help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2007-0110
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Naughton, C.
Right arrow Articles by Langdon, S. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Naughton, C.
Right arrow Articles by Langdon, S. P.
Molecular Endocrinology 21 (11): 2615-2626
Copyright © 2007 by The Endocrine Society

Progressive Loss of Estrogen Receptor {alpha} Cofactor Recruitment in Endocrine Resistance

Catherine Naughton, Kenneth MacLeod, Barbara Kuske, Robert Clarke, David A. Cameron and Simon P. Langdon

Edinburgh Cancer Research Centre (C.N., K.M., B.K., D.A.C., S.P.L.), University of Edinburgh, Edinburgh EH4 2XR, United Kingdom; and Lombardi Comprehensive Cancer Center (R.C.), Georgetown University School of Medicine, Washington, D.C., 20057

Address all correspondence and requests for reprints to: Catherine Naughton, Edinburgh Cancer Research Centre, University of Edinburgh, Crewe Road South, Edinburgh EH4 2XR, United Kingdom. E-mail: Catherine.Naughton{at}ed.ac.uk.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Differential expression of estrogen receptor-{alpha} (ER{alpha}) cofactors has been implicated in endocrine resistance in breast cancer. Using a three-stage MCF-7 cell-based model that emulates the clinical manifestation of acquired endocrine resistant breast cancer we now show, using a combination of chromatin immunoprecipitation and RNA interference, that there is a progressive loss of ER{alpha} cofactor recruitment to the estrogen-dependent pS2 gene and reduced requirement for cofactor expression. Maximal estrogen induced pS2 induction requires ER{alpha} and cofactor recruitment in MCF-7 cells, but in the progression to endocrine resistance these requirements are altered and expression has become less dependent on cofactors. Additionally, in estrogen-resistant MCF-7 cells there is a global loss of requirement of individual cofactors for proliferative cell growth indicating that other genes have lost the need for transcriptional cofactors. This loss of the requirement for cofactors may represent an important mechanism for gene misregulation in cancer.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
ENDOCRINE RESISTANCE IS a major problem in the treatment of breast cancer patients (1). One proposed mechanism of resistance involves differential expression of estrogen receptor-{alpha} (ER{alpha}) cofactors (2). These cofactors are either coactivators or corepressors and function to regulate ER{alpha}-mediated gene expression. Estrogen binding to ER{alpha} promotes receptor dimerization and induces occupancy of estrogen target gene promoters [typically at the site of conserved estrogen response elements] by ER{alpha} (1). Estrogen binding induces a conformational change in ER{alpha} that creates a protein interaction site on the surface of the ligand binding domain that is recognized by transcriptional coactivators (3, 4, 5). Coactivators function to recruit ATP-dependent chromatin remodelling complexes, histone acetyltransferases (HATs) and methyltransferases to specific enhancer/promoter regions (6, 7, 8). This activity serves to alleviate the repressive effect of chromatin on transcription, thus facilitating recruitment of the general transcription machinery (RNA polymerase II) and initiation of target gene transcription (6, 7). The ER{alpha} transcription complex formed is a dynamic structure with components recruited in a sequential order and has been shown to cycle repeatedly on and off target promoters in the presence of estrogen (9, 10). In contrast, ER{alpha} antagonists such as tamoxifen induce an alternate conformation in ER{alpha} that occludes the co-activator binding site and recruits co-repressors, which via recruitment of histone deacetylases (HDACs), silence gene transcription (5).

The p160 family of steroid receptor coactivators comprises three homologous members: SRC-1 (steroid receptor coactivator-1/NCOA-1), SRC-2 (TIF-2/GRIP-1/NCOA-2), and AIB1 (SRC-3/ACTR/pCIP/RAC-3/TRAM-1/NCOA-3), all of which have been implicated in ER{alpha}-mediated transcription and two of which (SRC-1 and AIB1) contain HAT activities (8). Specifically, overexpression and knockout studies have defined a role for p160s in the enhancement of ER{alpha} ligand-dependent transactivation (5, 11). More recently alterations in expression of one of these coactivators, AIB1, has been implicated in breast cancer initiation and, furthermore, in endocrine resistance. Overexpression of AIB1 in transgenic mice leads to the development of mammary carcinomas (12), and AIB1 gene amplification is detected in 5–10% of breast cancers (13), whereas a further study reported AIB1 overexpression in 64% of breast tumors (14). With respect to endocrine resistance, a recent study of tamoxifen-treated patients has shown that high AIB1 expression associates with a poorer disease-free survival in these patients, suggesting that high expression of ER{alpha} coactivators can reduce the antagonist activity of tamoxifen (15).

ER{alpha}-associated corepressors include the nuclear receptor corepressor (NCoR) and silencing mediator for retinoic and thyroid hormone receptors (SMRT) (16, 17). In the absence of ligand, these corepressors are associated with ER{alpha} to mediate transcriptional repression (18). In contrast to coactivators, a reduction in corepressor levels during tamoxifen treatment may be associated with resistance (19). Our understanding of how these coactivators and corepressors function at the ER{alpha} transcription complex comes from studies examining the promoter of estrogen-regulated genes, e.g. pS2 and Cathepsin D (9, 10, 20). pS2 [trefoil factor 1 (TFF1)] is the most frequently studied estrogen-responsive gene, with mRNA levels induced massively (up to 100-fold) by estrogen and only weakly by tamoxifen (21).

In this study we have investigated cofactor involvement in ER{alpha}-regulated transcription and growth using an in vitro model of endocrine resistance. We used the parental estrogen-dependent ER{alpha}+ MCF-7 breast cancer cell line and acquired resistance was examined using the MCF-7-derived Lombardi Cancer Centre (LCC) sublines MCF-7/LCC1 and MCF-7/LCC9. MCF-7/LCC1 (LCC1) cells were derived in vivo through selection under low estrogen conditions. These cells have become estrogen independent but remain responsive to antiestrogens (22). MCF7/LCC9 (LCC9) cells were established through stepwise in vitro selection of LCC1 cells against ICI 182, 780 and, in addition to acquiring ICI 182, 780 resistance, are cross resistant to tamoxifen (23). LCC1 and LCC9 cells retain functional ER{alpha} and remain dependent on ER{alpha} for maximal growth (24). However, our data suggest that in the acquisition of endocrine resistance in the low estrogen environment, growth becomes estrogen independent, involving increased ER{alpha} expression and estrogen independent gene transcription (22, 24). Using chromatin immunoprecipitation (ChIP) and RNA interference (RNAi) methodologies, we now show that there is a progressive loss of cofactor requirement in endocrine resistance for the expression of pS2, an estrogen-dependent gene. In addition, in endocrine resistant cells, there is a global loss of requirement of individual cofactors for proliferative cell growth indicating that many other proliferative genes have also lost their requirement for transcriptional cofactors.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
ER{alpha}-Dependent Gene Expression Is Altered in Endocrine Resistance
To investigate the molecular effects of estrogen resistance in breast cancer we have used the MCF-7 breast cancer cell line and estrogen-resistant derivative MCF-7 cell lines (22, 23). The pS2 gene is estrogen dependent and shows cyclical recruitment of factors for its expression (10). In MCF-7 cells pS2 gene expression is estradiol (E2) dependent with minimal expression in the absence of E2 (Fig. 1Go). In contrast, pS2 gene expression has become E2 independent in LCC1 and LCC9 cells, with significant levels of expression observed in the absence of E2 treatment (MCF-7 pS2 expression at 0 min vs. LCC1 0 min P = 0.016 and LCC9 0 min P = 0.0002; Student’s t test) making this gene a good model for investigating the molecular changes associated with endocrine resistance. This result supports similar previously published data from our group (24). However there is a significant induction of pS2 gene expression after 24-h E2 treatment, showing the pS2 promoter is E2 responsive in all cell lines (pS2 expression at 0 min vs. 24-h E2 treatment: MCF-7 and LCC9 P < 0.001, LCC1 P < 0.01; Student’s t test).


Figure 1
View larger version (9K):
[in this window]
[in a new window]

 
Fig. 1. Effects of Estrogen on pS2 mRNA Expression

Relative pS2 mRNA expression levels within each cell line were determined by RT-PCR after E2 (10–9 M) treatment over a 48-h time course. Data are presented as means ± SE of actin-corrected values from quadruplicate samples.

 
ER{alpha}-Independent pS2 Gene Expression in Endocrine Resistance
In a parallel study we have shown that pS2 gene expression has become ER{alpha} independent in the endocrine resistant LCC9 cell line (24). These experiments exploited Fulvestrant as an ER{alpha} down-regulator and demonstrated reduction of ER{alpha} expression in all three cell lines (MCF-7, LCC1, and LCC9). However, unlike MCF-7 and LCC1 cell lines, loss of ER{alpha} did not affect pS2 mRNA expression in LCC9 cells.

To examine how the mechanisms of pS2 gene transcription have changed in endocrine resistance, we used ChIP to investigate chromatin marks and cellular factors on the pS2 promoter. To determine whether the enhanced basal pS2 expression of LCC1 and LCC9 cells was regulated by ER{alpha} binding, ChIP analysis was used to examine ER{alpha}-ERE association at the pS2 promoter in each cell line. In MCF-7 cells, ER{alpha} binding to the pS2 promoter is minimal under basal conditions (Fig. 2AGo), but even in the absence of estrogen it was considerably higher in LCC1 cells (~8-fold). Importantly, in LCC9 cells there was little ER{alpha}, but a high level of pS2 expression, suggesting that in these very endocrine-resistant cells, there is no requirement of ER{alpha} for cofactor binding. These data are in agreement with our previously published observation, but novel associations with histone acetylation, cofactor binding, and gene expression are reported below (24).


Figure 2
View larger version (22K):
[in this window]
[in a new window]

 
Fig. 2. pS2 Promoter Acetylation and Occupancy by Cofactors

A, Basal H4 acetylation and ER{alpha} binding to the pS2 promoter were determined by ChIP analysis on untreated cells. Immunoprecipitated pS2 promoter was quantified by real-time PCR using primers that cover the region indicated (–353 to –30). H4 acetylation/ER{alpha} levels are normalized to the inputs and each is the mean ± SE (of 10 samples). Basal pS2 expression data from Fig. 1Go is shown. B, Cofactor and ER{alpha} protein levels were determined by Western blotting whole cell extracts. Actin is shown as a loading control. C and D, ChIP for basal pS2 promoter occupancy by coactivators SRC-1, AIB1 (C) and corepressors NCoR, SMRT (D). Data are presented as the mean ± SE for three independent experiments. In all ChIP experiments negative control IgG samples gave expression values < 0.1.

 
E2-Independent Gene Expression Associated with Altered Cofactor Binding to the pS2 Promoter
Histone acetylation is correlated to gene expression, and in MCF-7 cells histone H4 acetylation levels are low (Fig. 2AGo). Uninduced LCC1 cells have an increased level of histone acetylation (~2-fold) that is associated with maximal E2-induced pS2 gene expression observed in MCF-7 cells. Uninduced LCC9 cells display markedly enhanced H4 acetylation (>6-fold above MCF-7 levels) reflecting high basal expression within these cells. The considerable differences in histone acetylation on the pS2 promoter between the endocrine-resistant MCF-7 cells is probably due to a further misregulation of HATs or HDACs in LCC9 cells compared with LCC1 cells.

ER{alpha} cofactors are recruited to the ER{alpha}-transcription complex after ligand binding (9, 10). Many ER{alpha} cofactors have HAT or HDAC activity (5, 8). By Western analysis we examined the global expression levels of the p160 coactivators SRC-1, SRC-2, and AIB1 and the corepressors NCoR and SMRT in the MCF-7 cell lines (Fig. 2BGo). We observed that progressive endocrine resistance is accompanied by alterations in cofactor levels such that expression of all cofactors examined decreased in the LCC9 cells.

Using ChIP we assessed whether the enhanced basal gene expression and increased histone acetylation in LCC1 and LCC9 cells is due to alterations in cofactor binding to the pS2 promoter. We found that E2-independent pS2 gene activation in LCC1 cells might be due to increased HAT activity via enhanced AIB1 binding, whereas in LCC9 cells the increased pS2 gene activation is unlikely to be caused by a high level of HAT activity because both SRC-1 and AIB1 levels at the pS2 promoter are no higher than those observed in MCF-7 cells (Fig. 2CGo). However, ChIP analysis of H4 acetylation on the pS2 promoter after AIB1 short interfering RNA (siRNA) disproved this hypothesis (data not shown). Similarly enhanced pS2 gene activation could also be due to a loss of HDAC activity on the promoter as the level of SMRT associated with the pS2 promoter appears reduced in both LCC1 and LCC9 cells (Fig. 2DGo). In an effort to determine the importance of the individual cofactors for basal pS2 expression, an RNAi approach was used (Fig. 3Go). These data confirm that basal pS2 expression is enhanced after SMRT depletion (Fig. 3DGo).


Figure 3
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 3. Effects of siRNA Cofactor Depletion on Basal pS2 mRNA Expression

Transcriptional cofactors were depleted using an RNAi-based approach (see Materials and Methods). mRNA analysis confirming gene expression knockdown in (A) MCF-7 cells (B) LCC1 cells, and (C) LCC9 cells 48 h after siRNA treatment. D, pS2 mRNA expression was measured by quantitative RT-PCR on mRNA samples after 48-h siRNA treatment. Data are presented as means ± SD of actin-corrected values from triplicate samples.

 
Endocrine Resistance Is Not Associated with Altered ER{alpha} Recruitment
We have previously reported enhanced ER{alpha} binding at the pS2 promoter may be associated with increased basal ER{alpha} protein expression (Fig. 2AGo) (24). To further explore ER{alpha} involvement in endocrine resistance, ChIP analysis was used to explore E2-induced ER{alpha} recruitment in all cell lines over a 90-min period. E2 treatment strongly induced cyclical ER{alpha} recruitment to the pS2 promoter in MCF-7 cells (Fig. 4AGo). A similar response was observed for LCC1 and LCC9 cells. As a control we confirmed that ER{alpha} recruitment was not observed at a distal pS2 region (Fig. 4BGo).


Figure 4
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 4. E2-Induced ER{alpha} Recruitment to the pS2 Promoter

E2-induced ER{alpha} recruitment to the pS2 promoter (A) and distal region (B) were examined in MCF-7, LCC1, and LCC9 cells over a 90-min time course. At least three independent experiments were done in triplicate. Data are presented as the mean ± SE for a representative experiment. In addition we show agarose gel electrophoresis of the MCF-7 PCR products from the 0- to 90-min samples, inputs, and negative IgG control. C, E2-induced H4 acetylation at the pS2 promoter was examined over a 90-min time course. Data are presented as the mean ± SE for three independent experiments.

 
Significant levels of E2-induced ER{alpha} recruitment to the pS2 promoter were observed by 15 min in all cell lines, with maximal levels observed at 50 min. ER{alpha} recruitment was significantly greater in MCF-7 cells than in their endocrine-resistant derivatives, suggesting that although the ER{alpha} protein is intact and that mechanisms of ER{alpha} recruitment are not altered in hormone resistance, dependency on ER{alpha} as a cofactor for pS2 expression is reduced. Although E2-induced ER{alpha} recruitment is associated with enhanced H4 acetylation in both MCF-7 and LCC1 cells, this requirement has been lost in LCC9 cells where H4 acetylation is consistently high (Fig. 4CGo).

ER{alpha} Cofactor Recruitment Is Progressively Lost in Endocrine Resistance
High quality, cyclical gene transcription involves sequential recruitment of coactivators to the pS2 promoter (10). Because 15-min E2 exposure is sufficient to produce significant ER{alpha} recruitment in all three cell lines (Fig. 4AGo), we examined cofactor levels on the pS2 promoter at this time point (Fig. 5A–DGo). MCF-7 cells show E2-induced recruitment of SRC-1 and AIB1 to the pS2 promoter, whereas the corepressors NCoR and SMRT remain associated. LCC1 cells only show recruitment of AIB1 and have reduced association of NCoR and SMRT. In the fully estrogen-independent and tamoxifen-resistant LCC9 cells, AIB1 recruitment is reduced as compared with MCF-7 and LCC1 cells. Additionally, SRC-1 recruitment was not induced, and NCoR and SMRT levels were significantly decreased, thus showing the progressive loss of cofactor recruitment in hormone resistance.


Figure 5
View larger version (29K):
[in this window]
[in a new window]

 
Fig. 5. E2-Induced Cofactor Recruitment to the pS2 Promoter

E2-induced SRC-1 (A), AIB1 (B), NCoR (C), and SMRT (D) recruitment to the pS2 promoter were determined by ChIP after 15-min E2 (10–9 M) treatment in MCF-7, LCC1, and LCC9 cells. Data are normalized to basal levels from Fig. 2Go and presented as the mean ± SE for three independent experiments. The dashed red line represents basal levels normalized to 1. Effects of siRNA cofactor ablation on E2-induced pS2 gene expression. Transcriptional cofactors were ablated using an RNAi-based approach (see Materials and Methods). E, Western analysis confirming protein knockdown in MCF-7 cells 48 h after both siRNA and E2 (10–9 M) treatment. Similar reductions in protein expression were observed for LCC1 and LCC9 cells (data not shown). F, pS2 mRNA expression was measured by quantitative RT-PCR on mRNA samples after 48-h siRNA and E2 (10–9 M) treatment. Data are presented as means ± SD of actin-corrected values from triplicate samples.

 
E2-Induced pS2 Gene Expression Is Progressively Less Dependent on p160 Coactivators in Endocrine Resistance
We have shown that basal pS2 gene expression has become ER{alpha} independent in endocrine resistance (Fig. 2AGo) and (24). Additionally we have shown that although this expression is dependent on AIB1 in MCF-7 cells, expression has become AIB1 independent in LCC1 and LCC9 cells (Fig. 3DGo). To further investigate pS2 gene expression mechanisms in endocrine resistance, we used RNAi to investigate the role of individual cofactors on E2 induction of pS2 gene expression. RNAi was used to ablate either SRC-1, SRC-2, AIB1, NCoR, or SMRT expression (Fig. 5EGo). In MCF-7 cells there was a clear reduction (between 19 and 32%) in the E2 induction of pS2 gene expression after SRC-2, AIB1, or NCoR removal (Fig. 5FGo). In LCC1 cells E2-induced pS2 gene expression was only dependent on SRC-2 or AIB1 with expression reduced by between 30 and 40% after siRNA treatment. However, in the LCC9 cells E2-induced pS2 gene expression is less coactivator dependent with minor changes in expression after cofactor removal.

Estrogen-Insensitive LCC9 Cell Growth Is Cofactor Independent
We have shown that there is a progressive loss of cofactor requirement for expression of the estrogen-dependent gene pS2. To study the requirement of ER{alpha} cofactors in the E2 independent growth of each cell line, we ablated individual cofactors using RNAi. The efficiency and specificity of siRNA knockdown of target genes over 6 d was confirmed by Western analysis (Fig. 6AGo). Basal MCF-7 and LCC1 cell growth is dependent on each cofactor examined (Fig. 6BGo). In marked contrast, the E2-independent cell growth demonstrated by LCC9 cells is independent of all cofactors examined.


Figure 6
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 6. Effects of Specific Cofactor siRNAs on Cell Growth

A, Western analysis confirmed cofactor protein knockdown in MCF-7 cells was maintained over a 6-d period after siRNA treatment. Similar reductions in protein expression were observed for LCC1 and LCC9 cells (data not shown). B, Effects of cofactor-specific siRNA on basal cell growth were determined by cell proliferation assays, taking cell counts before siRNA treatment (d 0) and 3 d and 6 d after treatment. Negative control data are presented as means ± SE from quadruplicate samples. As each individual cofactor siRNA produced a similar effect on cell proliferation, these data are presented as the mean ± SE of all cofactors tested (SRC-1, SRC-2, AIB1, NCoR, and SMRT).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cofactor Dynamics Regulate ER{alpha}-Dependent Gene Expression
Much work has focused on ER{alpha} cofactor functions in ER{alpha}-mediated transcription and cell proliferation. These studies have identified p160 coactivators and the corepressors NCoR and SMRT as components of the ER{alpha} transcription complex assembled after ligand activation of ER{alpha} (9, 10, 25, 26). Indeed it has been reported that the recruitment by ER{alpha} of a p160 coactivator is sufficient for gene activation and to mediate estrogen-induced cell proliferation in breast cancer (9). The current view suggests that ligand-bound receptor exists in a dynamic equilibrium with coactivator and corepressor proteins to afford a regular and tightly controlled induction curve for nuclear receptor-mediated gene expression. However, the ultimate direction of the transcriptional response in a given cell and promoter context will be determined by the relative binding affinities and cellular distributions of these cofactors (27, 28, 29).

In this study we have identified altered cofactor binding and a progressive loss of cofactor recruitment in endocrine resistance in breast cancer. We have exploited a three-stage MCF-7-based cell line model wherein cofactor functions in parental MCF-7 cells were compared firstly to their E2-independent derivative LCC1 cells and secondly to the further derived fully endocrine-resistant LCC9 cells. We show that in the acquisition of endocrine resistance, both ER{alpha}-dependent pS2 gene expression and cell proliferation have become E2 independent. These changes are associated with altered cofactor binding to the promoter in the absence of ligand (Fig. 2Go) suggesting that cofactors are a significant feature in the development of endocrine-resistant breast cancer. In support of this, data from several studies have shown that high levels of coactivator expression may enhance the agonist activity of tamoxifen, thus contributing to endocrine resistance (12, 13, 14, 15). Additionally, expression of dominant-negative NCoR in MCF-7 cells was found to both enhance the transcriptional activity of tamoxifen bound ER{alpha} and induce cell growth (28). In further studies MCF-7 cells were implanted into nude mice, which were then treated with tamoxifen. A decrease in tumor NCoR levels was associated with acquired resistance of these tumors to the antiproliferative effects of tamoxifen (19). These studies suggest the level of coactivator/corepressor ratio plays a key role in preventing breast tumor proliferation by tamoxifen and support this as a mechanism associated with endocrine resistance (15, 19, 28).

ER{alpha} Cofactor Requirement Is Progressively Lost in Endocrine Resistance
High quality, cyclical gene transcription involves sequential recruitment of cofactors to the pS2 promoter (9, 10). LCC9 cells, in the acquisition of endocrine resistance, have a global reduction in cofactor protein levels (Fig. 2BGo). Although a reduction in corepressor proteins can be associated with endocrine resistance, coactivator expression is reported to increase (13, 14, 15, 19). Here we show that E2-induced pS2 transcription is associated with both progressive loss of cofactor recruitment and reduced dependency on individual cofactor expression in endocrine resistance. This change in cofactor regulation at the pS2 promoter may also describe why pS2 gene activation (as determined by H4 acetylation) is altered in LCC9 cells as compared with MCF-7 or LCC1 cells (Fig. 4CGo). Additionally we show a global loss of individual cofactor requirements for proliferative cell growth in endocrine resistance. This suggests that in the acquisition of endocrine resistance, many other proliferative genes have also lost the requirement for transcriptional cofactors. Thus the reduction in global cofactor expression is perhaps unsurprising and could be explained by decreased requirement for cofactors producing a negative feedback on cofactor transcription. This reinforces the view that interplay between coactivators and corepressors is key to controlling gene regulation and that changes in this process are a conceivable mechanism for contributing to endocrine resistance in breast cancer.

Cofactor Regulation and Posttranslational Modifications
One mechanism that could account for this loss of cofactor recruitment to the pS2 promoter is reduced ER{alpha} activation through Ser118 phosphorylation (30). Indeed we have previously identified reduced basal Ser118 phosphorylation in both LCC1 and LCC9 cells, and estrogen-induced Ser118 phosphorylation was markedly reduced upon acquisition of endocrine resistance (24). In addition, recent studies have identified ER{alpha} cofactors as targets for posttranslational modification by diverse cellular signaling pathways (ERK, MAPK, p38) (25, 31, 32, 33). Phosphopeptide mapping experiments have revealed multiple phosphorylation sites within the p160 coactivator proteins (31, 32, 33). The fact that very few of these are conserved between p160s argues that this may represent an important determinant of functional specificity. Significantly, AIB1 phosphorylation has been shown to enhance its nuclear sublocalisation, ER{alpha} interaction, and have essential functions for ER{alpha} transactivation (33, 34, 35). In terms of endocrine resistance phospho AIB1 has been shown to be necessary for AIB1-induced tamoxifen agonist activity in breast cancer cells (36). Similarly, SMRT phosphorylation has been shown to inhibit the ability of this corepressor to mediate repression (25). Increased activity in MAPK signaling pathways has been implicated in endocrine-resistant breast cancer, thus loss of cofactor functions could be accounted for via altered MAPK signaling (37, 38).

In conclusion, we have demonstrated progressive loss of cofactor function (including regulation of growth) in progressively more estrogen-independent breast cancer cell lines. This loss of cofactor requirement may represent an important mechanism for gene misregulation in cancer and afford a suitable target to overcome endocrine resistance in the treatment of breast cancer.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture and Reagents
MCF-7 cells were routinely grown in phenol red containing DMEM supplemented with 10% fetal calf serum, penicillin (100 U/ml), and streptomycin (100 µg/ml). MCF-7-derived MCF-7/LCC1 and MCF-7/LCC9 cells (22, 23) (source: Dr. Robert Clarke, V. T. Lombardi Cancer Research Centre, Georgetown University Medical School, Washington, D.C.) were routinely cultured in phenol-red-free DMEM supplemented with 5% dextran activated double charcoal stripped fetal calf serum (DCC), penicillin (100 U/ml), streptomycin (100 µg/ml), and 2 mM Glutamine. Cells were maintained in a humidified atmosphere at 37 C and 5% CO2. 17ß-E2 and tamoxifen were purchased from Sigma (St. Louis, MO).

Cell Proliferation Assays
MCF-7 cells were seeded at a density of 2.5 x 104 cells per well in six-well plates, and 24 h later the cells were washed twice with PBS and the media changed to phenol-red-free DMEM with 5% DCC for 48 h. The cells were then treated with media containing 10–9 M E2 T and incubated for 6 d. LCC1 and LCC9 cells were seeded at a density of 2.5 x 104 cells per well in six-well plates in phenol-red-free containing DMEM with 5% DCC and after 24 h were treated with media supplemented with E2. Cells were incubated with the drugs for 6 d, and this medium was changed and replaced with fresh medium and drugs on d 3. Cell counts on d 0, 3, and 6 were estimated using a Coulter Counter (Beckman Coulter, Inc., Fullerton, CA).

RNA Preparation and Real-Time RT-PCR Analysis
RNA from MCF-7 and LCC cells was prepared using either Stratagene’s Absolutely RNA miniprep kit (Stratagene, La Jolla, CA) or Tri-Reagent (Sigma) following manufacturers’ instructions. Quantification of the RNA was performed by spectrophotometry at 260 nm. RNA was analyzed by real-time RT-PCR using Rotorgene (Corbett Research, San Francisco, CA) and the QuantiTect SYBR Green system (QIAGEN, Chatsworth, CA) according to the manufacturers’ instructions. The thermal cycling conditions were RT: 50 C for 30 min; PCR: initial denaturation 95 C for 15 min; followed by 40 cycles of denaturation 94 C for 15 sec, annealing 57 C for 30 sec, extension 72 C for 30 sec; and a final extension of 72 C for 60 sec. The following primers were used: pS2: fwd TTGTGGTTTTCCTGGTGTCA and rev CCGAGCTCTGGGACTAATCA; ER{alpha}: fwd CCACCA ACCAGTGCACCATT, rev GTCTTTCCGTATCCCACCTTTC; AIB1: fwd CCCTTTTATCTACTCTGTCATC, rev CCAGATGTAGAGGAGGAGAC; SRC-2: fwd AGCCTGTGAGAGGGCTGTTA, rev AATGAGAGAGGGGAAGGGAA; SRC-1: fwd CATGCTTATGAGGCAGCAAA, rev ATTCCAGTGCCAAACTGTCC; NCoR: fwd AAAGTGTGGAGACCCAGGTG, rev ACCCTCACTTCAACGTCCAC; SMRT: fwd AAGTCCATCCTCACGTCCAC, rev AAGCACACTGGGTCTCTGCT; ß-actin: fwd CTACGTCGCCCTGGACTTCGAGC, rev GATGGAGCCGCCGATCCACACGG.

siRNA Transfections
MCF-7 cells were seeded at 0.5 x 106 cells per 75-cm2 flask in DMEM as above. Twenty-four hours later after two PBS washes, the medium was changed to phenol-red-free DMEM with 5% DCC for 48 h. LCC1 and LCC9 cells were seeded directly into phenol-red-free containing DMEM with 5% DCC for 24 h before transfection. Cells were transfected with siRNA for 4 h using Oligofectamine reagent (Invitrogen, Paisley, UK) after which time 10–9 M E2 was added if required for a further 48 h before RNA and protein extraction. siRNA sequences were: Negative siRNA: Upstate M-003401; AIB1: Qiagen 1024591; SRC-1: Qiagen 1024927; SRC-2: 5'AAGTCAGATGTATCCTCTACA; NCoR: 5'AAUGCUACUUCUCGAGGAAACA; SMRT: 5'AAGGGUAUCAUCACCGCUGUG. All siRNA were used at 100 nM.

Western Blot Analysis
Cells were washed twice with PBS and lysed in ice cold lysis buffer [50 mM Tris (pH 7.5), 5 mM EDTA (pH 8.5), 150 mM NaCl, 1% Triton X-100, aprotinin 10 µg/ml, and 1x protease inhibitor cocktail (Roche, Basel, Switzerland)] for 10 min, and the debris was cleared by centrifugation at 13,000 rpm for 6 min at 4 C. Protein lysates (25–100 µg) were resolved by 7–12% SDS-PAGE and electrophoretically transferred to Immobilon-P membranes. After transfer, membranes were blocked and probed with primary antibody overnight at 4 C. All blots were visualized with either BM chemiluminescence (Roche) or SuperSignal West Femto chemiluminescent substrate (Pierce, Rockford, IL) and Hyperfilm (Amersham Biosciences, Piscataway, NJ). Antibodies used were: ER{alpha} (F-10) (Santa Cruz Biotech SC-8002; Santa Cruz, CA), AIB1 (Affinity BioReagents, Inc., Golden, CO) (MA1-845), SRC-2 (BD Biosciences, Palo Alto, CA) (610984), SRC-1 (Upstate Biotechnology, Inc., Lake Placid, NY) (05-522) (this antibody recognizes both SRC-1 isoforms), NCoR (Upstate) (06-892), SMRT (Upstate) (06-891), and Actin (Calbiochem, La Jolla, CA) (CP01).

ChIP Assays
ChIP assays were performed as described (9). Cells were grown to 90% confluence in phenol-red-free DMEM with 5% DCC for at least 48 h. After treatment with 10–9 M E2 over a 90-min time course, cells were cross-linked with 1% formaldehyde at 37 C for 10 min. Unreacted formaldehyde was quenched by gentle agitation at room temperature for 10 min with 0.125 M glycine. Cells were then washed twice with ice-cold PBS, collected into PBS containing protease inhibitors and centrifuged for 4 min at 2000 rpm at 4 C. The pellets were resuspended in 100 µl of lysis buffer per 106 cells [1% sodium dodecyl sulfate (SDS), 10 mM EDTA, 50 mM Tris-HCl (pH 8.1), and 1x protease inhibitor cocktail], incubated on ice for 10 min, and sonicated for 12 x 20 sec at 2 amplitude microns (Soniprep 150; MSE, Sanyo Gallenkamp PLC, Loughborough, UK). After centrifugation for 15 min at 13,000 rpm and 4 C, supernatants were collected and resuspended in dilution buffer (0.01% SDS;1% Triton X-100; 1.2 mM EDTA; 16.7 mM Tris HCl, pH 8.1; 167 mM NaCl; and 1x protease inhibitor cocktail). Chromatin was precleared with 1 µg antirabbit or antimouse IgG; 2 µg sheared salmon sperm DNA, and protein-G-Agarose (50 µl of 50% slurry in dilution buffer) for 3 h at 4 C. Immunoprecipitation was performed overnight at 4 C with 2 µg sheared salmon sperm DNA, 50 µl protein-G-Agarose, and specific antibodies. Precipitates were washed sequentially for 5 min each at 4 C with TSE I (20 mM Tris, pH 8.1; 2 mM EDTA; 150 mM NaCl; 1% Triton X-100; and 0.1% SDS), TSE II (20 mM Tris, pH 8.1; 2 mM EDTA; 500 mM NaCl; 1% Triton X-100; and 0.1% SDS), and buffer III (10 mM Tris, pH 8.1; 0.25 M LiCl; 1 mM EDTA; 1% NP40; and 1% deoxycholate). Precipitates were then washed twice with TE buffer and the protein/DNA complexes were eluted twice with 0.1 M NaHCO3 in 1% SDS. Crosslinks were reversed by incubation at 65 C overnight. DNA fragments were purified using QIAquick Spin Kit columns (Qiagen) and amplified using the QuantiTect SYBR Green system (Qiagen). Thermal cycling conditions were: 95 C for 15 min followed by 45 cycles of 94 C for 15 sec, 55 C for 30 sec, 72 C for 30 sec, and a final extension of 72 C for 5 min. PCR primer sequences for the pS2 promoter were: fwd GACGGAATGGGCTTCATGAGC and rev CTGAGACAATAATCTCCACTG. PCR primer sequences for distal pS2 (~3 kb upstream of pS2 promoter) were: fwd CTTGCCTCTGCATTCTCTCC and rev GAGTTTGGCCTCCCACATTA.

ChIP Antibodies
H4 (Upstate, 06-866), ER{alpha} HC-20 (Santa Cruz, sc543), AIB-1 C-20 (Santa Cruz, sc7216), SRC-1 (Upstate, 05-522), NCoR (Santa Cruz, sc1609), and SMRT (Santa Cruz sc20778).


    ACKNOWLEDGMENTS
 
This work was supported by Cancer Research UK. We thank Dr. Nick Gilbert for helpful discussions and assistance in the preparation of the manuscript.


    FOOTNOTES
 
Present address for D.A.C.: NCRN Coordinating Centre, Arthington House, Cookridge Hospital, Hospital Lane, Leeds LS16 6QB, United Kingdom.

Requests for reprints may also be sent to: Simon P. Langdon, Edinburgh Cancer Research Centre, University of Edinburgh, Crewe Road South, Edinburgh EH4 2XR, United Kingdom. E-mail: Simon.Langdon{at}ed.ac.uk.

This work was supported by Cancer Research UK.

Disclosure Statement: The authors have nothing to disclose.

First Published Online July 31, 2007

Abbreviations: ChIP, Chromatin immunoprecipitation; DCC, double charcoal stripped fetal calf serum; E2, estradiol; ER{alpha}, estrogen receptor-{alpha}; HAT, histone acetyltransferase; HDAC, histone deacetylase; LCC, Lombardi Cancer Centre; NCoR, nuclear receptor corepressor; RNAi, RNA interference; siRNA, short interfering RNA; SDS, sodium dodecyl sulfate; SMRT, silencing mediator for retinoic and thyroid hormone receptor.

Received for publication February 27, 2007. Accepted for publication July 25, 2007.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Ali S, Coombes RC 2002 Endocrine-responsive breast cancer and strategies for combating resistance. Nat Rev Cancer 2:101–112[CrossRef][Medline]
  2. Normanno N, Di Maio M, De Maio E, De Luca A, de Matteis A, Giordano A, Perrone F 2005 Mechanisms of endocrine resistance and novel therapeutic strategies in breast cancer. Endocr Relat Cancer 12:721–747[Abstract/Free Full Text]
  3. Danielian PS, White R, Lees JA, Parker MG 1992 Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J 11:1025–1033[Medline]
  4. Parker MG 1995 Structure and function of estrogen receptors. Vitam Horm 51:267–87[Medline]
  5. Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA, Greene GL 1998 The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95:927–937[CrossRef][Medline]
  6. Brownell JE, Allis CD 1996 Special HATs for special occasions: linking histone acetylation to chromatin assembly and gene activation. Curr Opin Genet Dev 6:176–184[CrossRef][Medline]
  7. Belandia B, Parker MG 2003 Nuclear receptors: a rendez-vous for chromatin remodeling factors. Cell 114:277–280[CrossRef][Medline]
  8. Xu J, Li Q 2003 Review of the in vivo functions of the p160 steroid receptor coactivator family. Mol Endocrinol 17:168116–92
  9. Shang Y, Hu X, DiRenzo J, Lazar MA, Brown M 2000 Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103:843–852[CrossRef][Medline]
  10. Métivier R, Penot G, Hübne MR, Reid G, Brand H, Kos M, Gannon F 2003 Estrogen receptor-{alpha} directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115:751–763[CrossRef][Medline]
  11. Cavarretta ITR, Mukopadhyay R, Lonard DM, Cowsert LM, Bennett CF, O’Malley BW, Smith CL 2002 Reduction of coactivator expression by antisense oligodeoxynucleotides inhibits ER{alpha} transcriptional activity and MCF-7 proliferation. Mol Endocrinol 16:253–270[Abstract/Free Full Text]
  12. Torres-Arzayus MI, Font de Mora J, Yuan J, Vazquez F, Bronson R, Rue M, Sellers WR, Brown M 2004 High tumor incidence and activation of the PI3K/AKT pathway in transgenic mice define AIB1 as an oncogene. Cancer Cell 6:263–274[CrossRef][Medline]
  13. Bautista S, Valles H, Walker RL, Anzick S, Zeillinger R, Meltzer P, Theillet C 1998 In breast cancer, amplification of the steroid receptor coactivator gene AIB1 is correlated with estrogen and progesterone receptor positivity. Clin Can Res 4:2925–2929[Abstract]
  14. Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan X, Sauter G, Kallioniemi O, Trent JM, Meltzer PS 1997 AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277:965–968[Abstract/Free Full Text]
  15. Osborne CK, Bardou B, Hopp TA, Chamness GC, Hilsenbeck SG, Fuqua SAW, Wong J, Allred DC, Clark GM, Schiff R 2003 Role of the estrogen receptor coactivator AIB1 (SRC-3) and HER-2/neu in tamoxifen resistance in breast cancer. J Natl Cancer Inst 95:353–361[Abstract/Free Full Text]
  16. Heinzel T, Lavinsky RM, Mullen TM, Soderstrom M, Laherty CD, Torchia J, Yang WM, Brard G, Ngo SD, Davie JR, Seto E, Eisenman RN, Rose DW, Glass CK 1997 A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature 38:43–48
  17. Nagy L, Kao HY, Chakravarti D, Lin RJ, Hassig CA, Ayer DE, Schreiber SL, Evans RM 1997 Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase. Cell 89:373–380[CrossRef][Medline]
  18. Chen JD, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457[CrossRef][Medline]
  19. Lavinsky RM, Jepsen K, Heinzel T, Torchia J, Mullen T, Schiff R, Del-Rio AL, Ricote M, Ngo S, Gemsch J, Hilsenbeck SG, Osborne CK, Glass CK, Rosenfeld MG, Rose DW 1998 Diverse signalling pathways modulate nuclear receptor recruitment of N-CoR and SMRT complexes. Proc Nat Acad Sci 95:2920–2925[Abstract/Free Full Text]
  20. Liu X, Bagchi MK 2004 Recruitment of distinct chromatin-modifying complexes by tamoxifen-complexed estrogen receptor at natural target gene promoters in vivo. J Biol Chem 279:15050–15058[Abstract/Free Full Text]
  21. Prest SJ, May FEB, Westley BR 2002 The estrogen-regulated protein, TFF1, stimulates migration of human breast cancer cells. FASEB J 16:592–594[Abstract/Free Full Text]
  22. Brunner N, Boulay V, Fojo A, Freter CE, Lippman ME, Clarke R 1993 Acquisition of hormone-independent growth in MCF-7 cells is accompanied by increased expression of estrogen-regulated genes but without detectable DNA amplifications. Cancer Res 53:283–290[Abstract/Free Full Text]
  23. Brunner N, Boysen B, Jirus S, Skaar TC, Holst-Hansen C, Lippman J, Frandsen T, Spang-Thomsen M, Fuqua AW, Clarke R 1997 MCF7/LCC9: an antiestrogen-resistant variant in which acquired resistance to the steroidal antiestrogen ICI 182780 confers an early cross-resistance to the nonsteroidal antiestrogen tamoxifen. Cancer Res 57:3486–3493[Abstract/Free Full Text]
  24. Kuske B, Naughton C, Moore K, MacLeod KG, Miller WR, Clarke R, Langdon SP, Cameron DA 2006 Endocrine therapy resistance can be associated with high estrogen receptor {alpha} (ER{alpha}) espression and reduced ER{alpha} phosphorylation in breast cancer models. Endocrine Related Cancer 13:1121–1133[Abstract/Free Full Text]
  25. Hong, S, Privalsky ML 2000 The SMRT corepressor is regulated by a MEK-1 kinase pathway: inhibition of corepressor function is associated with SMRT phosphorylation and nuclear export. Mol Cell Biol 20:6612–6625[Abstract/Free Full Text]
  26. Smith CL, Nawaz Z, O’Malley BW 1997 Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4-hydroxytamoxifen. Mol Endocrinol 11:657–666[Abstract/Free Full Text]
  27. Zhang X, Jeyakumar M, Petukhov S, Bagchi MK 1998 A nuclear receptor corepressor modulates transcriptional activity of antagonist-occupied steroid hormone receptor. Mol Endocrinol 12:513–524[Abstract/Free Full Text]
  28. Fujita T, Kobayashi Y, Wada O, Tateishi Y, Kitada L, Yamamoto Y, Takashima H, Murayama A, Yano T, Baba T, Kato S, Kawabe Y, Yanagisawa J 2003 Full activation of estrogen receptor {alpha} activation function-1 induces proliferation of breast cancer cells. J Biol Chem 278:26704–26714[Abstract/Free Full Text]
  29. McKenna NJ, O’Malley BW 2002 Combinatorial control of gene expression by nuclear receptors and coregulators. Cell 108:465–474[CrossRef][Medline]
  30. Dutertre M, Smith CL 2003 Ligand-independent interactions of p160/steroid receptor coactivators and CREB-binding protein (CBP) with estrogen receptor-{alpha}: regulation by phosphorylation sites in the A/B region depends on other receptor domains. Mol Endocrinol 17:1296–1314[Abstract/Free Full Text]
  31. Lopez GN, Turck CW, Schaufele F, Stallcup MR, Kushner PJ 2001 Growth factors signal to steroid receptors through mitogen-activated protein kinase regulation of p160 coactivator activity. J Biol Chem 276:22177–22182[Abstract/Free Full Text]
  32. Rowan B, Weigel N, O’Malley BW 2000 Phosphorylation of steroid receptor coactivator-1. J Biol Chem 275:4475–4483[Abstract/Free Full Text]
  33. Wu R, Qin J, Yi P, Wong J, Tsai SY, Tsai M, O’Malley BW 2004 Selective phosphorylations of the SRC-3/AIB1 coactivator integrate genomic reponses to multiple cellular signaling pathways. Mol Cell 15:937–949[CrossRef][Medline]
  34. Wu R, Qin J, Hashimoto Y, Wong J, Xu J, Tsai YS, Tsai M, O’Malley BW 2002 Regulation of SRC-3 (pCIP/ACTR/AIB-1/RAC-3/TRAM-1) coactivator activity by I{kappa}B kinase. Mol Cell Biol 22:3549–3561[Abstract/Free Full Text]
  35. Wu R, Smith CL, O’Malley BW 2005 Transcriptional regulation by steroid receptor coactivator phosphorylation. Endocr Rev 26:393–399[Abstract/Free Full Text]
  36. Shao W, Krasnickas Keeton E, McDonnell DP, Brown M 2004 Coactivator AIB1 links estrogen receptor transcriptional activity and stability. Proc Natl Acad Sci 101:11599–11604[Abstract/Free Full Text]
  37. Ciocca DR, Elledge R 2000 Molecular markers for predicting response to tamoxifen in breast cancer patients. Endocrine 13:1–10[CrossRef][Medline]
  38. Mass R 2000 The role of HER-2 expression in predicting response to therapy in breast cancer. Semin Oncol 27:46–52[Medline]

NURSA Molecule Pages Link:

Nuclear Receptors:   ERα
Coregulators:   SRC-1  |  GRIP1  |  AIB1  |  NCOR  |  SMRT
Ligands:   17β-Estradiol



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. Palijan, I. Fernandes, Y. Bastien, L. Tang, M. Verway, M. Kourelis, L. E. Tavera-Mendoza, Z. Li, V. Bourdeau, S. Mader, et al.
Function of Histone Deacetylase 6 as a Cofactor of Nuclear Receptor Coregulator LCoR
J. Biol. Chem., October 30, 2009; 284(44): 30264 - 30274.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. Jin, R. J. van't Hof, O. M.E. Albagha, and S. H. Ralston
Promoter and intron 1 polymorphisms of COL1A1 interact to regulate transcription and susceptibility to osteoporosis
Hum. Mol. Genet., August 1, 2009; 18(15): 2729 - 2738.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Mao, N. M. Patterson, M. T. Cherian, I. O. Aninye, C. Zhang, J. B. Montoya, J. Cheng, K. S. Putt, P. J. Hergenrother, E. M. Wilson, et al.
A New Small Molecule Inhibitor of Estrogen Receptor {alpha} Binding to Estrogen Response Elements Blocks Estrogen-dependent Growth of Cancer Cells
J. Biol. Chem., May 9, 2008; 283(19): 12819 - 12830.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Naughton, C.
Right arrow Articles by Langdon, S. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Naughton, C.
Right arrow Articles by Langdon, S. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals