help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2007-0028
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuoka, T.-a.
Right arrow Articles by Yamasaki, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuoka, T.-a.
Right arrow Articles by Yamasaki, Y.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Molecular Endocrinology 21 (11): 2764-2774
Copyright © 2007 by The Endocrine Society

MafA Regulates Expression of Genes Important to Islet ß-Cell Function

Taka-aki Matsuoka, Hideaki Kaneto, Roland Stein, Takeshi Miyatsuka, Dan Kawamori, Eva Henderson, Itaru Kojima, Munehide Matsuhisa, Masatsugu Hori and Yoshimitsu Yamasaki

Department of Internal Medicine and Therapeutics (T.Ma., H.K., T.Mi., D.K., M.M., M.H., Y.Y.), Osaka University Graduate School of Medicine, Suita 565-0871, Japan; Department of Molecular Physiology and Biophysics (R.S., E.H.), Vanderbilt University School of Medicine, Nashville, Tennessee 37232; and Institute for Molecular and Cellular Regulation (I.K.), Gunma University, Maebashi 371-8512, Japan

Address all correspondence and requests for reprints to: Taka-aki Matsuoka, Department of Internal Medicine and Therapeutics, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita 565-0871 Japan. E-mail: takaaki{at}medone.med.osaka-u.ac.jp.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Insulin transcription factor MafA is unique in being exclusively expressed at the secondary and principal phase of insulin-expressing cell production during pancreas organogenesis and is the only transcriptional activator present exclusively in islet ß-cells. Here we show that ectopic expression of MafA is sufficient to induce a small amount of endogenous insulin expression in a variety of non-ß-cell lines. Insulin mRNA and protein expression was induced to a much higher level when MafA was provided with two other key insulin activators, pancreatic and duodenal homeobox (PDX-1) and BETA2. Potentiation by PDX-1 and BETA2 was entirely dependent upon MafA, and MafA binding to the insulin enhancer region was increased by PDX-1 and BETA2. Treatment with activin A and hepatocyte growth factor induced even larger amounts of insulin in AR42J pancreatic acinar cells, compared with other non-ß endodermal cells. The combination of PDX-1, BETA2, and MafA also induced the expression of other important regulators of islet ß-cell activity. These results support a critical role of MafA in islet ß-cell function.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PANCREATIC ISLET ß-cell-specific expression of the insulin gene is principally regulated by the actions of distinct islet-enriched transcription factors on the conserved A3 (–201/–196 bp), C1 (–118/–107 bp), and E1 (–100/–91 bp) elements of the enhancer region, which is found between –340 and –91 bbp relative to the transcription start site. Thus, the islet ß- and {delta}-cell-enriched pancreatic and duodenal homeobox-1 (PDX-1) homeodomain protein (formerly known as IPF-1, STF-1, and IDX-1) (1, 2, 3) controls A3 element activation (3, 4, 5, 6), whereas a heterodimer composed of islet cell-enriched BETA2 (7) and the generally distributed Hela E-box-binding factor (8) or E2A (9, 10, 11, 12) basic helix-loop-helix protein stimulates through an E1 element. These transcription factors also control expression of other gene products associated with ß-cell identity, including glucokinase (13, 14), islet amyloid polypeptide (15, 16, 17, 18), and glucose transporter type 2 (GLUT2) (19). Significantly, dysfunctional mutations in PDX-1 (20) and BETA2 (21) contribute to the development of diabetes in humans, presumably due in part to reduced expression of target genes required for glucose sensing. In addition, each of these factors plays a critical role in islet cell development during embryogenesis (22). Collectively, the data strongly suggest that PDX-1 and BETA2 are necessary for the formation and maintenance of physiologically functional islet ß-cells.

In contrast to PDX-1 and BETA2, ß-cell development does not appear to be affected in mice deficient for the basic leucine-zipper-containing MafA, an activator of insulin C1, although adult mutant animals are glucose intolerant due to diminished insulin transcription and impaired glucose-stimulated insulin secretion (23). The unimportance of MafA in ß-cell development is surprising, because this factor is produced only in insulin-producing cells of the second and principal phase of ß-cell production during embryogenesis in mice (24). Significantly, the expression pattern of MafA is unique, because no other transcription factor is expressed this late in islet cell development or in such a restricted fashion. For example, closely related MafB is detected in both first- and second-wave insulin-positive and glucagon-positive (i.e. islet {alpha}-cell) cells during pancreas organogenesis (25), whereas PDX-1 (26) and BETA2 (26) are found widely in pancreatic acinar/islet and islet progenitors, respectively. Because both MafA and MafB are coexpressed in developing ß-cells and capable of activating insulin expression (25, 27), MafB may be compensating for the loss of MafA in null mice. Collectively, these findings indicate that MafA and/or MafB is normally critical to the assembly of the insulin transcription unit in developing ß-cells, a proposal consistent with insulin expression being induced by MafA alone in a stably expressing islet {alpha}-cell line (i.e. {alpha}TC-6) (24) and suppressed insulin expression accompanied by reduction of endogenous MafA expression under hyperglycemic (28, 29) or reduced insulin signaling (30) conditions.

In this study, we show that adenoviral MafA overexpression is independently capable of activating endogenous insulin mRNA synthesis in several distinct non-ß-cell lines ({alpha}TC6, AR42J, and IEC-6). In addition, coexpression of PDX-1 and BETA2 was found to greatly enhance MafA-mediated activation, especially in AR42J cells. The combination of MafA, PDX-1, and BETA2 in AR42J and IEC-6 cells also stimulated the expression of other important ß-cell regulators [e.g. GLUT2 and prohormone convertase 2 (PC2)], with activation in AR42J cells entirely dependent upon the presence of growth factors critical to islet cell differentiation. Our studies show that a combination of islet-enriched transcription factors and signaling mediators is capable of producing high-level insulin-expressing ß-like cells from non-insulin-producing cells in vitro.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
MafA Induces Insulin and Other ß-Cell-Enriched Factors in Many Non-ß-Cell Lines
Stable expression of MafA selectively induced low-level insulin expression in {alpha}TC-6 cells (27). To more broadly evaluate the ability of this factor to initiate the insulin transcriptional program, adenoviruses expressing MafA, PDX-1, and BETA2 (Ad-MafA, Ad-PDX-1, and Ad-BETA2, respectively) were generated. Western blotting of nuclear extracts prepared from each adenovirus-infected cell confirmed that the appropriate sized product was produced by each adenovirus, which was approximately 2- to 7-fold higher than that in the MIN6 ß-cell line (Fig. 1AGo). The expression level was almost the same between the cell lines used (data not shown).


Figure 1
View larger version (26K):
[in this window]
[in a new window]

 
Fig. 1. Adenoviral MafA Expression Induces ß-Cell Products in a Variety of Non-ß-Cell Lines

A, IEC6 cells were infected with Ad-MafA, Ad-PDX-1, Ad-BETA2, or control Ad-GFP for 48 h. Nuclear protein was then isolated and Western blotting performed with {alpha}-MafA, {alpha}-PDX-1, or {alpha}-BETA2 antiserum. The same amount of MIN6 nuclear extract was used as a positive control. The relative amount of each factor to MIN6 cells is represented below the panel. B, Total RNA was isolated 3 d after Ad-MafA (MafA) or Ad-GFP (–) infection. Activin A and HGF were added in the medium for AR42J. RT-PCR was performed using mouse insulin 2 (lanes 1–3), rat insulin 2 (lanes 4–8), and human insulin specific primer sets (lanes 9–11). The signals from mouse islet (i.e. for {alpha}TC-6), rat islet (AR42J and IEC), and human islet (HepG2) served as species positive controls. Total RNA from IEC6 (C) or AR42J (D) cells was isolated 3 d after infection of Ad-MafA, -PDX-1, and/or -BETA2, and RT-PCR analysis was performed to examine expression of the specified genes. Note that an RT-PCR signal was not detected without the addition of reverse transcription or RNA. The RINm5F signal served as the positive control. The number of PCR cycles was 30 unless indicated as 25 cycles, which was decreased to semiquantitate the amount of mRNA.

 
Total RNA was isolated, and RT-PCR was performed to first determine whether rat insulin 1 and/or 2 mRNA expression is affected by infection with MafA vs. control GFP-expressing adenovirus (Ad-GFP) (rodents have two nonallelic insulin genes, which are regulated by similar, but not identical, enhancer control sequences) (31, 32, 33, 34). Insulin 2 gene expression was induced by MafA in {alpha}TC6 (i.e. islet {alpha}-like), AR42J (pancreatic acinar), and IEC-6 (intestinal epithelial) cells, but not in HepG2 (hepatic) cells (Fig. 1BGo). In contrast, insulin 1 expression was not detected clearly under these conditions (Fig. 1DGo), which may reflect the relatively weak MafA/C1 binding site within this gene (35). The insulin 2 RNA product was also correctly spliced in {alpha}TC6, AR42J, and IEC-6 cells, as judged by the size of the PCR product generated with the intron-spanning primers and by direct DNA sequencing. These results suggest that MafA is able to induce insulin 2 mRNA expression in many, but not all, endoderm-derived cell lines, although the produced amount varied considerably among cell lines infected with Ad-MafA.

Ad-MafA, -PDX-1, and -BETA2 were next used in IEC-6 and AR42J cells to examine their effects on the endogenous expression of other gene products associated with ß-cell identity, specifically GLUT2, ß-cell type glucokinase, ATP-sensitive inward rectifier potassium channel (Kir6.2), sulfonylurea receptor 1 (SUR1), and PC2. An insulin 2, GLUT2, and PC2 mRNA signal was clearly detected upon infection with Ad-MafA alone in IEC-6 cells, but only insulin 2 was activated clearly in AR42J cells (Fig. 1Go, C and D). Significantly, GLUT2 and PC2 expression was induced in AR42J cells when MafA was added in combination with BETA2 and/or PDX-1 (Fig. 1Go, C and D). However, these ß-cell-enriched products were induced in AR42J cells only in the presence of both activin A and hepatocyte growth factor (HGF) (Fig. 1DGo), growth factors involved in ß-cell differentiation (36). Interestingly, insulin 1 expression was detected in both IEC-6 and AR42J cells when MafA was coexpressed with PDX-1 and BETA2 (Fig. 1Go, C and D). Real-time PCR was performed to precisely quantify the induced amount of each ß-cell product in AR42J and IEC6 cells (Fig. 2Go). It was found that most of evaluated factors, with the exception of Kir6.2, were increased by the combination of MafA, PDX-1, and BETA2 and that the amount of insulin produced in AR42J cells was comparable to rat insulinoma cells, RINm5F. These results demonstrate that MafA, PDX-1, and BETA2 act together to activate endogenous transcription of a subset of key ß-cell genes such as insulin, GLUT2, and PC2 in a variety of distinct endodermally derived cell lines.


Figure 2
View larger version (19K):
[in this window]
[in a new window]

 
Fig. 2. Quantification of Induced ß-Cell Products in Non-ß-Cell Lines by MafA, PDX-1, and BETA2 Overexpression

Using the prepared RNA in the same way as Fig. 1Go with or without activin A and HGF, real-time PCR analysis was performed to precisely quantify and compare the amount of mRNA of insulin 1 (A), insulin 2 (B), GLUT2 (C), glucokinase (D), Kir6.2 (E), SUR1 (F), PC2 (G), and control ß-actin in AR42J, IEC6, and positive control cells such as rat islet and RINm5F cells. Each mRNA level was normalized with ß-actin level and is presented as relative amounts ± SD after Ad-GFP-infected control IEC6 being arbitrarily set at 1.0 (n = 4).

 
GLUT2 Appears to Be Regulated by MafA in Islet ß-Cells
To determine whether MafA regulates GLUT2 and PC2 transcription, MIN6 ß-cells were infected with adenoviruses producing small interference (si)RNAs to MafA (i.e. +66/+84 and +82/+102 bp) (37). As expected, the MafA level was profoundly reduced upon infection with both the +66/+84 and +82/+102 viruses (i.e. 30.4% of control Ad-GFP), and it was less affected with either +66/+84 (65.9%) or +82/+102 (37.8%) alone (Fig. 3AGo). GLUT2 mRNA was reduced upon reduction of MafA (Fig. 3BGo), whereas PC2 expression was unaffected (Fig. 3CGo). As expected, insulin 1 and 2 were also significantly suppressed by the MafA +66/+84 and +82/+102 siRNAs (37) (Fig. 3Go, D and E). These results indicate that MafA is a bona fide regulator of insulin and GLUT2 transcription in ß-cells.


Figure 3
View larger version (19K):
[in this window]
[in a new window]

 
Fig. 3. Suppression of MafA Reduces GLUT2 and Insulin Expression

A, MIN6 nuclear extracts were prepared after Ad-siMafA, Ad-GFP, or Ad-scramble infection and Western blotted with MafA antibody. The relative amount of MafA protein is indicated as mean ± SD, with the amount after treatment with Ad-GFP being arbitrarily set at 100% (n = 4). Real-time RT-PCR analysis was performed to detect GLUT2 (B), PC2 (C), insulin 1 (D), insulin 2 (E), and control ß-actin levels using total RNA. GLUT2, PC2, insulin 1, and insulin 2 mRNA levels were normalized with ß-actin level and are presented as relative amounts ± SD with the ratio of each mRNA level after Ad-GFP treatment being arbitrarily set at 1.0 (n = 4). *, P < 0.05; **, P < 0.01 vs. control Ad-GFP.

 
PDX-1 and BETA2 Potentiate MafA Binding to the Insulin Enhancer Region
In IEC6 and AR42J cells, the presence of PDX-1 and BETA2 enhanced MafA-mediated activation of –238 Luc, a rat insulin 2-luciferase (Luc) reporter activity driven by enhancer/promoter sequences spanning –238 to +2 bp (Fig. 4Go, A and B). However, activation of transiently transfected –238 Luc was independent of activin A and HGF treatment (Fig. 4BGo), in contrast to transcription of the chromosomal insulin genes (Fig. 1DGo, and see below). Chromatin immunoprecipitation analysis was next performed over the enhancer region with MafA and PDX-1 antibodies in AR42J cells to examine factor binding within the insulin control region. The level of precipitated DNA products was determined by real-time PCR analysis; Western blotting showed that a similar amount of PDX-1 and MafA protein was observed between samples (data not shown). The insulin enhancer region was selectively pulled down in Ad-MafA-infected cells (Fig. 4CGo), although the amount of {alpha}-MafA precipitation was enhanced by PDX-1 and BETA2, with PDX-1 being most effective. In contrast, the insulin enhancer signal detected upon {alpha}-PDX-1 precipitation was insensitive to MafA and/or BETA2 (Fig. 4DGo). These results suggest that PDX-1 and BETA2 potentiate MafA binding to the insulin enhancer region. Strikingly, PDX-1 and MafA binding occurs in the absence (or the presence of a low level) of insulin transcription, as concluded from the very similar binding pattern observed with and without activin A and HGF treatment (Figs. 1DGo and 4CGo). Collectively, these results imply that activin A and HGF impact insulin transcription by recruiting factors important to MafA, PDX-1, and/or BETA2 activation on the chromatin.


Figure 4
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 4. PDX-1 and BETA2 Enhance MafA Activity through Their Binding to the Insulin Enhancer Region in AR42J Cells

The rat insulin 2 (–238 to +2 bp)-driven firefly luciferase expression plasmid (–238 insulin Luc) was transiently cotransfected with MafA, PDX-1, and/or BETA2 expression plasmids into IEC6 (A) or AR42J (B) cells. The firefly Luc activity from –238 insulin Luc was normalized with the cotransfected phRL-TK renilla luciferase signal. The relative –238 insulin Luc activity was calculated as the ratio of Luc activity after MafA, PDX-1, and/or BETA2/pcDNA3.1 transfection to that after control pcDNA3.1 transfection. Experiments were performed at least four times and the relative values are expressed as means ± SD. The cross-linked DNA from Ad-GFP-, Ad-MafA-, Ad-PDX-1-, and/or Ad-BETA2-infected AR42J cells was sonicated, and the DNA-protein complexes were immunoprecipitated with {alpha}-MafA (C) or {alpha}-PDX (D). Top panel, The total (lane 1) and precipitated DNA (lanes 2–11) were analyzed by PCR using rat insulin (–263/–53 bp) enhancer region primers. The no-DNA template control is also shown (lane 12). Middle panel, Real-time PCR was performed to determine the relative amount of MafA binding to the insulin enhancer region under each condition. The results are presented as relative values to that after Ad-GFP treatment without activin A or HGF. Data are presented as means ± SD of four independent experiments. Lower panel, The similar size of the sonicated DNA products from each sample is illustrated. The immunoprecipitations were performed with the same amount of sonicated DNA.

 
MafA, PDX-1, and BETA2 Act Together to Induce Insulin Expression in AR42J and IEC-6 Cells
The level of insulin protein produced by the combined actions of MafA, PDX-1, and BETA2 paralleled insulin mRNA expression in IEC-6 and AR42J cells. Hence, the highest insulin mRNA levels were observed in the presence of all three activators in HGF- and activin A-treated AR42J cells (Fig. 2Go, A and B, and supplemental Fig. 1, A and B, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). Insulin protein levels analyzed by ELISA were also most effectively produced in AR42J cells (149.4 mg/g protein), with roughly 15-fold increase over untreated cells (Table 1Go). Insulin was clearly detected in the cytoplasm of Ad-MafA, Ad-PDX-1, and Ad-BETA2-treated cells (Fig. 5Go), although insulin secretion was not enhanced by glucose (AR42J, 49.4 and 52.6 pg/ml·105 cells in 18 and 1.5 mM glucose medium, respectively; MIN6, 2571.3 and 662.7 pg/ml·105 cells).


View this table:
[in this window]
[in a new window]

 
Table 1. MafA, PDX-1, and BETA2 Induce Substantial Amounts of Insulin Protein in AR42J Cells

 

Figure 5
View larger version (49K):
[in this window]
[in a new window]

 
Fig. 5. Combination of MafA, PDX-1, and BETA2 Induces Large Amounts of Insulin Protein in AR42J Cells

Insulin immunostaining was performed with AR42J cells infected with Ad-GFP, Ad-MafA, Ad-PDX-1, or/and Ad-BETA2. RINm5F cells were used as a positive control.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PDX-1 and BETA2 play a principal role in both islet cell development and adult islet function in vivo. The importance of PDX-1 (20) and BETA2 (21) in humans was also established upon demonstrating their mutational association with type 2 diabetes. In contrast, the recently isolated MafA transcription factor appears to principally be involved in adult islet ß-cell activity (23). Cell-line-based experiments performed with insulin-driven reporter constructs strongly suggest that high-level transcription in ß-cells requires the coordinated actions of MafA, BETA2, and PDX-1 (37, 38). Here we show that MafA, together with BETA2 and PDX-1, provided ß-like insulin expression properties to IEC-6 and AR42J cell lines.

The capability of adenoviral MafA expression alone to induce endogenous insulin expression was initially compared among a variety of endoderm-derived cell lines: IEC-6, AR42J, {alpha}TC6, and HepG2. Low-level insulin 2 expression was observed in all but HepG2 cells (Fig. 1BGo and supplemental Fig. 2, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). MafA induces insulin independently, because overexpression did not induce a detectable level of PDX-1 or BETA2 by Western blotting (data not shown). The ability of MafA to activate only insulin 2, but not insulin 1, was also observed in stably MafA-expressing {alpha}TC-6 cells (24). A combination of MafA, PDX-1, and BETA2 caused notably higher insulin expression than either individual factor in IEC-6 and AR42J cells, with mRNA and protein expressed at a significant fraction of rat islets and RINm5F ß-cells (Figs. 2Go and 5Go). Only MafA and PDX-1 or BETA2 were necessary in AR42J cells to detect a significant amount of insulin (Fig. 1DGo), whereas all were necessary in IEC6 (Fig. 1CGo). Although it is unclear why activation differed between such closely related cell lines, we assume that this is due to differences in expression of various transcriptional regulators that positively or negatively modulate insulin gene transcription.

Activation of endogenous insulin by MafA was entirely dependent upon the presence of two key ß-cell differentiation factors, activin A and HGF (Fig. 1DGo). These agents had been appreciated for their ability to induce low-level insulin production in AR42J cells (39, 40), as does the betacellulin differentiation factor in IEC6 cells (41, 42). [Betacellulin does not influence MafA-mediated activation of insulin in IEC6 cells (data not shown).] In striking contrast to the effect of activin A and HGF on endogenous insulin, activation of the transfected insulin-driven –238 Luc reporter by MafA, PDX-1, and BETA2 was not impacted by such factors (Fig. 3BGo). Similarly, binding to the endogenous insulin enhancer region in chromatin immunoprecipitation assays was also insensitive to the presence of these differentiation agents in AR42J cells. In addition, the expression level of p300/cAMP response element binding protein-binding protein, a coactivator for assembly of MafA, PDX-1, and BETA2, was also unchanged by activin A and HGF (data not shown). Thus, it remains unclear why activin A and HGF impact expression only of the endogenous insulin gene, but we assume that activin A and HGF are involved in promoting the assembly of the chromatin remodeling machinery by recruiting other activating factor(s).

MafA appears to mediate expression of other key islet ß-cell genes, such as GLUT2 and PC2 (Fig. 1Go, C and D). In addition, knockdown experiments also suggested that MafA directly regulates GLUT2 gene expression, although this may not be the case for the PC2 gene (Fig. 3Go). The importance of MafA in GLUT2 expression was also indicated in MafA–/– mice (23). Taken together, our findings clearly illustrate the central role that MafA plays in promoting insulin expression and the significance of functional interactions between other key islet regulators in regulating gene expression in ß-cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture and Preparation of Nuclear Extract
The IEC-6 (Riken Gene Bank, Tsukuba, Japan) and HeLa cell lines were maintained in DMEM and HepG2 cells in MEM, both of which were supplemented with 10% (vol/vol) heat-inactivated fetal calf serum and 1% penicillin-streptomycin. Monolayer pancreatic cell line cultures [ß, RINm5F (43), MIN6 (44); {alpha}, {alpha}TC6 (45); and acinar, AR42J B-13 (39)] were grown as described previously. In some experiments, 2 nM betacellulin (a gift from Dr. Reiko Sasada, Takeda Pharmaceutical, Tsukuba, Japan) or 2 nM human activin A (R&D Systems, Minneapolis, MN) plus 100 pM HGF (R&D Systems) were added to the medium. Human islets were provided by the Juvenile Diabetes Research Foundation Distribution Program at Washington University and were cultured in CMRL medium (GIBCO BRL, Gaithersburg, MD) with 10% heat-inactivated fetal calf serum. Cell line nuclear extracts were prepared by the procedure described by Schreiber et al. (46), except that 1 mM phenylmethylsulfonyl fluoride was included in the high-salt nuclear resuspension buffer.

Preparation of Expression Plasmids and Reporter Analysis
The –238 insulin firefly Luc expression plasmids contain rat insulin 2 gene sequence from –238 to +2 bp (47). The construction of the cytomegalovirus (CMV) enhancer-driven MafA expression vector (MafA/pcDNA3.1) was described previously (27), whereas PDX-1/pcDNA3.1 and BETA2/pcDNA3.1 were constructed by subcloning the coding sequences from mouse PDX-1 and hamster BETA2 into pcDNA3.1 (Invitrogen, San Diego, CA). Insulin –238 Luc (0.25 µg) was transfected into cells with MafA/pcDNA3.1 (0.25 µg), PDX-1/pcDNA3.1 (0.25 µg), and/or BETA2/pcDNA3.1 (0.25 µg) using the Lipofectamine procedure (Invitrogen, San Diego, CA), with the cotransfected tyrosine kinase promoter-driven renilla luciferase expression plasmid (phRL-TK, 20 ng; Promega, Madison, WI) serving as an internal control.

Preparation of Adenoviruses
Recombinant adenoviruses expressing MafA, PDX-1, or BETA2 were prepared using the AdEasy system (kindly provided by Dr. Bert Vogelstein, Johns Hopkins Cancer Center, Baltimore, MD) (48), with the pAdTrack-CMV shuttle vector used in cloning. The adenoviruses expressing siRNAs were driven by the RNA polymerase III H1 gene promoter and constructed using the following oligonucleotides: Ad-siMafA +66/+84 (37) (mafA sequences are underlined), 5'-CGCGTGCGACTTCGACCTGATGAAGGGAATTCGCTTCATCAGGTCGAAGTCGTTTTTTGGAAA-3' and 5'-AGCTTTTCCAAAAAACGACTTCGACCTGATGAAGCGAATTCCCTTCATCAGGTCGAAGTCGCA-3'; Ad-siMafA +82/+102 (37), 5'-CGCGTCCAAGTTCGAGGTGAAGAAGGAGTTCAAGAGAC T C CTTCTTCACCTCGAACTTTTTTTGGAAA-3' and 5'-AGC T T T T C CAAAAAAAGTTCGAGGTGAAGAAGGAGTCTCTTGAAC T C C T T CTTCACCTCGAACTTGGA-3'; and Ad-siScramble, 5'-CGCGTGCGCGCTTTGTAGGATTCGGGAATTCGCGAATCCTACA A A G C GCGCTTTTTTGGAAA-3' and 5'-AGCTTTTCCAAAAAAGCGCGCTTTGTAGGATTCGCGAATTCCCGAATCCTACAAAG C G C G C A-3'. These oligonucleotides were inserted in the MluI/HindIII sites of the pRNAT-H1.1/Adeno shuttle plasmid (GenScript, Piscataway, NJ). Adenovirus titer was roughly 1010 plaque-forming units/ml after treatment with the Virakit virus purification kit (Virapure, San Diego, CA), as estimated using the Adeno-X titer kit (Clontech).

RNA Isolation and RT-PCR Analysis
Total cellular RNA was isolated using the TRIZOL Reagent (Invitrogen, San Diego, CA). Two micrograms total RNA were reverse-transcribed at 42 C for 60 min with 0.5 µg oligo(dT)15 primer using the SuperScript II system (Invitrogen, San Diego, CA). The PCRs were run for 30 cycles with 25 pmol primer under the following conditions: 94 C for 30 sec, 60 C for 30 sec, and 72 C for 30 sec. The sequences of the primer sets were as follows: mouse insulin 2 (numbering relative to ATG, forward –57 AGCCCTAAGTGATCCGCTACAA, reverse +331 AGTTGCAGTAGTTCTCCAGCTG, 388-bp product), rat insulin 2 (–57 AGCCCTAAGTGACCAGCTACAG, +198 CAGTTGTGCCACTTGTGGGT, 255 bp), human insulin (–7 TTCTGCCATGGCCCTGTGGAT, +331 AGTTGCAGTAGTTCTCCAGCTG, 338 bp), rat insulin 1 (–50 AGTGACCAGCTACAATCATAG, +252 AACCTCCAGTGCCAAGGTCT, 302 bp), rat GLUT2 (+56 TGGGTTCCTTCCAGTTCG, +238 AGGCGTCTGGTGTCGTATG, 183 bp), rat glucokinase (+9 TGACAGAGCCAGGATGGAG, +307 TCTTCACGCTCCACTGCC, 299 bp), rat Kir6.2 (+717 CATGGAGAACGGTGTGGG, +915 CAGATAGGAGGTGCGGGC, 199 bp), rat SUR1 (+3904 CCAGACCAAGGGAAGATCCA, +4170 GTCCTGTAGGATGATAGACA, 267 bp), rat PC2 (+1629 CTCCAAGGTGGGCTTTGACA, +2053 GCAAGCAAAGCTTCAGACCA, 425 bp), rat ß-actin (+53 AGGCCGGCTTCGCGGGCGA, +302 TGCTCCTCAGGGGCCACACG, 250 bp). The products were resolved on a 1.5% agarose gel run in Tris-acetate-EDTA buffer and visualized by ethidium bromide staining. The correctness of the amplified products was determined by diagnostic restriction-enzyme digestion and DNA sequencing.

Real-Time PCR Analysis
One microliter of the reverse-transcribed products obtained as described above was used in a 25-µl reaction mixture including 1x Applied Biosystems SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) and 4 µl 2.5 µM primer for mouse insulin 1 (numbering relative to ATG, forward –47 GACCAGCTATAATCAGAGACC, reverse +331 AGTTGCAGTAGTTCTCCAGCTG, 378 bp), mouse GLUT2 (+557 CCCTGGGTACTCTTCACCAA, +666 GCCAAGTAGGATGTGCCAAT, 110 bp), mouse PC2 (+1646 ACAAGTGGCCTTTCATGACC, +1773 GTGAAGCATCAGGGTCCATT, 128 bp), mouse ß-actin (+778 GCTCTTTTCCAGCCTTCCTT, +945 CTTCTGCATCCTGTCAGCAA, 168 bp), or human ß-actin (+813 CTGTGGCATCCACGAAACTA, +1012 AGTACTTGCGCTCAGGAGGA, 200 bp). Other primer sets for real-time PCR analysis were described above. The initial cycling conditions involved a hold at 95 C for 10 min, followed by 40 cycles of 94 C for 15 sec and then 60 C for 60 sec. The signal fluorescence magnitude was detected with an ABI Prism 7700 sequence detector. The data are normalized to the ß-actin signal and presented as mean amount ± SD relative to the control adenovirus (Ad-GFP) infection.

Chromatin Immunoprecipitation Analysis
Control and HG- plus activin A-treated AR42J cells (~108 cells per point) were formaldehyde cross-linked 3 d after adenovirus infection and the sonicated chromatin-DNA complexes isolated as described previously (49). {alpha}-MafA (10 µg; Bethyl Laboratories, Montgomery, TX) or {alpha}-PDX-1 antibodies were added to the sonicated chromatin and the antibody-protein-DNA complexes isolated with A/G-agarose (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). PCR was performed on 1/20 of the purified immunoprecipitated DNA using 25 pmol of each primer, with the rat insulin 2 primers detecting binding to both the rat 1 and 2 genes (–263 GAGACAATGTCCCCTGCTGT-3', –53 CCCCTGGACTTTGCTGTTTG-3'). PCR cycling parameters were one cycle of 95 C (3 min) and 30 cycles of 95 C (20 sec), 60 C (20 sec), and 72 C (20 sec). Amplified products were electrophoresed through a 1.5% agarose gel in Tris-acetate-EDTA buffer and visualized by ethidium bromide staining. The same primer sets were used to quantify by RT-PCR the amount of DNA precipitated by {alpha}-MafA.

Northern Blotting Analysis
Total RNA (10 µg) was isolated from RINm5F and adenovirus-infected IEC-6 and AR42J cells and separated under denaturing conditions on 1% agarose gels. The transferred RNA was hybridized with a 32P-labeled mouse insulin cDNA probe isolated from the pMIn2C plasmid (50), which was a kind gift of Drs. J. M. Chirgwin (University of Texas Health Science Center, San Antonio, TX) and M. A. Permutt (Washington University School of Medicine, St. Louis, MO).

Western Immunoblot Analysis
MIN6 and IEC-6 nuclear protein was fractionated on 10% SDS-PAGE, transferred to nitrocellulose, and probed with {alpha}-MafA (1:2500 dilution), {alpha}-PDX-1 (1:5000) (51), and {alpha}-BETA2 (1:2000) (N-19; Santa Cruz Biotechnology) antiserum. Antibody binding was detected using horseradish peroxidase coupled to goat {alpha}-rabbit or rabbit {alpha}-goat IgG (1:5,000 dilution), with the complex visualized by incubation with the Western Lightning chemiluminescence reagent (PerkinElmer Life Sciences, Boston, MA).

ELISA for Insulin
Whole-cell extracts were obtained from adenovirus-infected AR42J, IEC6, or HepG2 cells by treating for 24 h at 4 C in acid-ethanol. The insulin content of the extract was determined with the Insulin ELISA Kit/Rat Ultra Sensitive using a rodent insulin standard (Morinaga Biochemicals, Yokohama, Japan), and the rat insulinoma RINm5F cell line was used as a positive control. Insulin concentration was normalized with total cellular protein, as measured using the Bio-Rad protein assay kit (Bio-Rad Laboratories, Richmond, CA).

Immunocytochemistry Analysis
AR42J cells were fixed on Lab-Tek chamber slides (Nalge Nunc International, Rochester, NY) with 4% paraformaldehyde. Insulin staining was performed using the Vectastain Elite ABC kit (Vector Laboratories, Burlingame, CA). The slides were incubated with ABC reagent for 30 min, and positive guinea pig antiinsulin antibody (1:2000; Dako, Glostrup, Denmark). Its reactivity was visualized with the 3,3'-diaminobenzidine tetrahydrochloride substrate (Zymed Laboratories, San Francisco, CA).

Statistical Analysis
Data are expressed as means ± SD. Statistical analysis was performed using the one-way ANOVA followed by Scheffe’s test. A value of P < 0.05 was considered to be statistically significant.


    ACKNOWLEDGMENTS
 
We thank Dr. Bert Vogelstein (Johns Hopkins Oncology Center) for kindly providing the AdEasy system. We also thank Ms. Yuko Sasaki for excellent technical assistance and Ms. Chikayo Yokogawa for secretarial assistance.


    FOOTNOTES
 
This work was supported by funds from the Juvenile Diabetes Research Foundation (Career Development Award 2-2005-946; to T.M.) and National Institutes of Health (Grant DK42502; to R.S.).

Disclosure Summary: The authors have nothing to disclose.

First Published Online July 17, 2007

Abbreviations: Ad, Adenovirus; GLUT2, glucose transporter type 2; HGF, hepatocyte growth factor; Kir6.2, ATP-sensitive inward rectifier potassium channel; Luc, luciferase; PC2, prohormone convertase 2; PDX-1, pancreatic and duodenal homeobox-1; si, small interference; SUR1, sulfonylurea receptor 1.

Received for publication January 16, 2007. Accepted for publication July 11, 2007.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Leonard J, Peers B, Johnson T, Ferreri K, Lee S, Montminy MR 1993 Characterization of somatostatin transactivating factor-1, a novel homeobox factor that stimulates somatostatin expression in pancreatic islet cells. Mol Endocrinol 7:1275–1283[Abstract/Free Full Text]
  2. Miller CP, McGehee Jr RE, Habener JF 1994 IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene. EMBO J 13:1145–1156[Medline]
  3. Ohlsson H, Karlsson K, Edlund T 1993 IPF1, a homeodomain-containing transactivator of the insulin gene. EMBO J 12:4251–4259[Medline]
  4. Peers B, Leonard J, Sharma S, Teitelman G, Montminy MR 1994 Insulin expression in pancreatic islet cells relies on cooperative interactions between the helix loop helix factor E47 and the homeobox factor STF-1. Mol Endocrinol 8:1798–1806[Abstract/Free Full Text]
  5. Peshavaria M, Gamer L, Henderson E, Teitelman G, Wright CV, Stein R 1994 XIHbox 8, an endoderm-specific Xenopus homeodomain protein, is closely related to a mammalian insulin gene transcription factor. Mol Endocrinol 8:806–816[Abstract/Free Full Text]
  6. Petersen HV, Serup P, Leonard J, Michelsen BK, Madsen OD 1994 Transcriptional regulation of the human insulin gene is dependent on the homeodomain protein STF1/IPF1 acting through the CT boxes. Proc Natl Acad Sci USA 91:10465–10469[Abstract/Free Full Text]
  7. Naya FJ, Stellrecht CM, Tsai MJ 1995 Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor. Genes Dev 9:1009–1019[Abstract/Free Full Text]
  8. Peyton M, Moss LG, Tsai MJ 1994 Two distinct class A helix-loop-helix transcription factors, E2A and BETA1, form separate DNA binding complexes on the insulin gene E box. J Biol Chem 269:25936–25941[Abstract/Free Full Text]
  9. Aronheim A, Ohlsson H, Park CW, Edlund T, Walker MD 1991 Distribution and characterization of helix-loop-helix enhancer-binding proteins from pancreatic ß-cells and lymphocytes. Nucleic Acids Res 19:3893–3899[Abstract/Free Full Text]
  10. Cordle SR, Henderson E, Masuoka H, Weil PA, Stein R 1991 Pancreatic ß-cell-type-specific transcription of the insulin gene is mediated by basic helix-loop-helix DNA-binding proteins. Mol Cell Biol 11:1734–1738[Abstract/Free Full Text]
  11. German MS, Blanar MA, Nelson C, Moss LG, Rutter WJ 1991 Two related helix-loop-helix proteins participate in separate cell-specific complexes that bind the insulin enhancer. Mol Endocrinol 5:292–299[Abstract/Free Full Text]
  12. Shieh SY, Tsai MJ 1991 Cell-specific and ubiquitous factors are responsible for the enhancer activity of the rat insulin II gene. J Biol Chem 266:16708–16714[Abstract/Free Full Text]
  13. Watada H, Kajimoto Y, Umayahara Y, Matsuoka T, Kaneto H, Fujitani Y, Kamada T, Kawamori R, Yamasaki Y 1996 The human glucokinase gene ß-cell-type promoter: an essential role of insulin promoter factor 1/PDX-1 in its activation in HIT-T15 cells. Diabetes 45:1478–1488[Abstract]
  14. Moates JM, Nanda S, Cissell MA, Tsai MJ, Stein R 2003 BETA2 activates transcription from the upstream glucokinase gene promoter in islet ß-cells and gut endocrine cells. Diabetes 52:403–408[Abstract/Free Full Text]
  15. Bretherton-Watt D, Gore N, Boam DS 1996 Insulin upstream factor 1 and a novel ubiquitous factor bind to the human islet amyloid polypeptide/amylin gene promoter. Biochem J 313(Pt 2):495–502
  16. Carty MD, Lillquist JS, Peshavaria M, Stein R, Soeller WC 1997 Identification of cis- and trans-active factors regulating human islet amyloid polypeptide gene expression in pancreatic ß-cells. J Biol Chem 272:11986–11993[Abstract/Free Full Text]
  17. Serup P, Jensen J, Andersen FG, Jorgensen MC, Blume N, Holst JJ, Madsen OD 1996 Induction of insulin and islet amyloid polypeptide production in pancreatic islet glucagonoma cells by insulin promoter factor 1. Proc Natl Acad Sci USA 93:9015–9020[Abstract/Free Full Text]
  18. Watada H, Kajimoto Y, Kaneto H, Matsuoka T, Fujitani Y, Miyazaki J, Yamasaki Y 1996 Involvement of the homeodomain-containing transcription factor PDX-1 in islet amyloid polypeptide gene transcription. Biochem Biophys Res Commun 229:746–751[CrossRef][Medline]
  19. Waeber G, Thompson N, Nicod P, Bonny C 1996 Transcriptional activation of the GLUT2 gene by the IPF-1/STF-1/IDX-1 homeobox factor. Mol Endocrinol 10:1327–1334[Abstract/Free Full Text]
  20. Stoffers DA, Ferrer J, Clarke WL, Habener JF 1997 Early-onset type-II diabetes mellitus (MODY4) linked to IPF1. Nat Genet 17:138–139[CrossRef][Medline]
  21. Malecki MT, Jhala US, Antonellis A, Fields L, Doria A, Orban T, Saad M, Warram JH, Montminy M, Krolewski AS 1999 Mutations in NEUROD1 are associated with the development of type 2 diabetes mellitus. Nat Genet 23:323–328[CrossRef][Medline]
  22. Melloul D 2004 Transcription factors in islet development and physiology: role of PDX-1 in ß-cell function. Ann NY Acad Sci 1014:28–37[CrossRef][Medline]
  23. Zhang C, Moriguchi T, Kajihara M, Esaki R, Harada A, Shimohata H, Oishi H, Hamada M, Morito N, Hasegawa K, Kudo T, Engel JD, Yamamoto M, Takahashi S 2005 MafA is a key regulator of glucose-stimulated insulin secretion. Mol Cell Biol 25:4969–4976[Abstract/Free Full Text]
  24. Matsuoka TA, Artner I, Henderson E, Means A, Sander M, Stein R 2004 The MafA transcription factor appears to be responsible for tissue-specific expression of insulin. Proc Natl Acad Sci USA 101:2930–2933[Abstract/Free Full Text]
  25. Artner I, Le Lay J, Hang Y, Elghazi L, Schisler JC, Henderson E, Sosa-Pineda B, Stein R 2006 MafB: an activator of the glucagon gene expressed in developing islet {alpha}- and ß-cells. Diabetes 55:297–304[Abstract/Free Full Text]
  26. Naya FJ, Huang HP, Qiu Y, Mutoh H, DeMayo FJ, Leiter AB, Tsai MJ 1997 Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/neuroD-deficient mice. Genes Dev 11:2323–2334[Abstract/Free Full Text]
  27. Matsuoka TA, Zhao L, Artner I, Jarrett HW, Friedman D, Means A, Stein R 2003 Members of the large Maf transcription family regulate insulin gene transcription in islet ß-cells. Mol Cell Biol 23:6049–6062[Abstract/Free Full Text]
  28. Harmon JS, Stein R, Robertson RP 2005 Oxidative stress-mediated, post-translational loss of MafA protein as a contributing mechanism to loss of insulin gene expression in glucotoxic ß-cells. J Biol Chem 280:11107–11113[Abstract/Free Full Text]
  29. Robertson RP 2004 Chronic oxidative stress as a central mechanism for glucose toxicity in pancreatic islet ß-cells in diabetes. J Biol Chem 279:42351–42354[Free Full Text]
  30. Ueki K, Okada T, Hu J, Liew CW, Assmann A, Dahlgren GM, Peters JL, Shackman JG, Zhang M, Artner I, Satin LS, Stein R, Holzenberger M, Kennedy RT, Kahn CR, Kulkarni RN 2006 Total insulin and IGF-I resistance in pancreatic ß-cells causes overt diabetes. Nat Genet 38:583–588[CrossRef][Medline]
  31. Crowe DT, Tsai MJ 1989 Mutagenesis of the rat insulin II 5'-flanking region defines sequences important for expression in HIT cells. Mol Cell Biol 9:1784–1789[Abstract/Free Full Text]
  32. Whelan J, Cordle SR, Henderson E, Weil PA, Stein R 1990 Identification of a pancreatic ß-cell insulin gene transcription factor that binds to and appears to activate cell-type-specific expression: its possible relationship to other cellular factors that bind to a common insulin gene sequence. Mol Cell Biol 10:1564–1572[Abstract/Free Full Text]
  33. German MS, Wang J, Chadwick RB, Rutter WJ 1992 Synergistic activation of the insulin gene by a LIM-homeo domain protein and a basic helix-loop-helix protein: building a functional insulin minienhancer complex. Genes Dev 6:2165–2176[Abstract/Free Full Text]
  34. Melloul D, Ben-Neriah Y, Cerasi E 1993 Glucose modulates the binding of an islet-specific factor to a conserved sequence within the rat I and the human insulin promoters. Proc Natl Acad Sci USA 90:3865–3869[Abstract/Free Full Text]
  35. Kajihara M, Sone H, Amemiya M, Katoh Y, Isogai M, Shimano H, Yamada N, Takahashi S 2003 Mouse MafA, homologue of zebrafish somite Maf 1, contributes to the specific transcriptional activity through the insulin promoter. Biochem Biophys Res Commun 312:831–842[CrossRef][Medline]
  36. Zhang YQ, Mashima H, Kojima I 2001 Changes in the expression of transcription factors in pancreatic AR42J cells during differentiation into insulin-producing cells. Diabetes 50(Suppl 1):S10–S14
  37. Zhao L, Guo M, Matsuoka TA, Hagman DK, Parazzoli SD, Poitout V, Stein R 2005 The islet ß-cell-enriched MafA activator is a key regulator of insulin gene transcription. J Biol Chem 280:11887–11894[Abstract/Free Full Text]
  38. Kaneto H, Matsuoka TA, Nakatani Y, Miyatsuka T, Matsuhisa M, Hori M, Yamasaki Y 2005 A crucial role of MafA as a novel therapeutic target for diabetes. J Biol Chem 280:15047–15052[Abstract/Free Full Text]
  39. Mashima H, Shibata H, Mine T, Kojima I 1996 Formation of insulin-producing cells from pancreatic acinar AR42J cells by hepatocyte growth factor. Endocrinology 137:3969–3976[Abstract]
  40. Zalzman M, Gupta S, Giri RK, Berkovich I, Sappal BS, Karnieli O, Zern MA, Fleischer N, Efrat S 2003 Reversal of hyperglycemia in mice by using human expandable insulin-producing cells differentiated from fetal liver progenitor cells. Proc Natl Acad Sci USA 100:7253–7258[Abstract/Free Full Text]
  41. Kojima H, Nakamura T, Fujita Y, Kishi A, Fujimiya M, Yamada S, Kudo M, Nishio Y, Maegawa H, Haneda M, Yasuda H, Kojima I, Seno M, Wong NC, Kikkawa R, Kashiwagi A 2002 Combined expression of pancreatic duodenal homeobox 1 and islet factor 1 induces immature enterocytes to produce insulin. Diabetes 51:1398–1408[Abstract/Free Full Text]
  42. Yoshida S, Kajimoto Y, Yasuda T, Watada H, Fujitani Y, Kosaka H, Gotow T, Miyatsuka T, Umayahara Y, Yamasaki Y, Hori M 2002 PDX-1 induces differentiation of intestinal epithelioid IEC-6 into insulin-producing cells. Diabetes 51:2505–2513[Abstract/Free Full Text]
  43. Lortz S, Tiedge M, Nachtwey T, Karlsen AE, Nerup J, Lenzen S 2000 Protection of insulin-producing RINm5F cells against cytokine-mediated toxicity through overexpression of antioxidant enzymes. Diabetes 49:1123–1130[Abstract]
  44. Miyazaki J, Araki K, Yamato E, Ikegami H, Asano T, Shibasaki Y, Oka Y, Yamamura K 1990 Establishment of a pancreatic ß-cell line that retains glucose-inducible insulin secretion: special reference to expression of glucose transporter isoforms. Endocrinology 127:126–132[Abstract/Free Full Text]
  45. Hamaguchi K, Leiter EH 1990 Comparison of cytokine effects on mouse pancreatic {alpha}-cell and ß-cell lines. Viability, secretory function, and MHC antigen expression. Diabetes 39:415–425[Abstract]
  46. Schreiber E, Matthias P, Muller MM, Schaffner W 1989 Rapid detection of octamer binding proteins with ‘mini-extracts’, prepared from a small number of cells. Nucleic Acids Res 17:6419[Free Full Text]
  47. Robinson GL, Peshavaria M, Henderson E, Shieh SY, Tsai MJ, Teitelman G, Stein R 1994 Expression of the trans-active factors that stimulate insulin control element-mediated activity appear to precede insulin gene transcription. J Biol Chem 269:2452–2460[Abstract/Free Full Text]
  48. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B 1998 A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA 95:2509–2514[Abstract/Free Full Text]
  49. Gerrish K, Cissell MA, Stein R 2001 The role of hepatic nuclear factor 1{alpha} and PDX-1 in transcriptional regulation of the pdx-1 gene. J Biol Chem 276:47775–47784[Abstract/Free Full Text]
  50. Soares MB, Schon E, Henderson A, Karathanasis SK, Cate R, Zeitlin S, Chirgwin J, Efstratiadis A 1985 RNA-mediated gene duplication: the rat preproinsulin I gene is a functional retroposon. Mol Cell Biol 5:2090–2103[Abstract/Free Full Text]
  51. Matsuoka T, Kajimoto Y, Watada H, Kaneto H, Kishimoto M, Umayahara Y, Fujitani Y, Kamada T, Kawamori R, Yamasaki Y 1997 Glycation-dependent, reactive oxygen species-mediated suppression of the insulin gene promoter activity in HIT cells. J Clin Invest 99:144–150[Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
J. S. Harmon, M. Bogdani, S. D. Parazzoli, S. S. M. Mak, E. A. Oseid, M. Berghmans, R. C. LeBoeuf, and R. P. Robertson
{beta}-Cell-Specific Overexpression of Glutathione Peroxidase Preserves Intranuclear MafA and Reverses Diabetes in db/db Mice
Endocrinology, November 1, 2009; 150(11): 4855 - 4862.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
I. Artner, Y. Hang, M. Guo, G. Gu, and R. Stein
MafA is a dedicated activator of the insulin gene in vivo
J. Endocrinol., August 1, 2008; 198(2): 271 - 279.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuoka, T.-a.
Right arrow Articles by Yamasaki, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuoka, T.-a.
Right arrow Articles by Yamasaki, Y.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals