receptor capable of stimulating members of all four G protein families. Proc Natl Acad Sci USA 93:116–120[Abstract/Free Full Text]
  29. Marinissen MJ, Gutkind JS 2001 G-protein-coupled receptors and signaling networks: emerging paradigms. Trends Pharmacol Sci 22:368–376[CrossRef][Medline]
  30. Dorsam RT, Gutkind JS 2007 G-protein-coupled receptors and cancer. Nat Rev Cancer 7:79–94[CrossRef][Medline]
  31. Werry TD, Sexton PM, Christopoulos A 2005 "Ins and outs" of seven-transmembrane receptor signalling to ERK. Trends Endocrinol Metab 16:26–33[CrossRef][Medline]
  32. Sun Y, Huang J, Xiang Y, Bastepe M, Juppner H, Kobilka BK, Zhang JJ, Huang XY 2007 Dosage-dependent switch from G protein-coupled to G protein-independent signaling by a GPCR. EMBO J 26:53–64[CrossRef][Medline]
  33. Conn PM, Knollman PE, Brothers SP, Janovick JA 2006 Protein folding as posttranslational regulation: evolution of a mechanism for controlled plasma membrane expression of a G protein-coupled receptor. Mol Endocrinol 20:3035–3041[Abstract/Free Full Text]
  34. Mundschenk J, Unger N, Schulz S, Hollt V, Steinke R, Lehnert H 2003 Somatostatin receptor subtypes in human pheochromocytoma: subcellular expression pattern and functional relevance for octreotide scintigraphy. J Clin Endocrinol Metab 88:5150–5157[Abstract/Free Full Text]
  35. Frohman LA, Kineman RD, Kamegai J, Park S, Teixeira LT, Coschigano KT, Kopchic JJ 2000 Secretagogues and the somatotrope: signaling and proliferation. Recent Prog Horm Res 55:269–290; discussion 290–291[Medline]
  36. Kimchi-Sarfaty C, Oh JM, Kim IW, Sauna ZE, Calcagno AM, Ambudkar SV, Gottesman MM 2006 A "silent" polymorphism in the MDR1 gene changes substrate specificity. Science 315:525–528[CrossRef][Medline]
  37. Iida A, Saito S, Sekine A, Kataoka Y, Tabei W, Nakamura Y 2004 Catalog of 300 SNPs in 23 genes encoding G-protein coupled receptors. J Hum Genet 49:194–208[CrossRef][Medline]
  38. Nyegaard M, Borglum AD, Bruun TG, Collier DA, Russ C, Mors O, Ewald H, Kruse TA 2002 Novel polymorphisms in the somatostatin receptor 5 (SSTR5) gene associated with bipolar affective disorder. Mol Psychiatry 7:745–754[CrossRef][Medline]
  39. Filopanti M, Ronchi C, Ballare E, Bondioni S, Lania AG, Losa M, Gelmini S, Peri A, Orlando C, Beck-Peccoz P, Spada A 2005 Analysis of somatostatin receptors 2 and 5 polymorphisms in patients with acromegaly. J Clin Endocrinol Metab 90:4824–4828[Abstract/Free Full Text]
  40. Jaquet P, Gunz G, Saveanu A, Barlier A, Dufour H, Taylor J, Dong J, Kim S, Moreau JP, Culler MD 2005 BIM-23A760, a chimeric molecule directed towards somatostatin and dopamine receptors, vs universal somatostatin receptors ligands in GH-secreting pituitary adenomas partial responders to octreotide. J Endocrinol Invest 28:21–27[Medline]
  41. Inoue K, Matsumoto H, Koyama C, Shibata K, Nakazato Y, Ito A 1992 Establishment of a folliculo-stellate-like cell line from a murine thyrotropic pituitary tumor. Endocrinology 131:3110–3116[Abstract]
  42. Chen CR, Tanaka K, Chazenbalk GD, McLachlan SM, Rapoport B 2001 A full biological response to autoantibodies in Graves’ disease requires a disulfide-bonded loop in the thyrotropin receptor N terminus homologous to a laminin epidermal growth factor-like domain. J Biol Chem 276:14767–14772[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Clin. Endocrinol. Metab.Home page
R. D. Murray and S. Melmed
A Critical Analysis of Clinically Available Somatostatin Analog Formulations for Therapy of Acromegaly
J. Clin. Endocrinol. Metab., August 1, 2008; 93(8): 2957 - 2968.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
K. Janssens, M. Boussemaere, S. Wagner, K. Kopka, and C. Denef
{beta}1-Adrenoceptors in Rat Anterior Pituitary May Be Constitutively Active. Inverse Agonism of CGP 20712A on Basal 3',5'-Cyclic Adenosine 5'-Monophosphate Levels
Endocrinology, May 1, 2008; 149(5): 2391 - 2402.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
21/10/2565    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow