Molecular Endocrinology, doi:10.1210/me.2006-0557
Molecular Endocrinology 21 (11): 2738-2749
Copyright © 2007 by The Endocrine Society
Transcriptional Regulation of Pituitary POMC Is Conserved at the Vertebrate Extremes Despite Great Promoter Sequence Divergence
Viviana F. Bumaschny1,
Flávio S. J. de Souza1,
Rodrigo A. López Leal,
Andrea M. Santangelo,
Manfred Baetscher,
Diego H. Levi,
Malcolm J. Low and
Marcelo Rubinstein
Instituto de Investigaciones en Ingeniería Genética y Biología Molecular (V.F.B., F.S.J.d.S., A.M.S., D.H.L., M.R.), Consejo Nacional de Investigaciones Cientificas y Técnicas (CONICET), and Departamento de Fisiología, Biología Molecular y Celular (M.R.), Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Argentina; Centro de Estudios Científicos (R.A.L.L., M.R.), Valdivia, Chile; Harvard Stem Cell Institute and Department of Molecular and Cellular Biology (M.B.), Harvard University, Cambridge, Massachusetts 02138; and Center for the Study of Weight Regulation and Associated Disorders (M.J.L., M.R.) and Department of Behavioral Neuroscience and Vollum Institute (M.J.L.), Oregon Health & Science University, Portland, Oregon 97239
Address all correspondence and requests for reprints to: Marcelo Rubinstein, Ph.D., Instituto de Investigaciones en Ingenieria Genética y Biologia Molecular-Consejo Nacional de Investigaciones Cientificas y Técnicas, Vuelta de Obligado 2490, Buenos Aires, Argentina. E-mail: mrubins{at}dna.uba.ar.
 |
ABSTRACT
|
|---|
The stress response involves complex physiological mechanisms that maximize behavioral efficacy during attack or defense and is highly conserved in all vertebrates. Key mediators of the stress response are pituitary hormones encoded by the proopiomelanocortin gene (POMC). Despite conservation of physiological function and expression pattern of POMC in all vertebrates, phylogenetic footprinting analyses at the POMC locus across vertebrates failed to detect conserved noncoding sequences with potential regulatory function. To investigate whether ortholog POMC promoters from extremely distant vertebrates are functionally conserved, we used 5'-flanking sequences of the teleost fish Tetraodon nigroviridis POMC
gene to produce transgenic mice. Tetraodon POMC
promoter targeted reporter gene expression exclusively to mouse pituitary cells that normally express Pomc. Importantly, transgenic expression in mouse corticotrophs was increased after adrenalectomy. To understand how conservation of precise gene expression mechanisms coexists with great sequence divergence, we investigated whether very short elements are still conserved in all vertebrate POMC promoters. Multiple local sequence alignments that consider phylogenetic relationships of ortholog regions identified a unique 10-bp motif GTGCTAA(T/G)CC that is usually present in two copies in POMC 5'-flanking sequences of all vertebrates. Underlined nucleotides represent totally conserved sequences. Deletion of these paired motifs from Tetraodon POMC
promoter markedly reduced its transcriptional activity in a mouse corticotropic cell line and in pituitary POMC cells of transgenic mice. In mammals, the conserved motifs correspond to reported binding sites for pituitary-specific nuclear proteins that participate in POMC transcriptional regulation. Together, these results demonstrate that mechanisms that participate in pituitary-specific and hormonally regulated expression of POMC have been preserved since mammals and teleosts diverged from a common ancestor 450 million years ago despite great promoter sequence divergence.
 |
INTRODUCTION
|
|---|
THE PROOPIOMELANOCORTIN GENE (POMC) encodes a prohormone that gives rise to several bioactive peptides including ACTH, the melanocortins
-, ß-, and
-MSH, and the opioid peptide ß-endorphin. POMC is mainly transcribed in discrete populations of brain neurons and in the pituitary gland, where it is expressed in melanotrophs of the intermediate lobe and corticotrophs of the anterior lobe. ACTH is a principal component of the hypothalamic-pituitary-adrenal (HPA) axis that mediates the stress response in all vertebrates (1, 2, 3). Stress-induced release of the hypothalamic peptide CRH stimulates the release of ACTH from pituitary corticotrophs, which in turn promotes glucocorticoid release from the adrenal gland cortex. As part of a negative feedback loop, glucocorticoids decrease the expression of CRH in the hypothalamus and POMC in pituitary corticotrophs. The crucial importance of ACTH in the stress response can be appreciated in humans carrying mutations that inactivate the POMC gene, who die from adrenal insufficiency unless permanently supplemented with glucocorticoids (4, 5). Although POMC is expressed in the pituitary and brain of all species studied to date, several mutations that modify the peptide repertoire of the POMC prohormone have been selected and fixed in different vertebrate lineages. For example, POMC in rodents lacks a di-basic site necessary for a proteolytic cleavage that releases ß-MSH (6). In addition, POMC sequences that code for
-MSH were deleted from teleost fish genomes more than 320 million years ago (7, 8).
Transcriptional regulation of pituitary POMC has been investigated in several expression systems. Transgenic mouse studies revealed that 400 bp of the rat POMC proximal promoter direct pituitary cell-specific and hormonally regulated expression to corticotrophs and melanotrophs (9). In addition, extensive expression studies performed in the mouse corticotropic-derived cell line AtT20 led to the characterization of several cis-acting sequences that participate in the transcriptional control of pituitary POMC, including binding sites for the following transcription factors: paired-like homeodomain 1 (Pitx1), pituitary-restricted transcription factor (Tpit), Ikaros, neurogenic differentiation 1 (NeuroD1)/ß2, Nurr1/NR4A2 (nuclear receptor subfamily 4, group A, member 2), Nur77/NR4A1 (nuclear receptor subfamily 4, group A, member 1), signal transducer and activator of transcription 3 (STAT3), and glucocorticoid receptor (10, 11, 12, 13, 14, 15). More recently, 415 bp of the zebrafish proximal POMC promoter have also been shown to direct specific expression of a reporter gene to the pituitary of transgenic zebrafish (16).
Despite the similar expression patterns of POMC in all vertebrates (7), phylogenetic footprinting analyses at the POMC locus of most vertebrate classes failed to detect conserved sequences with potential regulatory function (17). This might be explained by pituitary POMC expression being controlled by different transcription factors in different vertebrate classes or, alternatively, because transcription factor binding sites in the ortholog POMC promoters are only marginally conserved at the nucleotide sequence. To investigate whether ortholog POMC promoters from extremely distant vertebrates are functionally conserved despite their high level of sequence divergence, we tested the ability of 5'-flanking sequences of the POMC
gene of the teleost fish Tetraodon nigroviridis to direct the expression of a reporter gene to POMC cells of transgenic mice. The Tetraodon genome has been sequenced and assembled (18), and it constitutes an advantageous fish model for promoter expression studies because it has one of the most compact vertebrate genomes. Here, we report that pituitary-specific and hormonally regulated expression of POMC has been preserved since mammals and teleost fishes diverged from a common ancestor almost half a billion years ago (19). By using a bioinformatic algorithm that takes into account phylogenetic relationships, we detected a conserved 10-bp relic that is present in POMC promoters of all vertebrate classes analyzed and proved to be essential for POMC promoter activity.
 |
RESULTS
|
|---|
Cell-Specific Expression of Pituitary POMC Is Conserved at the Vertebrate Extremes
To investigate whether the POMC promoter of a teleost fish is functionally conserved in a mammalian expression system, we sought to study the expression of Tetraodon POMC gene constructs in transgenic mice. Tetraodon, like other teleost fishes, has two ancient POMC paralogs, POMC
and -ß (8). We chose to study the expression of POMC
because it is the most similar to mammalian POMC at the sequence level and is strongly expressed in the pituitary gland (8). By screening a fosmid genomic Tetraodon DNA library, we isolated a 36-kb fragment that contains the complete POMC
transcriptional unit together with the 5' and 3' intergenic regions and portions of the upstream and downstream flanking genes. We used this genomic fragment to investigate the expression pattern of the entire unmodified Tetraodon POMC
locus in transgenic mice (transgene 1, Fig. 1
). In situ hybridization experiments using a highly specific and sensitive riboprobe against Tetraodon POMC
exon 2 (8) failed to detect transgene 1 expression in the pituitaries or brains of F1 transgenic mice of eight independently generated pedigrees. RT-PCR experiments performed on transgenic pituitaries, hypothalami, and various other tissues also failed to detect Tetraodon POMC
mRNA even using various combinations of primers (data not shown). Also, transgene 1 was transcriptionally silent in transient transfection experiments in the mouse corticotropic cell line AtT20, as tested by extensive RT-PCR analyses (data not shown). Because it has been reported that unmodified fish genomic transgenes may not be efficiently expressed or processed in mouse cells (20, 21), we decided to construct fusion transgenes. We first ligated a fragment containing the entire 5'-flanking region of Tetraodon POMC
, exon 1, and most of intron 1 to the minimal chicken ß-globin promoter fused to the reporter gene lacZ and generated transgenic mice (transgene 2; Fig. 1
). Analysis of F1 transgenic mice carrying transgene 2 showed ß-galactosidase expression in the intermediate and anterior lobes of the pituitary gland in two of five independently generated transgenic pedigrees (Fig. 2
). Double histochemistry in pituitary sections demonstrated colocalization of 5-bromo-4-chloro-3-indolyl ß-D-galactopyranoside (X-Gal) staining in pituitary cells labeled with an anti-ACTH antibody (Fig. 2
). Although not all ACTH-expressing cells stained with X-Gal, ß-galactosidase activity was observed only within POMC cells. These results demonstrate that the 5'-flanking region of Tetraodon POMC
contains cis-regulatory elements recognized by the transcription factor machinery that normally transactivates Pomc in mouse pituitary cells. Transgenic mice generated with a shorter fragment containing about 1 kb of Tetraodon POMC
5'-flanking DNA gave similar results but with no detectable corticotropic lacZ expression under basal conditions (transgene 3; Figs. 1
and 3
). None of the transgenic mice expressed transgenes 2 or 3 in the arcuate nucleus of the hypothalamus.

View larger version (121K):
[in this window]
[in a new window]
|
Fig. 2. Tetraodon POMC Promoter Drives ß-Galactosidase Expression to Pituitary Corticotrophs and Melanotrophs of Transgenic Mice
A, Coronal section of the pituitary of a newborn (postnatal d 1) mouse transgenic for transgene 2 showing expression of ß-galactosidase in corticotrophs of the anterior lobe (AL) and melanotrophs of the intermediate lobe (IL). NL, Neural lobe. B, Higher-magnification image showing colocalization of ß-galactosidase (X-Gal staining, blue dots) and ACTH immunostaining (diaminobenzidine, brown) in corticotrophs (arrows). Arrowheads show corticotrophs that do not express ß-galactosidase. C, Inset shows colocalization of ß-galactosidase (ß-gal, inclusion bodies) and ACTH in corticotroph perikarya.
|
|

View larger version (85K):
[in this window]
[in a new window]
|
Fig. 3. Mouse HPA Hormonal Changes Regulate Tetraodon POMC Promoter Activity
Bilateral adrenalectomy (ADX) performed in transgenic mice expressing construct 3 showed a robust increase in whole-mount X-Gal staining in pituitary anterior lobe (AL) in comparison with sham-operated siblings (control). No changes were observed in the intermediate lobe (IL). Left panels show insets of the pituitaries shown on the right. NL, Neural lobe.
|
|
Conservation of Hormonal Regulation of Pituitary POMC Expression between Fishes and Mice
Adrenal glucocorticoids normally exert a tonic inhibition on POMC expression in mouse corticotrophs, whereas hypothalamic CRH activates transcription of POMC in this cell type. Therefore, we investigated whether corticotropic transgenic expression driven by the Tetraodon POMC
promoter was responsive to changes in the concentration of hormones of the mouse HPA axis. We observed that removal of circulating glucocorticoids after bilateral adrenalectomy increased the transcriptional activity of the Tetraodon POMC
promoter in corticotrophs of transgenic mice (transgene 3) as evidenced by enhanced X-Gal staining in the pituitary anterior lobe (Fig. 3
). The increase in corticotropic expression was dramatic because ß-galactosidase-positive cells were undetectable in all of the anterior lobe sections obtained from three sham-operated transgenic mice, whereas three adrenalectomized transgenic mouse siblings showed a high, although variable, number of X-Gal-positive corticotrophs: 137.4 ± 28.6; 86.8 ± 31.2, and 79.2 ± 21.8 per 16-µm coronal pituitary section.
The effect of CRH on Tetraodon POMC
promoter activity was directly tested in the mouse corticotropic cell line AtT20 transiently transfected with transgene 3 and compared with the effect of CRH on the mouse Pomc promoter (transgene 6; Fig. 1
). CRH (10–7 M) increased lacZ activity driven by the Tetraodon or mouse POMC promoters to a similar extent (44 and 34%, respectively) in comparison with untreated controls (Fig. 4A
). Taken together, these results indicate that Tetraodon POMC
promoter activity in mouse corticotrophs is regulated by HPA hormonal changes. In contrast, the glucocorticoid receptor agonist dexamethasone failed to inhibit the activity of the Tetraodon POMC
promoter in AtT20 cells as it did acting on the mouse POMC proximal promoter (Fig. 4B
), suggesting that the mouse ligand-bound glucocorticoid receptor would not interact with Tetraodon POMC
promoter sequences. Lack of dexamethasone effect on Tetraodon POMC
promoter activity was confirmed in AtT20 cells transfected with transgene 2 (data not shown).
Phylogenetic Footprinting of the POMC Locus at the Vertebrate Extremes: Discovery of a Functional DNA Relic
The results shown above demonstrate that the transcription factor machinery present in mouse pituitary POMC cells specifically recognizes cis-acting elements present in the teleost fish Tetraodon nigroviridis POMC
promoter. The functional conservation of this cis-trans code for more than 450 million years of vertebrate evolution contrasts with the lack of overt sequence similarity between the mouse and Tetraodon POMC
5'-flanking regions (Fig. 5A
). The sequence comparison program PipMaker (22), which allows the global visualization of all local alignments, can detect sequence identity between Tetraodon and mammals only in POMC coding exon 3 (Fig. 5A
). To investigate the possibility that only very short functional sequences are conserved among all vertebrates, we used Footprinter 2.1, a bioinformatic program that performs multiple local sequence alignments, taking into account the phylogenetic relationships of the ortholog DNA fragments to be compared, and detects conserved motifs that are evolving more slowly than surrounding DNA sequences (23). By comparing around 700 bp of the POMC 5'-flanking sequences of representative species of most vertebrate classes, we were able to define comparison parameters that led to the identification of a short consensus sequence of 10 bp with an identical 4-bp core from human to fishes (Fig. 5
, B and C). All species except frogs have this element represented twice in their POMC promoter. In mammals, chicken, and zebrafish, these two motifs are separated by around 100 bp, whereas in the Tetraodontid fishes Tetraodon nigroviridis and Takifugu rubripes, they are next to each other sharing the consensus core sequence GCTAATC (Fig. 5
, B and C). We named these juxtaposed elements present in the Tetraodon POMC
promoter pituitary POMC conserved element (PPCE).

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 5. Phylogenetic Footprinting of Vertebrate POMC Loci and Identification of a Conserved 10-bp Motif
A, Percent identity plot using PipMaker for the Tetraodon POMC locus in comparison with its ortholog genes from Fugu, zebrafish, mouse, and human. Tetraodon POMC exons are depicted at the top. Coding sequences are depicted in blue and untranslated regions in orange. Note that Tetraodon and mammalian POMC show sequence identity only in exon 3. Tetraodon and Fugu POMC orthologs show a high level of identity across the entire locus. For all species, sequences include the POMC gene and approximately 1300 bp or approximately 600 bp of 5'- and 3'-flanking regions, respectively. Part of the upstream and downstream flanking genes (NOD/Caterpiller and KIAA0953, respectively) are denoted in green. Tetraodon sequence repeats were masked with the RepeatMasker program. B, Output of FootPrinter 2.1 program showing the location of the conserved sequences (red boxes) in various vertebrate POMC promoters. The conserved sequence present in Tetraodon (PPCE) is indicated. POMC transcriptional start sites are aligned (arrow). Phylogenetic relationships between the species are indicated at the right. Zebrafish, Fugu, and Tetraodon sequences correspond to the POMC paralogs. C, Sequence of the conserved motifs identified by Footprinter 2.1. Nucleotides conserved in all sequences are denoted in black, and those conserved in most sequences are denoted in gray. Nucleotide relative frequencies of the consensus GTGCTAA(T/G)CC are represented below the table. Tetraodon PPCE is formed by two juxtaposed conserved motifs (* and #).
|
|
To investigate whether PPCE plays a role in pituitary POMC expression, we performed transient transfection assays in AtT20 cells using a plasmid containing Tetraodon-POMC
promoter from which PPCE was deleted (Tetraodon-
PPCE; transgene 5 in Fig. 1
) in comparison with a control plasmid with an intact promoter (Tetraodon-WT; transgene 4 in Fig. 1
). Removal of PPCE decreased lacZ expression by 68% (Fig. 6A
). We also tested the importance of Tetraodon POMC
PPCE to drive lacZ expression to pituitary POMC cells by performing a transgenic mouse founder analysis of postnatal d 1 mice that developed from individual embryos microinjected with transgenes 4 and 5. The intact promoter was able to direct lacZ expression to melanotrophs and corticotrophs in five of seven independent transgenic founder mice, whereas removal of PPCE dramatically impaired transcriptional specificity and strength of the Tetraodon POMC
promoter (Fig. 6
, B and C). From 21 independently generated Tetraodon-
PPCE transgenic founder mice, only two showed X-Gal staining in just a few POMC cells, whereas the other 19 mice were completely devoid of pituitaty lacZ expression (Fig. 6
, B and C). From these latter 19 mice at least 10 showed ectopic lacZ expression in different brain areas, indicating that absence of pituitary expression was not due to insertion of the transgene in silent heterochromatin. Together, these results demonstrate that the 20-bp DNA element PPCE present in Tetraodontid POMC
promoters plays a critical role in the cis-trans code controlling pituitary POMC expression in transgenic mice.

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 6. PPCE Is Critical for Tetraodon POMC Promoter Activity
A, Deletion of PPCE (Tetraodon- PPCE, transgene 5) resulted in a 68% fall in ß-galactosidase activity in AtT20 cells relative to the intact promoter (Tetraodon-WT, transgene 4). ß-Galactosidase activity was measured with orthonitrophenyl 1-ß-D-galactopyranoside, and EGFP was used as transfection efficiency control. pTrap (empty vector) background expression was subtracted from both WT and PPCE activity. B, Coronal pituitary sections of newborn (postnatal d 1) Tetraodon-WT (left panels) or Tetraodon- PPCE (right panels) transgenic founder mice showing colocalization of ß-galactosidase (X-Gal staining, blue dots) and ACTH immunoreactivity (brown) in melanotrophs and corticotrophs (only visible at higher magnification). Objective magnifications: upper panels, x5; middle panels, x10; lower panels, x40. The dashed rectangles represent the magnified figures below. The inset in the left corner shows a corticotroph positively stained with X-Gal (x100). The arrows show some of the scarce X-Gal-positive melanotrophs in PPCE transgenic mice. C, Number of transgenic founders showing high expression (e.g. left panels of B), low expression (e.g. right panels of B), and nondetectable expression of lacZ in pituitaries of WT and PPCE mice.
|
|
Although critical for basal corticotropic expression, PPCE is dispensable for CRH stimulation of POMC expression because CRH (10–7 M) increased lacZ activity in AtT20 cells transfected with the wild-type or the PPCE mutant plasmid in a similar fashion (88 vs. 53%, respectively; Fig. 7A
).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 7. CRH, Pitx1, and Tpit Stimulation of Tetraodon POMC Promoter Activity Does Not Depend on PPCE
A, AtT20 cells were transfected with the empty vector pTrap, transgene 4 (Tetraodon-WT), transgene 5 (Tetraodon- PPCE), or transgene 6 (mouse POMC). Treatment with 10–7 M CRH increased the activity of Tetraodon POMC promoter independently of PPCE. B, CHO cells were transfected with the same reporter plasmids as in A together with a mouse Pitx1 expression vector (pcDNA3-Pitx1) or empty pcDNA3 as control. C, Similar experiment as in B, but cotransfection was performed with Tpit (pcDNA3-Tbx19). Data are expressed relative to PBS-treated (A) or pcDNA3 cotransfected (B and C) controls. Bars are the mean of three independent experiments performed in triplicates. Error bars represent SEM. *, P < 0.001; #, P < 0.01, calculated with Students t test.
|
|
In the human, mouse, rat, and chicken POMC promoters, the upstream conserved 10-bp relic is similar to a previously characterized element present in the rat POMC promoter that acts as a binding site for Pitx1 (10, 24). Because Pitx1 has been reported to stimulate rat POMC promoter activity, we investigated whether Pitx1 would also regulate Tetraodon POMC
promoter activity interacting with PPCE. To this end, we performed a functional expression study in heterologous Chinese hamster ovarian (CHO) cells transfected with either Tetraodon-WT (construct 4), Tetraodon-
PPCE (construct 5), or the mouse proximal Pomc promoter (construct 6). Cotransfection with a plasmid expressing mouse Pitx1 increased the activity of the wild-type and the mutated construct to a similar extent (Fig. 7B
), indicating that Pitx1 stimulation of Tetraodon POMC
is independent of PPCE and that this element might be specifically recognized by a still unknown transcription factor present in pituitary POMC cells.
Tpit is a T box transcription factor known to play an important role in pituitary POMC expression in humans and mice (13). To study whether Tpit also enhances Tetraodon POMC
promoter activity, we cotransfected CHO cells with the same reporter plasmids as in the previous experiment together with a plasmid expressing Tpit. Figure 7C
shows that Tpit was able to stimulate Tetraodon POMC in a similar fashion to the mouse ortholog and through a PPCE-independent mechanism.
Tetraodon PPCE Acts as a Transcriptional Enhancer in the Mouse Pomc Promoter
Because PPCE proved to be crucial for Tetraodon POMC
promoter activity, we then investigated whether this fish element would also act as a pituitary POMC cell enhancer when placed into the mouse Pomc promoter context. The mouse and rat POMC promoters have two discrete 10-bp motifs separated by approximately 100 nucleotides that are highly similar to PPCE sequences. Our laboratories previously identified the more proximal of these motifs [named putative pituitary POMC-1 (PP1)], relative to the TATAA box, and showed by a deletion analysis performed in transgenic mice that it plays an important pituitary enhancer role (9, 25). We therefore swapped PP1 from the mouse Pomc promoter with PPCE (transgene 7) or with a mutated PPCE sequence (transgene 8) and performed a second transgenic newborn mouse founder study. Consistent with our previously published studies based on the rat POMC promoter (9, 25), transgene 6 showed strong expression of ß-galactosidase in pituitary POMC cells (Fig. 8
, A and B). The exchange of PP1 for a mutated version of PPCE considerably diminished the transcriptional strength of the mouse Pomc promoter as evidenced by fewer and less intense X-Gal-stained pituitary POMC cells. In contrast, replacement of PP1 by intact fish PPCE restored, and even increased, Pomc-specific expression levels in pituitary melanotrophs and corticotrophs (Fig. 8
, A and B). Interestingly, the percentage of transgenic mouse founders expressing lacZ in POMC cells was also greatly improved in the presence of PPCE (Fig. 8B
). In general, an increased penetrance of transgene expression from multiple independent integration sites is highly suggestive of increased enhancer function overcoming negative position effects. The forceful evidence of this experimental sequence swap indicates that the conserved 10-bp element detected by Footprinter 2.1 in proximal POMC promoters is a functionally conserved relic that putatively controls pituitary POMC-specific expression in all vertebrate species.

View larger version (77K):
[in this window]
[in a new window]
|
Fig. 8. Tetraodon PPCE Enhances Mouse Pomc Promoter Activity in POMC Cells of Transgenic Mice
The PP1 binding site in the mouse Pomc promoter was deleted and replaced with either a wild-type Tetraodon PPCE or a mutated PPCE. A, Pituitary coronal sections of newborn (postnatal d1) founder mice carrying transgene 6 (WT, left panels), transgene 8 ( PP1/+MutPPCE, middle panels), or transgene 7 ( PP1/+PPCE, right panels) showing ß-galactosidase (X-Gal staining, blue dots) and ACTH immunoreactivity (brown). Objective magnifications: upper panels, x5; lower panels, x40. The dashed rectangles represent the magnified figures below. B, Number of transgenic mice showing high expression (e.g. left and right panels of A), low expression (e.g. middle panels of A), or nondetectable expression of reporter lacZ in pituitaries of WT, PP1/+MutPPCE, and PP1/+PPCE mice.
|
|
 |
DISCUSSION
|
|---|
The impending completion of several whole-genome projects has greatly stimulated comparative studies that attempt to understand how genomes were shaped by evolution. The theory elaborated by Kimura and Takahata (26) several decades ago establishing that the rate of molecular evolution is inversely related to the level of functional constraint can also be demonstrated now for noncoding sequences and, in particular, those that participate in transcriptional regulation (27). Although enhancers evolve more slowly than neighboring sequences, their identification by phylogenetic footprinting is not always applicable because transcription factor binding sites are short, accept a certain degree of degeneracy, and may disappear and be recreated in a different region at a relatively fast turnover rate (28, 29). In fact, absence of conservation in flanking sequences of ortholog mammalian and fish genes prevails (30). In this study, we sought to investigate whether the loss of overall sequence conservation between two ortholog promoters of extremely distant species modifies the molecular interaction between cis-acting elements and trans-acting factors. To this end, we generated transgenic mice in which lacZ pituitary expression was driven by the 5'-flanking sequence of the POMC
gene of the teleost fish Tetraodon nigroviridis. In Tetraodon, POMC
is expressed in the intermediate (pars intermedia) and anterior (pars distalis) lobes of the pituitary (8), a similar expression pattern to that of the mammalian POMC gene. Our results demonstrated that, in the absence of overt sequence similarity, mammalian and fish species share the cis-element information necessary for specific gene expression in pituitary melanotrophs and corticotrophs. Thus, the regulatory elements of POMC
that are functional in mammalian pituitary cells are probably also at work in the Tetraodon pituitary. These results are in line with a recent study showing that enhancers of the human RET locus, conserved only among mammals, drive specific transgene expression in zebrafish, even though there is no obvious sequence conservation between human and fish noncoding ortholog sequences (31). Taken together, we conclude that ortholog enhancers decrease their sequence conservation in direct relation to their evolutionary distance even when preserving their function. Exceptions to this rule are 100- to 500-bp ultraconserved enhancers particularly found in developmental genes (32).
As a vital part of the HPA axis, one of the critical properties of POMC promoter activity is that it is stimulated by CRH and inhibited by glucocorticoids. In our transgenic mice, glucocorticoid depletion induced by bilateral adrenalectomy strongly stimulated reporter gene activity driven by the Tetraodon POMC
promoter, suggesting that the molecular mechanisms that participate in glucocorticoid regulation of POMC expression are conserved at the vertebrate extremes. The increase in Tetraodon POMC
promoter activity observed in adrenalectomized mice could be due to the lack of direct glucocorticoid repression on the fish POMC promoter and/or increased stimulation of hypothalamic CRH release. Our experiments performed in the mouse corticotropic cell line AtT20 showed that CRH increased Tetraodon POMC
promoter activity, but dexamethasone did not reduce basal promoter activity as it did on the mouse ortholog promoter. Thus, although glucocorticoid-mediated repression of POMC transcription appears to be different between mammals and teleost fishes, the final regulatory effect of glucocorticoid depletion on corticotropic POMC promoter activity is conserved.
Altogether these observations raise a fundamental question in molecular evolution: how do preserved mechanisms of precise gene expression control coexist with an absence of sequence conservation? One possible explanation is that the conserved expression phenotype observed between the mouse and Tetraodon POMC promoters is the result of a stabilizing selection process, in which multiple near-neutral compensatory mutations occurred since the divergence from a common ancestor almost half a billion years ago. This type of mechanism has already been demonstrated at the molecular and functional level for two species of Drosophila whose most recent common ancestor diverged around 50 million years ago (33). A nonexclusive alternative explanation is that ortholog pituitary POMC enhancers evolved at a neutral rate except for a reduced number of very short sequences that maintained their efficacy to bind ortholog transcription factors to assure pituitary-specific POMC expression from mammals to fishes. In this study, we investigated the possibility that very short elements are conserved in POMC promoters from a wide spectrum of vertebrate species, including teleost fishes, amphibians, birds, and mammals. By using the program FootPrinter 2.1 (23), we identified a 10-bp conserved motif that is present twice in all ortholog POMC promoters except in Xenopus tropicalis, where it is present just once. In Tetraodon, both motifs are juxtaposed (PPCE), and when deleted, transcriptional activity of the Tetraodon POMC
promoter markedly decreased in both the mouse corticotropic cell line AtT20 and pituitary POMC cells of transgenic mice. Interestingly, the mammalian conserved motifs correspond to reported binding sites for pituitary-specific nuclear proteins. The upstream motif is recognized by Pitx1, a homeodomain transcription factor that is expressed during the development of the pituitary and participates in POMC expression (10, 24). However, deletion of PPCE did not modify the ability of Pitx1 to increase Tetraodon POMC
promoter activity. In addition, the downstream element recognized by the FootPrinter program in mammalian promoters is known to bind to a protein present in AtT20 nuclear extracts, and there is strong evidence that this element is necessary for rat POMC promoter activity in the pituitary of transgenic mice (9, 25). The putative transcription factor that binds to this element, dubbed PP1, has not yet been identified and might be a factor that regulates the expression of POMC in both teleosts and mammals. In fact, whereas swapping PP1 from the mouse promoter for a mutated version of fish PPCE impaired transcriptional activity of the chimeric promoter, its exchange for intact PPCE completely restored reporter gene activity in pituitary POMC cells of transgenic mice, demonstrating that the mouse and fish elements are functional analogs. Although the functional 10-bp relic was the only strongly conserved sequence found using this analysis, pituitary POMC expression in mammals is known to depend on the synergistic activity of several distinct binding sites and transcription factors (34). Comparisons between more closely related species might be necessary to identify additional functional elements. Tetraodon, similarly to all other teleost fishes, has two POMC paralogs that likely originated in the whole-genome duplication that occurred in a teleost ancestor around 320 million years ago (8). Expression of the Tetraodon POMC paralogs has diverged during evolution; POMC
is expressed strongly in the pituitary and in the ventral hypothalamus, whereas POMCß is expressed weakly in the pituitary and in the preoptic area in the brain. Consistent with the divergence of their expression patterns, the 5'-flanking region of teleost POMCß genes does not have the consensus short element present in teleost POMC
and the POMC promoter of all other vertebrates.
Even though the pituitary regulatory regions are functionally conserved between the POMC promoters of fishes and mammals, transgenic mice generated with the entire Tetraodon POMC
locus failed to express the transgene in the eight pedigrees analyzed. Although some tetraodontid genomic clones have been accurately expressed in transgenic mice (35), there are other examples in which they have failed to be properly expressed, probably due to a fish-mouse incompatibility on mRNA processing or minimal promoter recognition (20, 21). Our results provide a clear example that the study of teleost regulatory regions in mammalian expression systems can be maximized by using fusion transgenes containing heterologous minimal promoters and classical reporter genes such as lacZ.
In summary, we have found that pituitary cell-specific and hormonally regulated expression of POMC from a teleost fish is functionally conserved in mammalian expression systems despite great promoter sequence divergence. A bioinformatic analysis that takes into account the evolutionary distance of all compared species allowed the identification of a unique 10-bp motif that is conserved in all vertebrate classes and proved to be essential for pituitary POMC transcriptional regulation. Future experiments will be needed to determine whether transcription factors that control POMC expression in mammals also control the teleost orthologs, shedding light on the molecular evolution of the cis-trans transcriptional code of this essential gene.
 |
MATERIALS AND METHODS
|
|---|
Tetraodon Genomic Library Generation and Screening
A fosmid library was constructed with the genomic DNA of Tetraodon nigroviridis using the EpiFOS Fosmid Library Production Kit (Epicenter, Madison, WI). Using a 968-bp PCR product of the POMC
promoter (–1124/–157) as probe, we screened the genomic DNA library spotted onto nylon membranes and found two positive clones (044-N21 and 057-A19).
Transgenes and Plasmids
Transgenes were constructed using standard molecular cloning techniques, and sequence quality was assessed by automated PCR sequencing. To obtain transgene 1, a 3578-bp NarI/XhoI restriction fragment was isolated from the 044-N21 clone containing the complete POMC
locus and part of both 5'- and 3'-flanking genes and subcloned into pBluescript SK (+/–) (Stratagene, La Jolla, CA). To obtain transgene 2, transgene 1 was digested with HindIII, producing a fragment of 1723 bp (–1328/+395) that includes part of the upstream gene, the 5'-flanking region, the first noncoding exon, and part of the first intron of Tetraodon POMC
. This fragment was subcloned into the pTrap vector (36), upstream of the minimal promoter of the chicken ß-globin gene and the lacZ reporter gene. To obtain transgene 3, a 967-bp fragment of the 5'-flanking region of POMC
(–1124/–157) was PCR-amplified using Tetraodon genomic DNA and the primers 5'-GGGGTCGACNGGTTCTNCTTTGCCTTG-3' (SalI restriction site underlined) and 5'-GGGGGTACCTCATTCATGCTNGTAAACAC-3' (KpnI site underlined), and the PCR product was subcloned into the pTrap vector into the SalI/KpnI sites. Before microinjection, transgene 1 was digested with EcoRV and XhoI, and transgenes 2 and 3 were digested with NotI to discard vector sequences. Digested plasmids were size-fractionated on agarose gels and purified using Elutip columns (Schleicher and Schuell, Keene, NH).
To obtain transgene 5, a 20-bp sequence containing PPCE (TGGTGCTAATCCGGCTAATC) was deleted using a megaprimer PCR approach (37). Two external primers were used to amplify a 1064-bp fragment (–1193/–130) of Tetraodon POMC
5'-flanking region: primer 1, 5'-CCCGTCGACAGAACACAGGCTGGTTT-3' (SalI site underlined), and primer 2, 5'-CCCAAGCTTGTCACAGGTGATGTA-3' (HindIII site underlined). For the deletion of PPCE, two internal primers were designed, each containing both 5' and 3' PPCE flanking sequences: primer 1b, 5'-TGTCAGCGGGCAGGCCGCCATGGCGTCATG-3', and primer 2b, 5'-GCCATGGCGGCCTGCCCGCTGACATTTAG-3'. First, two parallel PCR were performed using primers 1/1b (5' fragment amplification) and 2/2b (3' fragment amplification) using transgene 1 as template. Both PCR products are complementary in the PPCE flanking regions and therefore were used as template and primers (megaprimers) for a second PCR, together with external primers 1 and 2. This second reaction generated a product lacking PPCE. To obtain the wild-type control (transgene 4), a PCR amplification was performed using primers 1 and 2. The final products were cut with SalI and HindIII and subcloned into the pTrap vector. To obtain transgene 6, a 472-bp fragment (–503 to –31) of the mouse Pomc promoter was amplified by PCR using the primers 5'-CCCGTCGACCCGTGACTCTTG-3' (SalI site underlined) and 5'-CCCAAGCTTCTTGCAGGGTTG-3' (HindIII site underlined). The product was subcloned into the SalI/HindIII sites of the pTrap vector. To construct transgenes 7 and 8, the PP1 site was replaced from transgene 6 by PPCE or by a mutated PPCE (TGGTGTCGGTCCGGTCGGTC, mutations underlined). The external primers for both constructs are 5'-CCCGTCGACCCGTGACTCTTGACAGCCTCTGTTGTT-3' (SalI site underlined) and 5'-CCCAAGCTTCTTGCAGGGTTGGGTGGGTGAGCCTTGG ACGTG-3' (HindIII site underlined). The internal primers to swap PPCE were 5'-GA-TTAGCCGGATTAGCACCACCCGCTGAAGCGCA-3' and 5'-TGGTGCTAATCCGGCTAATCGCCAGCCTCCGCGCTTT-3' (PPCE underlined). To swap the mutated PPCE, the internal primers were 5'-GACCGACCGGACCGACACCACCCGCTGAAGCGCA-3' and 5'-TGGTGTCGGTCCGGTCGGTCGCCAGCCTCCGCGCTTT-3' (mutated PPCE underlined). PCR products were subcloned into the SalI/HindIII sites of the pTrap vector. pcDNA3-Pitx1 and pcDNA3-Tbx19, expression plasmids for mouse Pitx1 and Tpit/Tbx19, respectively, were kindly provided by M. G. Rosenfeld (38).
Transgenic Mice and Adrenalectomy
Transgenic mice were generated by pronuclear microinjection of B6CBF2 or B6D2F2 zygotes as described previously (17, 39). Microinjected zygotes were transferred to the oviduct of B6CB pseudopregnant females. Transgenic pups were identified by tail genomic DNA PCR as described (17, 39) using the primer pair 5'-CGGTTCTGCTTTGCCTTG-3' and 5'-TCATTCATGCTTGTAAACAC-3', which amplifies the Tetraodon POMC
promoter. Bilateral adrenalectomy was performed as described previously (39), and mice were analyzed 4 d after adrenalectomy for X-Gal staining. Sham-operated control mice were subjected to the same surgery, but adrenal glands were left intact. Experimental protocols were consistent with the Guide for the Care and Use of Laboratory Animals and approved by the local institutional animal care and use committee.
Histochemistry
For X-Gal staining, adrenalectomized or sham-operated adult mice were deeply anesthetized and perfused with 4% paraformaldehyde (PFA) in KPBS (0.9% NaCl, 16 mM K2HPO4, 3.6 mM KH2PO4). Pituitaries were excised, postfixed in 4% PFA/KPBS for 15 min at room temperature, and incubated overnight with 1 mg/ml X-Gal (Invitrogen, Carlsbad, CA) in staining solution (137 mM NaCl; 2.7 mM KCl; 10 mM Na2HPO4; 2 mM KH2PO4; 2.12 mg/ml potassium ferrocyanide; 1.64 mg/ml potassium ferricyanide; 2 mM MgCl2; 0.01% sodium deoxycholate; and 0.02% Nonidet P-40, pH 7.5) at 37 C. The number of X-Gal-positive cells in the anterior lobe was quantified in seven to 12 coronal half-cryosections of 16 µm thickness (three mice per group). For ß-galactosidase and ACTH colocalization, postnatal d 1 transgenic mice carrying constructs 2, 4, 5, 6, 7, or 8 were decapitated, and skin-free heads were fixed with 4% PFA/KPBS for 1 h at 4 C and subjected overnight to whole-mount X-Gal staining. Stained heads were cryoprotected with 30% sucrose/KPBS and frozen in embedding medium (Tissue Tek; Electron Microscopy Sciences, Hatfield, PA). Serial coronal sections (20 µm) were cut using a cryostat microtome (IEC Microtome, Walldorf, Germany) at –20 C. Sections were thaw-mounted on Vectabond-coated (Vector Laboratories, Burlingame, CA) slides and stored at –70 C until use. X-Gal-stained slices were then subjected to anti-ACTH immunohistochemistry as described in de Souza et al. (17) except that the incubation with anti-ACTH antibody was conducted at 37 C for 4 h and slices were developed with 25 mg/ml diaminobenzidine (Sigma Chemical Co., St. Louis, MO) and 0.05% H2O2 in Tris-buffered saline (150 mM NaCl and 50 mM Tris-HCl, pH 7.5). The in situ hybridization of brains and pituitaries of transgene-1 mice was performed as described in de Souza et al. (17) with the probe for Tetraodon POMC
exon 2 described in de Souza et al. (8).
Cell Culture and Transient Transfection Assays
AtT20 and CHO cells were cultured in DMEM supplemented with 10% fetal calf serum. For dexamethasone treatment, charcoal-stripped fetal calf serum was used. For lipofection, 90% confluent attached cells were incubated with DNA and Lipofectamine 2000 (Invitrogen) as suggested by the manufacturer. For CRH and dexamethasone treatment, one well of a six-well dish was transfected with each plasmid. The next day, cells were passed to 96-well plates and incubated either with 10–7 M CRH (National Hormone and Pituitary Program, National Institutes of Health, Torrance, CA), 10–7 M dexamethasone (Decadron, Sidus, Argentina) or PBS for 24 h. CHO cells were transfected in 96-well plates with 130 ng/well of transgene 4 or 5 and 20 ng/well of pcDNA3-Pitx1, pcDNA3-Tbx19, or pcDNA3 (Invitrogen) as control. Fifteen nanograms of CMV-EGFP plasmid per well were used for transfection efficiency control. pcDNA3 was used to complete a total of 200 ng DNA/well. ß-Galactosidase activity was measured with orthonitrophenyl 1-ß-D-galactopyranoside (MP Biomedicals, Solon, OH) and normalized with protein (Bradford; Bio-Rad, Hercules, CA) or by counting EGFP-positive cells.
Sequences and Programs
POMC loci sequences from human (Homo sapiens), mouse (Mus musculus), rat (Rattus norvegicus), chicken (Gallus gallus), frog (Xenopus tropicalis), zebrafish (Danio rerio), Tetraodon (Tetraodon nigroviridis), and Fugu (Takifugu rubripes) were retrieved from the Ensembl website (www.ensembl.org). The 700-bp sequences of POMC promoters of the different vertebrate species were compared using the FootPrinter 2.1 program (23) available at http://bio.cs.washington.edu/software.html. We fixed parameters for searching 7-bp sequences conserved in all the species with a maximum of two mutations per sequence and one mutation per branch. Sequences of POMC loci of Tetraodon, Fugu, zebrafish, mouse, and human were compared using the PipMaker program (http://bio.cse.psu.edu/pipmaker) after masking the repeats with RepeatMasker program (http://www.repeatmasker.org/cgi-bin/WEBRepeatMasker). Nucleotide frequencies of the conserved elements were calculated using the WebLogo program available at http://weblogo.berkeley.edu/.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Martín Larosa, Micaela Ricca, Vanina Rodriguez, Marta Treimun, and Beatriz Wyss for excellent technical assistance and the Functional Genomics Unit of the Centro de Estudios Cientificos for microinjection of selected transgenes. We are grateful to M. G. Rosenfeld for kindly providing plasmids pcDNA3-Tbx19 and pcDNA3-Pitx1.
 |
FOOTNOTES
|
|---|
This work was supported by Fogarty International Research Collaborative Award TW01233 (M.J.L. and M.R.), National Institutes of Health Grant DK68400 (M.J.L. and M.R.), International Research Scholar Grant of the Howard Hughes Medical Institute (M.R.), Agencia Nacional de Promoción Científica y Tecnológica (M.R.), and Universidad de Buenos Aires (M.R.). V.F.B., F.S.J.S., and A.M.S. are recipients of fellowships from the Consejo Nacional de Investigaciones Cientificas y Técnicas-Argentina.
Disclosure Statement: The authors have nothing to disclose.
First Published Online August 14, 2007
1 V.F.B. and F.S.J.d.S. contributed equally. 
Abbreviations: CHO, Chinese hamster ovarian; HPA, hypothalamic-pituitary-adrenal; Nurr1/NR4A2, nuclear receptor subfamily 4, group A, member 2; Nurr77/NR4A1, nuclear receptor subfamily 4, group A, member 1; PFA, paraformaldehyde; Pitx1, paired-like homeodomain 1; POMC, proopiomelanocortin; PP1, putative pituitary POMC-1; PPCE, pituitary POMC conserved element; Tpit, pituitary-restricted transcription factor; X-Gal, 5-bromo-4-chloro-3-indolyl ß-D-galactopyranoside.
Received for publication December 28, 2006.
Accepted for publication August 7, 2007.
 |
REFERENCES
|
|---|
- Lovejoy DA, Balment RJ 1999 Evolution and physiology of the corticotropin-releasing factor (CRF) family of neuropeptides in vertebrates. Gen Comp Endocrinol 115:1–22[CrossRef][Medline]
- Carrasco GA, Van de Kar LD 2003 Neuroendocrine pharmacology of stress. Eur J Pharmacol 463:235–272[CrossRef][Medline]
- Flik G, Klaren PH, Van den Burg EH, Metz JR, Huising MO 2006 CRF and stress in fish. Gen Comp Endocrinol 146:36–44[CrossRef][Medline]
- Krude H, Biebermann H, Luck W, Horn R, Brabant G, Gruters A 1998 Severe early-onset obesity, adrenal insufficiency and red hair pigmentation caused by POMC mutations in humans. Nat Genet 19:155–157[CrossRef][Medline]
- Farooqi IS, Drop S, Clements A, Keogh JM, Biernacka J, Lowenbein S, Challis BG, ORahilly S 2006 Heterozygosity for a POMC-null mutation and increased obesity risk in humans. Diabetes 55:2549–2553[Abstract/Free Full Text]
- Bennett HP 1986 Biosynthetic fate of the amino-terminal fragment of pro-opiomelanocortin within the intermediate lobe of the mouse pituitary. Peptides 7:615–622[CrossRef][Medline]
- Dores RM, Lecaude S 2005 Trends in the evolution of the proopiomelanocortin gene. Gen Comp Endocrinol 142:81–93[CrossRef][Medline]
- de Souza FS, Bumaschny VF, Low MJ, Rubinstein M 2005 Subfunctionalization of expression and peptide domains following the ancient duplication of the proopiomelanocortin gene in teleost fishes. Mol Biol Evol 22:2417–2427[Abstract/Free Full Text]
- Liu B, Hammer GD, Rubinstein M, Mortrud M, Low MJ 1992 Identification of DNA elements cooperatively activating proopiomelanocortin gene expression in the pituitary glands of transgenic mice. Mol Cell Biol 12:3978–3990[Abstract/Free Full Text]
- Lamonerie T, Tremblay JJ, Lanctot C, Therrien M, Gauthier Y, Drouin J 1996 Ptx1, a bicoid-related homeo box transcription factor involved in transcription of the pro-opiomelanocortin gene. Genes Dev 10:1284–1295[Abstract/Free Full Text]
- Poulin G, Turgeon B, Drouin J 1997 NeuroD1/ß2 contributes to cell-specific transcription of the proopiomelanocortin gene. Mol Cell Biol 17:6673–6682[Abstract/Free Full Text]
- Drouin J, Maira M, Philips A 1998 Novel mechanism of action for Nur77 and antagonism by glucocorticoids: a convergent mechanism for CRH activation and glucocorticoid repression of POMC gene transcription. J Steroid Biochem Mol Biol 65:59–63[CrossRef][Medline]
- Lamolet B, Pulichino AM, Lamonerie T, Gauthier Y, Brue T, Enjalbert A, Drouin J 2001 A pituitary cell-restricted T box factor, Tpit, activates POMC transcription in cooperation with Pitx homeoproteins. Cell 104:849–859[CrossRef][Medline]
- Ezzat S, Mader R, Yu S, Ning T, Poussier P, Asa SL 2005 Ikaros integrates endocrine and immune system development. J Clin Invest 115:1021–1029[CrossRef][Medline]
- Mynard V, Guignat L, Devin-Leclerc J, Bertagna X, Catelli MG 2002 Different mechanisms for leukemia inhibitory factor-dependent activation of two proopiomelanocortin promoter regions. Endocrinology 143:3916–3924[Abstract/Free Full Text]
- Liu NA, Huang H, Yang Z, Herzog W, Hammerschmidt M, Lin S, Melmed S 2003 Pituitary corticotroph ontogeny and regulation in transgenic zebrafish. Mol Endocrinol 17:959–966[Abstract/Free Full Text]
- de Souza FS, Santangelo AM, Bumaschny V, Avale ME, Smart JL, Low MJ, Rubinstein M 2005 Identification of neuronal enhancers of the proopiomelanocortin gene by transgenic mouse analysis and phylogenetic footprinting. Mol Cell Biol 25:3076–3086[Abstract/Free Full Text]
- Jaillon O, Aury JM, Brunet F, Petit JL, Stange-Thomann N, Mauceli E, Bouneau L, Fischer C, Ozouf-Costaz C, Bernot A, Nicaud S, Jaffe D, Fisher S, Lutfalla G, Dossat C, Segurens B, Dasilva C, Salanoubat M, Levy M, Boudet N, Castellano S, Anthouard V, Jubin C, Castelli V, Katinka M, Vacherie B, Biemont C, Skalli Z, Cattolico L, Poulain J, De Berardinis V, Cruaud C, Duprat S, Brottier P, Coutanceau JP, Gouzy J, Parra G, Lardier G, Chapple C, McKernan KJ, McEwan P, Bosak S, Kellis M, Volff JN, Guigo R, Zody MC, Mesirov J, Lindblad-Toh K, Birren B, Nusbaum C, Kahn D, Robinson-Rechavi M, Laudet V, Schachter V, Quetier F, Saurin W, Scarpelli C, Wincker P, Lander ES, Weissenbach J, Roest Crollius H 2004 Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype. Nature 431:946–957[CrossRef][Medline]
- Kumar S, Hedges SB 1998 A molecular timescale for vertebrate evolution. Nature 392:917–920[CrossRef]
- Sathasivam K, Baxendale S, Mangiarini L, Bertaux F, Hetherington C, Kanazawa I, Lehrach H, Bates GP 1997 Aberrant processing of the Fugu HD (FrHD) mRNA in mouse cells and in transgenic mice. Hum Mol Genet 6:2141–2149[Abstract/Free Full Text]
- Miles CG, Rankin L, Smith SI, Niksic M, Elgar G, Hastie ND 2003 Faithful expression of a tagged Fugu WT1 protein from a genomic transgene in zebrafish: efficient splicing of pufferfish genes in zebrafish but not mice. Nucleic Acids Res 31:2795–2802[Abstract/Free Full Text]
- Schwartz S, Zhang Z, Frazer KA, Smit A, Riemer C, Bouck J, Gibbs R, Hardison R, Miller W 2000 PipMaker: a web server for aligning two genomic DNA sequences. Genome Res 10:577–586[Abstract/Free Full Text]
- Blanchette M, Tompa M 2003 FootPrinter: a program designed for phylogenetic footprinting. Nucleic Acids Res 31:3840–3842[Abstract/Free Full Text]
- Szeto DP, Ryan AK, OConnell SM, Rosenfeld MG 1996 P-OTX: a PIT-1-interacting homeodomain factor expressed during anterior pituitary gland development. Proc Natl Acad Sci USA 93:7706–7710[Abstract/Free Full Text]
- Liu B, Mortrud M, Low MJ 1995 DNA elements with AT-rich core sequences direct pituitary cell-specific expression of the pro-opiomelanocortin gene in transgenic mice. Biochem J 312(Pt 3):827–832
- Kimura M, Takahata N 1983 Selective constraint in protein polymorphism: study of the effectively neutral mutation model by using an improved pseudosampling method. Proc Natl Acad Sci USA 80:1048–1052[Abstract/Free Full Text]
- Loots GG, Locksley RM, Blankespoor CM, Wang ZE, Miller W, Rubin EM, Frazer KA 2000 Identification of a coordinate regulator of interleukins 4, 13, and 5 by cross-species sequence comparisons. Science 288:136–140[Abstract/Free Full Text]
- Dermitzakis ET, Clark AG 2002 Evolution of transcription factor binding sites in mammalian gene regulatory regions: conservation and turnover. Mol Biol Evol 19:1114–1121[Abstract/Free Full Text]
- Wasserman WW, Sandelin A 2004 Applied bioinformatics for the identification of regulatory elements. Nat Rev Genet 5:276–287[CrossRef][Medline]
- Plessy C, Dickmeis T, Chalmel F, Strahle U 2005 Enhancer sequence conservation between vertebrates is favoured in developmental regulator genes. Trends Genet 21:207–210[CrossRef][Medline]
- Fisher S, Grice EA, Vinton RM, Bessling SL, McCallion AS 2006 Conservation of RET regulatory function from human to zebrafish without sequence similarity. Science 312:276–279[Abstract/Free Full Text]
- Boffelli D, Nobrega MA, Rubin EM 2004 Comparative genomics at the vertebrate extremes. Nat Rev Genet 5:456–465[CrossRef][Medline]
- Ludwig MZ, Bergman C, Patel NH, Kreitman M 2000 Evidence for stabilizing selection in a eukaryotic enhancer element. Nature 403:564–567[CrossRef][Medline]
- Therrien M, Drouin J 1991 Pituitary pro-opiomelanocortin gene expression requires synergistic interactions of several regulatory elements. Mol Cell Biol 11:3492–3503[Abstract/Free Full Text]
- Gilligan P, Brenner S, Venkatesh B 2003 Neurone-specific expression and regulation of the pufferfish isotocin and vasotocin genes in transgenic mice. J Neuroendocrinol 15:1027–1036[CrossRef][Medline]
- Pfeffer PL, Bouchard M, Busslinger M 2000 Pax2 and homeodomain proteins cooperatively regulate a 435 bp enhancer of the mouse Pax5 gene at the midbrain-hindbrain boundary. Development 127:1017–1028[Abstract]
- Datta AK 1995 Efficient amplification using megaprimer by asymmetric polymerase chain reaction. Nucleic Acids Res 23:4530–4531[Free Full Text]
- Liu J, Lin C, Gleiberman A, Ohgi KA, Herman T, Huang HP, Tsai MJ, Rosenfeld MG 2001 Tbx19, a tissue-selective regulator of POMC gene expression. Proc Natl Acad Sci USA 98:8674–8679[Abstract/Free Full Text]
- Young JI, Otero V, Cerdan MG, Falzone TL, Chan EC, Low MJ, Rubinstein M 1998 Authentic cell-specific and developmentally regulated expression of pro-opiomelanocortin genomic fragments in hypothalamic and hindbrain neurons of transgenic mice. J Neurosci 18:6631–6640[Abstract/Free Full Text]