| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cofactor Recruitment in Endocrine ResistanceEdinburgh Cancer Research Centre (C.N., K.M., B.K., D.A.C., S.P.L.), University of Edinburgh, Edinburgh EH4 2XR, United Kingdom; and Lombardi Comprehensive Cancer Center (R.C.), Georgetown University School of Medicine, Washington, D.C., 20057
Address all correspondence and requests for reprints to: Catherine Naughton, Edinburgh Cancer Research Centre, University of Edinburgh, Crewe Road South, Edinburgh EH4 2XR, United Kingdom. E-mail: Catherine.Naughton{at}ed.ac.uk.
| ABSTRACT |
|---|
|
|
|---|
(ER
) cofactors has been implicated in endocrine resistance in breast cancer. Using a three-stage MCF-7 cell-based model that emulates the clinical manifestation of acquired endocrine resistant breast cancer we now show, using a combination of chromatin immunoprecipitation and RNA interference, that there is a progressive loss of ER
cofactor recruitment to the estrogen-dependent pS2 gene and reduced requirement for cofactor expression. Maximal estrogen induced pS2 induction requires ER
and cofactor recruitment in MCF-7 cells, but in the progression to endocrine resistance these requirements are altered and expression has become less dependent on cofactors. Additionally, in estrogen-resistant MCF-7 cells there is a global loss of requirement of individual cofactors for proliferative cell growth indicating that other genes have lost the need for transcriptional cofactors. This loss of the requirement for cofactors may represent an important mechanism for gene misregulation in cancer. | INTRODUCTION |
|---|
|
|
|---|
(ER
) cofactors (2). These cofactors are either coactivators or corepressors and function to regulate ER
-mediated gene expression. Estrogen binding to ER
promotes receptor dimerization and induces occupancy of estrogen target gene promoters [typically at the site of conserved estrogen response elements] by ER
(1). Estrogen binding induces a conformational change in ER
that creates a protein interaction site on the surface of the ligand binding domain that is recognized by transcriptional coactivators (3, 4, 5). Coactivators function to recruit ATP-dependent chromatin remodelling complexes, histone acetyltransferases (HATs) and methyltransferases to specific enhancer/promoter regions (6, 7, 8). This activity serves to alleviate the repressive effect of chromatin on transcription, thus facilitating recruitment of the general transcription machinery (RNA polymerase II) and initiation of target gene transcription (6, 7). The ER
transcription complex formed is a dynamic structure with components recruited in a sequential order and has been shown to cycle repeatedly on and off target promoters in the presence of estrogen (9, 10). In contrast, ER
antagonists such as tamoxifen induce an alternate conformation in ER
that occludes the co-activator binding site and recruits co-repressors, which via recruitment of histone deacetylases (HDACs), silence gene transcription (5).
The p160 family of steroid receptor coactivators comprises three homologous members: SRC-1 (steroid receptor coactivator-1/NCOA-1), SRC-2 (TIF-2/GRIP-1/NCOA-2), and AIB1 (SRC-3/ACTR/pCIP/RAC-3/TRAM-1/NCOA-3), all of which have been implicated in ER
-mediated transcription and two of which (SRC-1 and AIB1) contain HAT activities (8). Specifically, overexpression and knockout studies have defined a role for p160s in the enhancement of ER
ligand-dependent transactivation (5, 11). More recently alterations in expression of one of these coactivators, AIB1, has been implicated in breast cancer initiation and, furthermore, in endocrine resistance. Overexpression of AIB1 in transgenic mice leads to the development of mammary carcinomas (12), and AIB1 gene amplification is detected in 5–10% of breast cancers (13), whereas a further study reported AIB1 overexpression in 64% of breast tumors (14). With respect to endocrine resistance, a recent study of tamoxifen-treated patients has shown that high AIB1 expression associates with a poorer disease-free survival in these patients, suggesting that high expression of ER
coactivators can reduce the antagonist activity of tamoxifen (15).
ER
-associated corepressors include the nuclear receptor corepressor (NCoR) and silencing mediator for retinoic and thyroid hormone receptors (SMRT) (16, 17). In the absence of ligand, these corepressors are associated with ER
to mediate transcriptional repression (18). In contrast to coactivators, a reduction in corepressor levels during tamoxifen treatment may be associated with resistance (19). Our understanding of how these coactivators and corepressors function at the ER
transcription complex comes from studies examining the promoter of estrogen-regulated genes, e.g. pS2 and Cathepsin D (9, 10, 20). pS2 [trefoil factor 1 (TFF1)] is the most frequently studied estrogen-responsive gene, with mRNA levels induced massively (up to 100-fold) by estrogen and only weakly by tamoxifen (21).
In this study we have investigated cofactor involvement in ER
-regulated transcription and growth using an in vitro model of endocrine resistance. We used the parental estrogen-dependent ER
+ MCF-7 breast cancer cell line and acquired resistance was examined using the MCF-7-derived Lombardi Cancer Centre (LCC) sublines MCF-7/LCC1 and MCF-7/LCC9. MCF-7/LCC1 (LCC1) cells were derived in vivo through selection under low estrogen conditions. These cells have become estrogen independent but remain responsive to antiestrogens (22). MCF7/LCC9 (LCC9) cells were established through stepwise in vitro selection of LCC1 cells against ICI 182, 780 and, in addition to acquiring ICI 182, 780 resistance, are cross resistant to tamoxifen (23). LCC1 and LCC9 cells retain functional ER
and remain dependent on ER
for maximal growth (24). However, our data suggest that in the acquisition of endocrine resistance in the low estrogen environment, growth becomes estrogen independent, involving increased ER
expression and estrogen independent gene transcription (22, 24). Using chromatin immunoprecipitation (ChIP) and RNA interference (RNAi) methodologies, we now show that there is a progressive loss of cofactor requirement in endocrine resistance for the expression of pS2, an estrogen-dependent gene. In addition, in endocrine resistant cells, there is a global loss of requirement of individual cofactors for proliferative cell growth indicating that many other proliferative genes have also lost their requirement for transcriptional cofactors.
| RESULTS |
|---|
|
|
|---|
-Dependent Gene Expression Is Altered in Endocrine Resistance
|
-Independent pS2 Gene Expression in Endocrine Resistance
independent in the endocrine resistant LCC9 cell line (24). These experiments exploited Fulvestrant as an ER
down-regulator and demonstrated reduction of ER
expression in all three cell lines (MCF-7, LCC1, and LCC9). However, unlike MCF-7 and LCC1 cell lines, loss of ER
did not affect pS2 mRNA expression in LCC9 cells.
To examine how the mechanisms of pS2 gene transcription have changed in endocrine resistance, we used ChIP to investigate chromatin marks and cellular factors on the pS2 promoter. To determine whether the enhanced basal pS2 expression of LCC1 and LCC9 cells was regulated by ER
binding, ChIP analysis was used to examine ER
-ERE association at the pS2 promoter in each cell line. In MCF-7 cells, ER
binding to the pS2 promoter is minimal under basal conditions (Fig. 2A
), but even in the absence of estrogen it was considerably higher in LCC1 cells (
8-fold). Importantly, in LCC9 cells there was little ER
, but a high level of pS2 expression, suggesting that in these very endocrine-resistant cells, there is no requirement of ER
for cofactor binding. These data are in agreement with our previously published observation, but novel associations with histone acetylation, cofactor binding, and gene expression are reported below (24).
|
2-fold) that is associated with maximal E2-induced pS2 gene expression observed in MCF-7 cells. Uninduced LCC9 cells display markedly enhanced H4 acetylation (>6-fold above MCF-7 levels) reflecting high basal expression within these cells. The considerable differences in histone acetylation on the pS2 promoter between the endocrine-resistant MCF-7 cells is probably due to a further misregulation of HATs or HDACs in LCC9 cells compared with LCC1 cells.
ER
cofactors are recruited to the ER
-transcription complex after ligand binding (9, 10). Many ER
cofactors have HAT or HDAC activity (5, 8). By Western analysis we examined the global expression levels of the p160 coactivators SRC-1, SRC-2, and AIB1 and the corepressors NCoR and SMRT in the MCF-7 cell lines (Fig. 2B
). We observed that progressive endocrine resistance is accompanied by alterations in cofactor levels such that expression of all cofactors examined decreased in the LCC9 cells.
Using ChIP we assessed whether the enhanced basal gene expression and increased histone acetylation in LCC1 and LCC9 cells is due to alterations in cofactor binding to the pS2 promoter. We found that E2-independent pS2 gene activation in LCC1 cells might be due to increased HAT activity via enhanced AIB1 binding, whereas in LCC9 cells the increased pS2 gene activation is unlikely to be caused by a high level of HAT activity because both SRC-1 and AIB1 levels at the pS2 promoter are no higher than those observed in MCF-7 cells (Fig. 2C
). However, ChIP analysis of H4 acetylation on the pS2 promoter after AIB1 short interfering RNA (siRNA) disproved this hypothesis (data not shown). Similarly enhanced pS2 gene activation could also be due to a loss of HDAC activity on the promoter as the level of SMRT associated with the pS2 promoter appears reduced in both LCC1 and LCC9 cells (Fig. 2D
). In an effort to determine the importance of the individual cofactors for basal pS2 expression, an RNAi approach was used (Fig. 3
). These data confirm that basal pS2 expression is enhanced after SMRT depletion (Fig. 3D
).
|
Recruitment
binding at the pS2 promoter may be associated with increased basal ER
protein expression (Fig. 2A
involvement in endocrine resistance, ChIP analysis was used to explore E2-induced ER
recruitment in all cell lines over a 90-min period. E2 treatment strongly induced cyclical ER
recruitment to the pS2 promoter in MCF-7 cells (Fig. 4A
recruitment was not observed at a distal pS2 region (Fig. 4B
|
recruitment to the pS2 promoter were observed by 15 min in all cell lines, with maximal levels observed at 50 min. ER
recruitment was significantly greater in MCF-7 cells than in their endocrine-resistant derivatives, suggesting that although the ER
protein is intact and that mechanisms of ER
recruitment are not altered in hormone resistance, dependency on ER
as a cofactor for pS2 expression is reduced. Although E2-induced ER
recruitment is associated with enhanced H4 acetylation in both MCF-7 and LCC1 cells, this requirement has been lost in LCC9 cells where H4 acetylation is consistently high (Fig. 4C
ER
Cofactor Recruitment Is Progressively Lost in Endocrine Resistance
High quality, cyclical gene transcription involves sequential recruitment of coactivators to the pS2 promoter (10). Because 15-min E2 exposure is sufficient to produce significant ER
recruitment in all three cell lines (Fig. 4A
), we examined cofactor levels on the pS2 promoter at this time point (Fig. 5A–D
). MCF-7 cells show E2-induced recruitment of SRC-1 and AIB1 to the pS2 promoter, whereas the corepressors NCoR and SMRT remain associated. LCC1 cells only show recruitment of AIB1 and have reduced association of NCoR and SMRT. In the fully estrogen-independent and tamoxifen-resistant LCC9 cells, AIB1 recruitment is reduced as compared with MCF-7 and LCC1 cells. Additionally, SRC-1 recruitment was not induced, and NCoR and SMRT levels were significantly decreased, thus showing the progressive loss of cofactor recruitment in hormone resistance.
|
independent in endocrine resistance (Fig. 2A
Estrogen-Insensitive LCC9 Cell Growth Is Cofactor Independent
We have shown that there is a progressive loss of cofactor requirement for expression of the estrogen-dependent gene pS2. To study the requirement of ER
cofactors in the E2 independent growth of each cell line, we ablated individual cofactors using RNAi. The efficiency and specificity of siRNA knockdown of target genes over 6 d was confirmed by Western analysis (Fig. 6A
). Basal MCF-7 and LCC1 cell growth is dependent on each cofactor examined (Fig. 6B
). In marked contrast, the E2-independent cell growth demonstrated by LCC9 cells is independent of all cofactors examined.
|
| DISCUSSION |
|---|
|
|
|---|
-Dependent Gene Expression
cofactor functions in ER
-mediated transcription and cell proliferation. These studies have identified p160 coactivators and the corepressors NCoR and SMRT as components of the ER
transcription complex assembled after ligand activation of ER
(9, 10, 25, 26). Indeed it has been reported that the recruitment by ER
of a p160 coactivator is sufficient for gene activation and to mediate estrogen-induced cell proliferation in breast cancer (9). The current view suggests that ligand-bound receptor exists in a dynamic equilibrium with coactivator and corepressor proteins to afford a regular and tightly controlled induction curve for nuclear receptor-mediated gene expression. However, the ultimate direction of the transcriptional response in a given cell and promoter context will be determined by the relative binding affinities and cellular distributions of these cofactors (27, 28, 29).
In this study we have identified altered cofactor binding and a progressive loss of cofactor recruitment in endocrine resistance in breast cancer. We have exploited a three-stage MCF-7-based cell line model wherein cofactor functions in parental MCF-7 cells were compared firstly to their E2-independent derivative LCC1 cells and secondly to the further derived fully endocrine-resistant LCC9 cells. We show that in the acquisition of endocrine resistance, both ER
-dependent pS2 gene expression and cell proliferation have become E2 independent. These changes are associated with altered cofactor binding to the promoter in the absence of ligand (Fig. 2
) suggesting that cofactors are a significant feature in the development of endocrine-resistant breast cancer. In support of this, data from several studies have shown that high levels of coactivator expression may enhance the agonist activity of tamoxifen, thus contributing to endocrine resistance (12, 13, 14, 15). Additionally, expression of dominant-negative NCoR in MCF-7 cells was found to both enhance the transcriptional activity of tamoxifen bound ER
and induce cell growth (28). In further studies MCF-7 cells were implanted into nude mice, which were then treated with tamoxifen. A decrease in tumor NCoR levels was associated with acquired resistance of these tumors to the antiproliferative effects of tamoxifen (19). These studies suggest the level of coactivator/corepressor ratio plays a key role in preventing breast tumor proliferation by tamoxifen and support this as a mechanism associated with endocrine resistance (15, 19, 28).
ER
Cofactor Requirement Is Progressively Lost in Endocrine Resistance
High quality, cyclical gene transcription involves sequential recruitment of cofactors to the pS2 promoter (9, 10). LCC9 cells, in the acquisition of endocrine resistance, have a global reduction in cofactor protein levels (Fig. 2B
). Although a reduction in corepressor proteins can be associated with endocrine resistance, coactivator expression is reported to increase (13, 14, 15, 19). Here we show that E2-induced pS2 transcription is associated with both progressive loss of cofactor recruitment and reduced dependency on individual cofactor expression in endocrine resistance. This change in cofactor regulation at the pS2 promoter may also describe why pS2 gene activation (as determined by H4 acetylation) is altered in LCC9 cells as compared with MCF-7 or LCC1 cells (Fig. 4C
). Additionally we show a global loss of individual cofactor requirements for proliferative cell growth in endocrine resistance. This suggests that in the acquisition of endocrine resistance, many other proliferative genes have also lost the requirement for transcriptional cofactors. Thus the reduction in global cofactor expression is perhaps unsurprising and could be explained by decreased requirement for cofactors producing a negative feedback on cofactor transcription. This reinforces the view that interplay between coactivators and corepressors is key to controlling gene regulation and that changes in this process are a conceivable mechanism for contributing to endocrine resistance in breast cancer.
Cofactor Regulation and Posttranslational Modifications
One mechanism that could account for this loss of cofactor recruitment to the pS2 promoter is reduced ER
activation through Ser118 phosphorylation (30). Indeed we have previously identified reduced basal Ser118 phosphorylation in both LCC1 and LCC9 cells, and estrogen-induced Ser118 phosphorylation was markedly reduced upon acquisition of endocrine resistance (24). In addition, recent studies have identified ER
cofactors as targets for posttranslational modification by diverse cellular signaling pathways (ERK, MAPK, p38) (25, 31, 32, 33). Phosphopeptide mapping experiments have revealed multiple phosphorylation sites within the p160 coactivator proteins (31, 32, 33). The fact that very few of these are conserved between p160s argues that this may represent an important determinant of functional specificity. Significantly, AIB1 phosphorylation has been shown to enhance its nuclear sublocalisation, ER
interaction, and have essential functions for ER
transactivation (33, 34, 35). In terms of endocrine resistance phospho AIB1 has been shown to be necessary for AIB1-induced tamoxifen agonist activity in breast cancer cells (36). Similarly, SMRT phosphorylation has been shown to inhibit the ability of this corepressor to mediate repression (25). Increased activity in MAPK signaling pathways has been implicated in endocrine-resistant breast cancer, thus loss of cofactor functions could be accounted for via altered MAPK signaling (37, 38).
In conclusion, we have demonstrated progressive loss of cofactor function (including regulation of growth) in progressively more estrogen-independent breast cancer cell lines. This loss of cofactor requirement may represent an important mechanism for gene misregulation in cancer and afford a suitable target to overcome endocrine resistance in the treatment of breast cancer.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Proliferation Assays
MCF-7 cells were seeded at a density of 2.5 x 104 cells per well in six-well plates, and 24 h later the cells were washed twice with PBS and the media changed to phenol-red-free DMEM with 5% DCC for 48 h. The cells were then treated with media containing 10–9 M E2 T and incubated for 6 d. LCC1 and LCC9 cells were seeded at a density of 2.5 x 104 cells per well in six-well plates in phenol-red-free containing DMEM with 5% DCC and after 24 h were treated with media supplemented with E2. Cells were incubated with the drugs for 6 d, and this medium was changed and replaced with fresh medium and drugs on d 3. Cell counts on d 0, 3, and 6 were estimated using a Coulter Counter (Beckman Coulter, Inc., Fullerton, CA).
RNA Preparation and Real-Time RT-PCR Analysis
RNA from MCF-7 and LCC cells was prepared using either Stratagenes Absolutely RNA miniprep kit (Stratagene, La Jolla, CA) or Tri-Reagent (Sigma) following manufacturers instructions. Quantification of the RNA was performed by spectrophotometry at 260 nm. RNA was analyzed by real-time RT-PCR using Rotorgene (Corbett Research, San Francisco, CA) and the QuantiTect SYBR Green system (QIAGEN, Chatsworth, CA) according to the manufacturers instructions. The thermal cycling conditions were RT: 50 C for 30 min; PCR: initial denaturation 95 C for 15 min; followed by 40 cycles of denaturation 94 C for 15 sec, annealing 57 C for 30 sec, extension 72 C for 30 sec; and a final extension of 72 C for 60 sec. The following primers were used: pS2: fwd TTGTGGTTTTCCTGGTGTCA and rev CCGAGCTCTGGGACTAATCA; ER
: fwd CCACCA ACCAGTGCACCATT, rev GTCTTTCCGTATCCCACCTTTC; AIB1: fwd CCCTTTTATCTACTCTGTCATC, rev CCAGATGTAGAGGAGGAGAC; SRC-2: fwd AGCCTGTGAGAGGGCTGTTA, rev AATGAGAGAGGGGAAGGGAA; SRC-1: fwd CATGCTTATGAGGCAGCAAA, rev ATTCCAGTGCCAAACTGTCC; NCoR: fwd AAAGTGTGGAGACCCAGGTG, rev ACCCTCACTTCAACGTCCAC; SMRT: fwd AAGTCCATCCTCACGTCCAC, rev AAGCACACTGGGTCTCTGCT; ß-actin: fwd CTACGTCGCCCTGGACTTCGAGC, rev GATGGAGCCGCCGATCCACACGG.
siRNA Transfections
MCF-7 cells were seeded at 0.5 x 106 cells per 75-cm2 flask in DMEM as above. Twenty-four hours later after two PBS washes, the medium was changed to phenol-red-free DMEM with 5% DCC for 48 h. LCC1 and LCC9 cells were seeded directly into phenol-red-free containing DMEM with 5% DCC for 24 h before transfection. Cells were transfected with siRNA for 4 h using Oligofectamine reagent (Invitrogen, Paisley, UK) after which time 10–9 M E2 was added if required for a further 48 h before RNA and protein extraction. siRNA sequences were: Negative siRNA: Upstate M-003401; AIB1: Qiagen 1024591; SRC-1: Qiagen 1024927; SRC-2: 5'AAGTCAGATGTATCCTCTACA; NCoR: 5'AAUGCUACUUCUCGAGGAAACA; SMRT: 5'AAGGGUAUCAUCACCGCUGUG. All siRNA were used at 100 nM.
Western Blot Analysis
Cells were washed twice with PBS and lysed in ice cold lysis buffer [50 mM Tris (pH 7.5), 5 mM EDTA (pH 8.5), 150 mM NaCl, 1% Triton X-100, aprotinin 10 µg/ml, and 1x protease inhibitor cocktail (Roche, Basel, Switzerland)] for 10 min, and the debris was cleared by centrifugation at 13,000 rpm for 6 min at 4 C. Protein lysates (25–100 µg) were resolved by 7–12% SDS-PAGE and electrophoretically transferred to Immobilon-P membranes. After transfer, membranes were blocked and probed with primary antibody overnight at 4 C. All blots were visualized with either BM chemiluminescence (Roche) or SuperSignal West Femto chemiluminescent substrate (Pierce, Rockford, IL) and Hyperfilm (Amersham Biosciences, Piscataway, NJ). Antibodies used were: ER
(F-10) (Santa Cruz Biotech SC-8002; Santa Cruz, CA), AIB1 (Affinity BioReagents, Inc., Golden, CO) (MA1-845), SRC-2 (BD Biosciences, Palo Alto, CA) (610984), SRC-1 (Upstate Biotechnology, Inc., Lake Placid, NY) (05-522) (this antibody recognizes both SRC-1 isoforms), NCoR (Upstate) (06-892), SMRT (Upstate) (06-891), and Actin (Calbiochem, La Jolla, CA) (CP01).
ChIP Assays
ChIP assays were performed as described (9). Cells were grown to 90% confluence in phenol-red-free DMEM with 5% DCC for at least 48 h. After treatment with 10–9 M E2 over a 90-min time course, cells were cross-linked with 1% formaldehyde at 37 C for 10 min. Unreacted formaldehyde was quenched by gentle agitation at room temperature for 10 min with 0.125 M glycine. Cells were then washed twice with ice-cold PBS, collected into PBS containing protease inhibitors and centrifuged for 4 min at 2000 rpm at 4 C. The pellets were resuspended in 100 µl of lysis buffer per 106 cells [1% sodium dodecyl sulfate (SDS), 10 mM EDTA, 50 mM Tris-HCl (pH 8.1), and 1x protease inhibitor cocktail], incubated on ice for 10 min, and sonicated for 12 x 20 sec at 2 amplitude microns (Soniprep 150; MSE, Sanyo Gallenkamp PLC, Loughborough, UK). After centrifugation for 15 min at 13,000 rpm and 4 C, supernatants were collected and resuspended in dilution buffer (0.01% SDS;1% Triton X-100; 1.2 mM EDTA; 16.7 mM Tris HCl, pH 8.1; 167 mM NaCl; and 1x protease inhibitor cocktail). Chromatin was precleared with 1 µg antirabbit or antimouse IgG; 2 µg sheared salmon sperm DNA, and protein-G-Agarose (50 µl of 50% slurry in dilution buffer) for 3 h at 4 C. Immunoprecipitation was performed overnight at 4 C with 2 µg sheared salmon sperm DNA, 50 µl protein-G-Agarose, and specific antibodies. Precipitates were washed sequentially for 5 min each at 4 C with TSE I (20 mM Tris, pH 8.1; 2 mM EDTA; 150 mM NaCl; 1% Triton X-100; and 0.1% SDS), TSE II (20 mM Tris, pH 8.1; 2 mM EDTA; 500 mM NaCl; 1% Triton X-100; and 0.1% SDS), and buffer III (10 mM Tris, pH 8.1; 0.25 M LiCl; 1 mM EDTA; 1% NP40; and 1% deoxycholate). Precipitates were then washed twice with TE buffer and the protein/DNA complexes were eluted twice with 0.1 M NaHCO3 in 1% SDS. Crosslinks were reversed by incubation at 65 C overnight. DNA fragments were purified using QIAquick Spin Kit columns (Qiagen) and amplified using the QuantiTect SYBR Green system (Qiagen). Thermal cycling conditions were: 95 C for 15 min followed by 45 cycles of 94 C for 15 sec, 55 C for 30 sec, 72 C for 30 sec, and a final extension of 72 C for 5 min. PCR primer sequences for the pS2 promoter were: fwd GACGGAATGGGCTTCATGAGC and rev CTGAGACAATAATCTCCACTG. PCR primer sequences for distal pS2 (
3 kb upstream of pS2 promoter) were: fwd CTTGCCTCTGCATTCTCTCC and rev GAGTTTGGCCTCCCACATTA.
ChIP Antibodies
H4 (Upstate, 06-866), ER
HC-20 (Santa Cruz, sc543), AIB-1 C-20 (Santa Cruz, sc7216), SRC-1 (Upstate, 05-522), NCoR (Santa Cruz, sc1609), and SMRT (Santa Cruz sc20778).
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Requests for reprints may also be sent to: Simon P. Langdon, Edinburgh Cancer Research Centre, University of Edinburgh, Crewe Road South, Edinburgh EH4 2XR, United Kingdom. E-mail: Simon.Langdon{at}ed.ac.uk.
This work was supported by Cancer Research UK.
Disclosure Statement: The authors have nothing to disclose.
First Published Online July 31, 2007
Abbreviations: ChIP, Chromatin immunoprecipitation; DCC, double charcoal stripped fetal calf serum; E2, estradiol; ER
, estrogen receptor-
; HAT, histone acetyltransferase; HDAC, histone deacetylase; LCC, Lombardi Cancer Centre; NCoR, nuclear receptor corepressor; RNAi, RNA interference; siRNA, short interfering RNA; SDS, sodium dodecyl sulfate; SMRT, silencing mediator for retinoic and thyroid hormone receptor.
Received for publication February 27, 2007. Accepted for publication July 25, 2007.
| REFERENCES |
|---|
|
|
|---|
M, Gannon F 2003 Estrogen receptor-
directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115:751–763[CrossRef][Medline]
transcriptional activity and MCF-7 proliferation. Mol Endocrinol 16:253–270
(ER
) espression and reduced ER
phosphorylation in breast cancer models. Endocrine Related Cancer 13:1121–1133
activation function-1 induces proliferation of breast cancer cells. J Biol Chem 278:26704–26714
: regulation by phosphorylation sites in the A/B region depends on other receptor domains. Mol Endocrinol 17:1296–1314
B kinase. Mol Cell Biol 22:3549–3561NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
A. Palijan, I. Fernandes, Y. Bastien, L. Tang, M. Verway, M. Kourelis, L. E. Tavera-Mendoza, Z. Li, V. Bourdeau, S. Mader, et al. Function of Histone Deacetylase 6 as a Cofactor of Nuclear Receptor Coregulator LCoR J. Biol. Chem., October 30, 2009; 284(44): 30264 - 30274. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Jin, R. J. van't Hof, O. M.E. Albagha, and S. H. Ralston Promoter and intron 1 polymorphisms of COL1A1 interact to regulate transcription and susceptibility to osteoporosis Hum. Mol. Genet., August 1, 2009; 18(15): 2729 - 2738. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Mao, N. M. Patterson, M. T. Cherian, I. O. Aninye, C. Zhang, J. B. Montoya, J. Cheng, K. S. Putt, P. J. Hergenrother, E. M. Wilson, et al. A New Small Molecule Inhibitor of Estrogen Receptor {alpha} Binding to Estrogen Response Elements Blocks Estrogen-dependent Growth of Cancer Cells J. Biol. Chem., May 9, 2008; 283(19): 12819 - 12830. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |