Molecular Endocrinology, doi:10.1210/me.2007-0107
Molecular Endocrinology 21 (12): 2877-2889
Copyright © 2007 by The Endocrine Society
Orphan Receptor TR3 Attenuates the p300-Induced Acetylation of Retinoid X Receptor-
Wen-xiu Zhao,
Min Tian,
Bi-xing Zhao,
Gui-deng Li,
Bo Liu,
Yan-yan Zhan,
Hang-zi Chen and
Qiao Wu
Key Laboratory of the Ministry of Education for Cell Biology and Tumor Cell Engineering, School of Life Sciences, Xiamen University, Xiamen 361005, Fujian Province, China
Address all correspondence and requests for reprints to: Qiao Wu, Ph.D., Department of Biomedical Sciences, School of Life Sciences, Xiamen University, Xiamen 361005, Fujian, China. E-mail: xgwu{at}xmu.edu.cn.
 |
ABSTRACT
|
|---|
Acetylation modification regulates the functions of histone and nonhistone proteins, including transcriptional activity, protein interaction, and subcellular localization. Although many nuclear receptors have been shown to be modified by acetylation, whether retinoid X receptors (RXRs) are acetylated and how the acetylation is regulated remains unknown. Here, we provide the first evidence of RXR
acetylation by p300 on lysine 145. Acetylation of RXR
by p300 facilitated its DNA binding and subsequently increased its transcriptional activity. Furthermore, we discovered that TR3, an orphan receptor, exerted a negative regulation on p300-induced RXR
acetylation. TR3 significantly reduced the p300-induced RXR
acetylation and transcriptional activity, and such inhibition required the interaction of TR3 with RXR
. Binding of TR3 to RXR
resulted in the sequestration of RXR
from p300. 9-cis retinoic acid, a ligand for RXR
, enhanced the association of RXR
with TR3, rather than acetylation of RXR
by p300. Biological function analysis revealed that the mitogenic activity of RXR
stimulated by p300 was acetylation dependent and could be repressed by TR3. Upon the treatment of 9-cis retinoic acid, RXR
was translocated with TR3 from the nucleus to the mitochondria, and apoptosis was induced. Taken together, our data demonstrate the distinct regulatory mechanisms of p300 and TR3 on RXR
acetylation and reveal a previously unrecognized role for orphan receptor in the transcriptional control of retinoid receptors.
 |
INTRODUCTION
|
|---|
NUCLEAR RECEPTORS COMPRISE a large family of ligand-dependent transcription factors that bind to hormone response elements of target genes and regulate their transcriptional activities. Retinoid X receptors (RXRs) are important members of the nuclear receptor superfamily and regulate various physiological processes, such as proliferation, differentiation, and apoptosis in many cell types. RXRs can either homodimerize by themselves or heterodimerize with retinoic acid receptors (RARs) and bind to RXR response element (RXRE) or retinoic acid response element (RARE), thereby positively or negatively controlling the gene transcription and expression. In addition, RXRs also form heterodimers with many other members of nuclear receptors, including vitamin D receptor, peroxisome proliferator-activated receptor, and thyroid hormone receptor (TR) as well as several orphan receptors, such as liver X receptor and TR3 (also termed as Nur77 and NGFI-B) (1, 2). RXRs, therefore, play an essential role in integrating multiple nuclear hormone-signaling pathways.
Although RXRs are well known to function restrictedly in nucleus as potent heterodimerization partners for many nuclear receptors, one of the members, RXR
, has been demonstrated to shuttle between the nucleus and the cytoplasm (3). We have found that RXR
serves as a carrier for TR3 mitochondrial targeting in a RXR-ligand-dependent manner (3). Others have also revealed that RXR
and its selective ligands are critical regulators for TR3 activity and localization (4). TR3 is a transcriptional factor, and its expression can be rapidly induced by a number of growth factors and mitogens in a variety of cancer cells. In addition, TR3 can translocate from the nucleus to the mitochondria to initiate apoptosis in response to several apoptotic stimuli (3, 5, 6). Recently, we have demonstrated a unique TR3-p53-MDM2 pathway in which TR3 with p53 cooperatively acts to regulate MDM2 functions in the nucleus (7). Therefore, TR3 may mediate distinct signal pathways, although its regulatory role in these pathways remains to be clarified.
Acetylation represents an important mechanism to regulate the functions of nuclear receptors and their related signal pathways. The candidate acetylation motif (KXKK/RXKK) of many nuclear receptors, such as TR, RAR, peroxisome proliferator-activated receptor, liver X receptor, FXR, vitamin D receptor, glucocorticoid receptor, progesterone receptor, hepatocyte nuclear factor, and steroidogenic factor 1, is conserved among different species, including vertebrates, arthropods, and nematodes (8). Other types of motif for acetylation have also been identified, such as GK and SK (9). p300 is a transcriptional coactivator that possesses an intrinsic histone acetyltransferase activity (10). It contributes to the formation of a protein activation complex that bridges various factors to the general transcription machinery. p300 has been shown to acetylate a growing number of nonhistone proteins, notably transcription factors such as p53 (11), E2F1 (12), high-mobility group protein isoform I and Y (13), hepatocyte nuclear factor 4 (14), HIV Tat (15), and nuclear receptors such as androgen receptor (16, 17), and estrogen receptor-
(18, 19).
In the present study, we demonstrated for the first time that RXRs, including RXR
and RXR
, are subjected to p300 acetylation. Such acetylation promotes RXR
binding to RXRE, thereby increasing the transcriptional activity of RXR
. We further revealed that TR3 has a significant inhibitory effect on p300-induced RXR
acetylation. TR3 competes with p300 in RXR
binding and results in the translocation of TR3/RXR
from the nucleus to the mitochondria in response to 9-cis retinoic acid. Although acetylation of RXR
by p300 stimulates the growth of HeLa cells, attenuation of p300-induced RXR
acetylation by TR3 induces apoptosis through TR3/RXR
heterodimerization, translocation, and mitochondrial targeting. Taken together, our results demonstrated that the orphan receptor TR3 plays an important role in p300-induced RXR
acetylation by functioning as a negative regulator.
 |
RESULTS
|
|---|
p300 Induces Acetylation of RXR
on K145
Retinoid X receptors (RXRs) consist of three different isoforms, RXR
, RXRβ, and RXR
. To investigate whether RXRs can be acetylated by p300, green fluorescent protein (GFP)-tagged isoforms of RXRs were transiently transfected into 293T cells. Lysates were prepared from these transfected cells, and GFP-tagged proteins were immunoprecipitated and blotted with an acetylation-specific antibody. As shown in Fig. 1A
, none of RXR
, RXRβ, and RXR
could be detected by the acetylation-specific antibody when they were transfected into cells alone. However, when p300 was cotransfected, RXR
and RXR
, but not RXRβ, became detectable by the same antibody, indicating that RXR
and RXR
were acetylated in the presence of p300.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 1. p300 Induced the Acetylation of RXR
A, Acetylation of RXR isoforms by p300. Different GFP-tagged retinoid receptors, including RXR , -β, and - , together with or without p300, were transfected into 293T cells, respectively. After transfection, cells were harvested and cell extracts were prepared. RXRs were immunoprecipitated with anti-GFP antibody followed by Western blotting with acetylation-specific antibody. Tubulin was used to indicate the similar loading of proteins in each lane. B, Acetylation of RXR by p300 in a dose-dependent manner. GFP-RXR , together with different amounts of HA-p300, was transfected into 293T cells. The level of RXR acetylation was determined as described above. p53 and GFP were used as positive and negative control, respectively. C, Effect of endogenous p300 on RXR acetylation. Cell extracts from HeLa and MCF-7 cells were prepared and immunoprecipitated with anti-RXR antibody, followed by Western blotting with acetylation-specific antibody to show the levels of RXR acetylation (left panel, black arrow). IgG was used as negative control. To diminish the activity of endogenous p300, siRNA-p300 was introduced into HeLa and MCF-7 cells respectively, and the levels of RXR acetylation was determined as above (right panel, black arrow). White arrow indicates a heavy chain.
|
|
We chose RXR
for further study because its acetylation level was higher than RXR
(Fig. 1A
). The acetylation level of RXR
seemed to be enhanced by the increase of transfected p300 (Fig. 1B
). However, cotransfection of a p300 mutant (p300DY) deficient in acetylase activity (20) resulted in no acetylation of RXR
(Fig. 1B
), suggesting that the acetylase activity of p300 is directly responsible for the acetylation of RXR
. The acetylated RXR
could also be clearly detected in HeLa and MCF-7 cells (Fig. 1C
, left panel, black arrow), both of which are known to stably express p300 (Fig. 1C
). When small interfering RNA (siRNA)-p300 was introduced into these two cell lines to inhibit the expression of endogenous p300, the acetylation level of RXR
greatly decreased (Fig. 1C
, right panel, black arrow). Together, these results suggest that p300 is essential and necessary to induce the acetylation of RXR
.
Sequence analysis of RXR
revealed four consensus acetylation motifs located at approximately 144–145 (GK), 212–213 (GK), 362–363 (SK), and 387–388 (SK), respectively (Fig. 2A
). To determine which site is responsible for RXR
acetylation, different deletion mutants of RXR
were constructed (Fig. 2A
) and cotransfected with p300 into 293T cells for acetylation assays. Wild-type RXR
and deletion mutants of RXR
/D2 and RXR
/D3, but not RXR
/D1 mutant, were found to be acetylated (Fig. 2B
), indicating that the region around amino acids 133–156 is responsible for RXR
acetylation. Because that region contains only a candidate acetylation motif (Lys145), we then constructed a new point mutant of RXR
(K145R) in which Lys145 was replaced with Arg. As expected, the K145R mutation significantly abolished the acetylation of RXR
induced by p300 in 293T cells (Fig. 2C
). These results clearly demonstrate Lys145 as the p300-induced acetylation site on RXR
.
Acetylation of RXR
Increases Its DNA-Binding and Transcriptional Activity
Acetylation of nuclear receptors is often closely related to the regulation of their DNA-binding and transcriptional activity. To determine the correlation between RXR
acetylation and its transcriptional activity, we assessed the activity of a luciferase reporter gene linked with RARE in 293T cells. With the presence of endogenous RXR
, p300 could enhance the reporter activity in a concentration-dependent manner (Fig. 3A
), whereas the acetyltransferase-dead mutant of p300 (p300DY) failed to do so (Fig. 3B
). When RXR
mutant K145R was used for cotransfection, p300 had no effect on the reporter activity (Fig. 3C
). Taken together, these results clearly demonstrated a positive regulation of p300-induced acetylation on the transcriptional activity of RXR
.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 3. Acetylation of RXR by p300 Enhanced Its DNA-Binding and Transcriptional Activities
A, p300 increased the transcriptional activity of RXR . The RARE-linked luciferase reporter gene and β-gal gene expression vector, together with increasing doses of p300 expression vector, were transfected into 293T cells. Reporter gene activity was determined and normalized in relation to the cotransfected β-gal activity. The bars represent the average ± mean from three independent experiments. B, A p300 mutant that was deficient in acetylase activity (p300DY) was used for the same assay as A. C, Correlation between RXR transcriptional activity and its acetylation. RARE-luciferase reporter gene and β-gal gene expression vector, together with different combinations of RXR and its point mutant K145R as indicated, were transfected into 293T cells in the absence or presence of p300. Reporter gene activity was determined and normalized as described above. D, Colocalization of RXR with p300. HA-p300, Myc-RXR , and its point mutant K145R were transfected into 293T cells in different combinations as indicated. Cells were immunostained by Myc antibody followed by FITC-conjugated secondary antibody to detect RXR or its point mutant K145R, or by HA antibody followed by Texas Red-conjugated secondary antibody to detect p300. Stained cells were visualized with the confocal microscope. Percentage of cells with speckle RXR /p300 is indicated. E, Effect of p300 on RXR and its point mutant K145R binding to DNA. GFP-RXR or GFP-K145R was transfected into 293T cells in the absence or presence of HA-p300 as indicated. Nuclear proteins were prepared, and homodimerization of RXR was analyzed by the method of EMSA and probed with biotin-labeled RXRE oligonucleotides. To determine the formation of RXR homodimer, antibody specific for GFP (aGFP) was preincubated with nuclear proteins for 2 h before assay. NS means nonspecific band. F, The binding of RXR to the RARβ promoter. GFP-RXR or its point mutant K145R was transfected into 293T cells in the absence or presence of p300 as indicated. The binding of RXR or K145R to the RARβ promoter was analyzed by the method of ChIP. Beads were used as negative control. Input was used to indicate similar loading of DNA in each lane.
|
|
We next analyzed the subcellular localization of RXR
and p300 by confocal microscopy. When expressed alone in 293T cells, p300 displayed as microspeckles in the nucleus, whereas RXR
and its mutant K145R mainly located in the nucleus with diffused pattern (Fig. 3D
, first panel). Once coexpressed, p300 and RXR
showed a colocalization pattern in about 50% cells by forming obvious speckles in the nucleus (Fig. 3D
, second panel). By contrast, such speckles could only be seen in less than 10% of cells that were transfected with either p300DY/RXR
(Fig. 3D
, third panel) or K145R/p300 (Fig. 3D
, last panel). We suspected that the formation of RXR
with p300 into speckles might be related to its DNA-binding property. To verify this possibility, EMSA was performed with the use of RXRE as a probe for incubation with nuclear proteins. As shown in Fig. 3E
, nuclear proteins extracted from GFP-RXR
-transfected 293T cells formed a complex with RXRE, and p300 enhanced this complex formation obviously (Fig. 3E
, black arrow). The complex band was up-shifted only when the nuclear proteins were preincubated with anti-GFP antibody (aGFP) (Fig. 3E
, white arrow), indicating that the complex is composed of homodimer of RXR
. Chromatin immunoprecipitation (ChIP) assay further demonstrated that p300 could enhance the binding of RXR
to the RARβ promoter (Fig. 3F
). However, the K145R mutant of RXR
did not bind to RXRE, even in the presence of p300 (Fig. 3E
), and p300 also failed to promote its binding to RARβ promoter (Fig. 3F
). Together, these data suggested that RXR
acetylation by p300 results in its binding to DNA, which is correlated well with the activation of its transcriptional activity.
TR3 Binds to RXR
and Attenuates Its Acetylation by p300
The orphan receptor TR3 has been shown to inhibit p300-induced acetylation of p53 (7). Because TR3 heterodimerizes with RXR
in vivo (3, 21, 22), we suspected that TR3 may also be involved in regulation of RXR
acetylation. When TR3 was introduced into 293T cells that had been transfected with RXR
and p300, we found that the p300-induced RXR
acetylation became significantly attenuated (Fig. 4A
). A similar result was also observed in HeLa cells that were transfected with TR3 alone (Fig. 4B
, black arrow). We further investigated the inhibitory effect of endogenous TR3 on RXR
acetylation. When siRNA-TR3 was introduced into HeLa cells to inhibit endogenous TR3 expression, more acetylated RXR
could be detected (Fig. 4C
, black arrow). Quantitative analysis by densitometry further confirmed the effect of TR3 on regulating RXR
acetylation (Fig. 4
, B and C, bottom panels). Together, these results demonstrated that TR3 has a unique role in antagonizing the p300-induced RXR
acetylation.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 4. Attenuation of p300-Induced RXR Acetylation by TR3
A, TR3 antagonized the acetylation of RXR induced by p300. Myc-TR3, together with GFP-RXR and HA-p300, were transfected into 293T cells. The levels of RXR acetylation were determined as described as Fig. 1B . B, TR3 inhibited acetylation of endogenous RXR . HeLa cells were transfected with Myc-TR3 and the levels of RXR acetylation (black arrow) were determined as described in Fig. 1C . White arrow indicates a heavy chain. C, Effect of siRNA-TR3 on RXR acetylation. HeLa cells were transfected with siRNA-TR3, and the levels of RXR acetylation (black arrow) were determined as described as Fig. 1C . The levels of RXR acetylation regulated by TR3 were quantified by densitometry in B and C. D, Interaction of RXR with TR3 and its deletion mutants. Schematic diagrams of deletion mutants of TR3 are shown at the top. 293T cells were transfected with GFP-RXR and Flag-TR3 or its different deletion mutants as indicated. Cell lysates were immunoprecipitated with anti-GFP antibody. The immunoprecipitates and cell lysates were then analyzed by Western blotting separately using anti-Flag-antibody for TR3 and its deletion mutants and anti-GFP antibody for RXR . E, Effect of TR3 deletion mutants on acetylation of RXR by p300. Flag-TR3 and its deletion mutants, together with GFP-RXR and HA-p300, were transfected into 293T cells, and the levels of RXR acetylation were determined as described in Fig. 1B .
|
|
TR3 may inhibit RXR
acetylation via interaction. We therefore constructed different deletion mutants of TR3 (Fig. 4D
) to test their interaction with RXR
. The results showed that TR3/
N but not TR3/
M could be efficiently precipitated with RXR
when coexpressed in 293T cells (Fig. 4D
), indicating that the amino acids 299–361 region of TR3 is important for the interaction with RXR
. Next, we introduced these two deletion mutants of TR3 into 293T cells to analyze their effects on RXR
acetylation. The p300-induced acetylation of RXR
could be inhibited by TR3/
N that interacted with RXR
but not by TR3/
M that failed to interact with RXR
(Fig. 4E
). Therefore, it is likely that interaction with RXR
is a prerequisite for TR3 to inhibit p300-induced acetylation of RXR
.
TR3 Competes with p300 for RXR
Binding
Because TR3 interacts with RXR
, it may compete with p300 in the RXR
binding to attenuate the p300-induced acetylation of RXR
. Coimmunoprecipitation/Western blotting confirmed that either TR3 or p300 was able to interact with RXR
independently, whereas RXR
point mutant K145R almost failed to bind with p300, although it still interacted with TR3 (Fig. 5A
). As we expected, increasing the amount of TR3 enhanced the TR3-RXR
interaction and decreased the p300-RXR
interaction, and vice versa (Fig. 5B
), indicating that TR3 and p300 bind to RXR
in a competition manner. We further transfected the HA-TR3, HA-p300, and Myc-RXR
into 293T cells and detected higher level of TR3 than p300 in RXR
immunoprecipitates (Fig. 5C
, right panel, lane 3), although HA-TR3 and HA-p300 were expressed at similar levels (Fig. 5C
, left panel, lane 3). This result further suggested that RXR
has a higher ability to interact with TR3 than p300 when both proteins coexist.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 5. TR3 Competed with p300 Binding to RXR
A, Interaction of RXR with TR3 or p300. 293T cells were transfected with HA-TR3, HA-p300, and Myc-RXR or its point mutant K145R as indicated. Cell lysates were immunoprecipitated with anti-HA antibody. The immunoprecipitates and cell lysates were then analyzed by Western blotting separately using anti-HA antibody for TR3, anti-HA antibody for p300, and anti-Myc antibody for RXR . B, TR3 and p300 bound to RXR competitively. Increasing amounts of TR3 or p300 together with RXR were transfected into 293T cells as indicated. Cell lysates were immunoprecipitated with anti-Myc antibody to pull down RXR . The immunoprecipitates and cell lysates were then analyzed by Western blotting separately using anti-HA antibody for p300 and anti-GFP antibody for TR3. C, The relative binding ability of p300 and TR3 to RXR . 293T cells were transfected with Myc-RXR , HA-TR3, and HA-p300. Western blot against the common HA tag was used to compare the expression levels of TR3 and p300 (left panel, indicated by arrow). Binding ability of TR3 and p300 to RXR is shown by using anti-HA antibody in RXR immunoprecipitates (right panel, indicated by arrow). D, Effect of TR3 and its deletion mutants on p300-RXR colocalization. Flag-TR3 or its deletion mutants together with Myc-RXR and HA-p300 were transfected into 293T cells as indicated. The transfected cells were immunostained by anti-Flag antibody followed by Alexa fluor 350-conjugated secondary antibody to detect TR3 and its point mutants, by anti-HA antibody followed by Texas Red-conjugated secondary antibody to detect p300, or by anti-Myc antibody followed by FITC-conjugated secondary antibody to detect RXR . Stained cells were visualized with the confocal microscope. The same data are plotted to indicate the percentage of cells with speckle RXR (bottom panel).
|
|
Confocal microscopic analysis revealed that transfection of TR3 inhibited the formation of RXR
-p300 speckles in 293T cells, with the percentage of cells containing p300/RXR
speckles dramatically dropped from 46.8 to 6.1%. Although TR3 colocalized with RXR
in a diffused pattern, p300 existed as microspeckles (Fig. 5D
). We further found that the TR3/
N mutant, but not the TR3/
M mutant, could interfere with the formation of RXR
/p300 speckles (Fig. 5D
). The percentage of cells with speckles was much higher in TR3/
M-transfected cells (39.3%) than in TR3/
N-transfected cells (11.0%). Therefore, the reduced colocalization of RXR
with p300 is most likely due to its sequestration by TR3.
9-cis Retinoic Acid Facilitates Translocation of Endogenous RXR
with TR3
Because 9-cis retinoic acid is a well known ligand for RXR
(23, 24), we went on to investigate how it regulates the physical interactions of RXR
with p300 and TR3 as well as the acetylation of RXR
by p300. Coimmunoprecipitation/Western blotting revealed that 9-cis retinoic acid enhanced the interaction of endogenous RXR
with TR3 and simultaneously decreased the interaction of RXR
with p300 (Fig. 6A
). The increased TR3/RXR
association consequently resulted in the translocation of both proteins from the nucleus to the mitochondria, which was seen in more than 65% of HeLa cells (Fig. 6B
). On the other hand, the acetylation level of RXR
in HeLa cells was reduced to some extent upon 9-cis retinoic acid treatment (Fig. 6C
, black arrow). This is most likely due to the attenuation of p300/RXR
association (Fig. 6A
), because the expression level of endogenous RXR
and p300 was not affected by 9-cis retinoic acid (Fig. 6C
, top panel), although the acetylation of RXR
was inhibited by 9-cis retinoic acid (Fig. 6C
, bottom panel). A similar result was also observed in MCF-7 cells (data not shown). As a consequence of the reduced acetylation, the transcriptional activity of RXR
in HeLa cells remained to be induced by 9-cis retinoic acid (Fig. 6D
, black bars) and slightly repressed by the transfection with an increased amount of TR3 (Fig. 6D
). Together, these results demonstrate that 9-cis retinoic acid facilitates RXR
translocation with TR3 rather than its acetylation by p300 in HeLa cells.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 6. 9-cis Retinoic Acid Facilitated Translocation Rather than Acetylation of RXR in the Presence of TR3
A, Effect of 9-cis retinoic acid on interactions of RXR with TR3 or p300. HeLa cells were treated with 9-cis retinoic acid (10–6 mol/liter) for 12 h. Cell lysates were prepared and immunoprecipitated with anti-TR3 and anti-p300 antibodies, respectively. The immunoprecipitates and cell lysates were then analyzed by Western blotting separately using anti-RXR , anti-TR3, and anti-p300 antibodies to detect endogenous TR3, RXR , or p300 proteins, respectively. IgG was used as control. B, Cotranslocation of TR3 and RXR from the nucleus to the mitochondria in HeLa cells induced by 9-cis retinoic acid. Cells were treated with or without 9-cis retinoic acid (10–6 mol/liter) for 12 h and then immunostained with anti-RXR , anti-TR3, and anti-Hsp60 antibodies, followed by their corresponding FITC-, Texas Red-, and Alexa fluor 350-conjugated secondary antibodies to show endogenous RXR , TR3, and Hsp60 proteins simultaneously. The fluorescent images were visualized under confocal microscope. C, Effect of 9-cis retinoic acid on RXR acetylation. To examine the effect of 9-cis retinoic acid on endogenous RXR acetylation, HeLa cells were treated with 9-cis retinoic acid (10–6 mol/liter) for 12 h before the levels of RXR acetylation were determined. White arrow indicates a heavy chain. The levels of RXR acetylation regulated by 9-cis retinoic acid were quantified by densitometry. D, Effect of 9-cis retinoic acid on RARE activity in HeLa cells. Cells were transfected with Myc-TR3 and then treated with 9-cis retinoic acid (10–6 mol/liter) for 6 h. The reporter gene activity was determined as described in Fig. 3A .
|
|
p300 and TR3 Have Distinct Cellular Functions through Regulation of RXR
Acetylation
Finally, we investigated the biological significance of p300 positive regulation and TR3 negative regulation on RXR
acetylation. p300 has been shown to promote apoptosis as well as cell proliferation, which appears to be highly context dependent (25, 26). We thus examined HeLa cells expressing p300, RXR
, and its point mutant for cell proliferation by using a bromodeoxyuridine (BrdU) assay. As shown in Fig. 7A
, RXR
did not show any effect on BrdU incorporation (first panel, green curve) compared with control. However, cotransfection of p300 with RXR
displayed an obvious increase in BrdU incorporation (first panel, blue curve). By contrast, p300DY failed to enhance BrdU incorporation even in the presence of RXR
(first panel, black curve), strongly suggesting that p300 functions as a mitogenic factor to stimulate cell growth, probably through inducing RXR
acetylation. We therefore used the RXR
point mutant to further characterize this possibility. Compared with RXR
, no increased BrdU incorporation was observed in cells transfected with K145R in the absence or presence of p300 (second panel, purple curve). These data thus indicate an important role of p300 acetylation on RXR
in cell proliferation by promoting mitogenic activity in HeLa cells.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 7. Different Functions of p300 and TR3 in Activating Mitogenic Activity and Inducing Apoptosis
A, Effects of RXR , p300, and TR3 on the mitogenic activity of HeLa cells. Different expression vectors, including RXR , p300, TR3, and their related mutants, were transfected into HeLa cells as indicated. After transfection, the cells were maintained in BrdU-containing medium for 2 h. The mitogenic activity was then identified by flow cytometry as described in Materials and Methods. B, TR3 and RXR induced apoptosis in HeLa cells. HeLa cells were transfected with GFP-TR3 and Myc-RXR or their mutants as indicated and then treated with 9-cis retinoic acid (10–6 mol/liter) for 48 h. The nuclear morphology stained by 4',6-diamidino-2-phenylindole was visualized under fluorescent microscope, and apoptotic cells were scored by examination of 500 transfected cells.
|
|
On the other hand, we found that TR3 could attenuate the p300-induced cell proliferation via RXR
in HeLa cells, as a clear left-shifted curve was seen (third panel, yellow curve). Moreover, like TR3, TR3/
N that bound to RXR
(Fig. 4D
) and blocked p300 acetylation (Fig. 4E
) also diminished the p300 effect on stimulating cell growth (third panel, gray curve), whereas TR3/
M that did not interact with RXR
(Fig. 4D
) failed to antagonize p300-induced mitogenic activity (third panel, pink curve). Based on these results and the fact that TR3 heterodimerization with RXR
facilitated their shuttling to the mitochondria in response to 9-cis retinoic acid (Fig. 6B
), it is possible that TR3 attenuation on RXR
acetylation might correlate with apoptosis induction, because mitochondrial targeting of TR3 is critical for triggering apoptosis in cancer cells (3, 5, 6), just as, for example, when TR3/RXR
-cotransfected HeLa cells were treated with 9-cis retinoic acid, more apoptotic cells were seen and the apoptotic rate reached to 24.5% (Fig. 7B
). Similar results were also observed in TR3
N/RXR
transfected cells (25.7% apoptotic cells) and K145R/TR3-transfected cells (18.4% apoptotic cells), but not in TR3
M/RXR
-transfected cells (less than 5%). We therefore concluded that p300 positively regulates RXR
acetylation to facilitate cell proliferation and TR3 negatively regulates RXR
acetylation for apoptosis induction.
 |
DISCUSSION
|
|---|
Posttranscriptional modification of nuclear receptors integrates a variety of signaling pathways (8). Although the exact number and variety of nuclear receptors that are acetylated in the cells is still largely unknown, it is clear that far more candidates are modified by this mechanism than initially appreciated. In the current study, we provide the first evidence that RXRs, including RXR
and RXR
, are acetylation targets of p300. Acetylation by p300 enhanced the DNA binding and activated the transcriptional activity of RXR
, thereby promoting cell proliferation. Furthermore, we found that TR3, an orphan receptor, functions as a negative regulator to attenuate RXR
acetylation by competition with p300 for RXR
binding. As a result, p300-mediated DNA binding of RXR
was repressed and RXR
turned to form a complex with TR3, which would translocate from the nucleus to the mitochondria to facilitate apoptosis induction in response to 9-cis retinoid acid. These findings allowed us to propose a novel model in which RXR
acetylation is positively regulated by p300 and negatively regulated by TR3 (Fig. 8
).
RXR
processed four candidate acetylation sites, and one of them, the lysine residue 145, could be acetylated by p300. Mutation of Lys145 to Arg greatly abrogated RXR
acetylation. As a result of acetylation, the transcriptional activity of RXR
was increased in a p300-dependent manner. Because K145 locates in the first zinc finger of the DNA-binding domain of RXR
(27), p300-induced RXR
acetylation might recruit RXR
to its response element. Indeed, in the presence of p300, much more RXR
was found to bind to its response element RXRE, whereas RXR
/K145R that could not be acetylated by p300 failed to do so. These results demonstrated a good consistency between structural characteristics of RXR
and biological function of p300 on regulation of RXR
acetylation.
So far, little is known about how the acetylation of nuclear receptors is regulated. We unexpectedly found that the orphan receptor TR3 could act as a negative factor to regulate the p300-induced acetylation of RXR
. TR3 seems to achieve its inhibitory effect on RXR
acetylation by competing with p300 for RXR
binding, because the interaction with RXR
was a prerequisite for TR3 to inhibit p300-induced RXR
acetylation. When RXR
, TR3, and p300 coexisted in cells, RXR
preferred to the interaction with TR3 rather than p300. 9-cis retinoic acid further enhanced the TR3/RXR
binding but decreased the p300/RXR
interaction. Therefore, TR3 regulation seems to be highly contextual and may be dependent on the relative expression levels of TR3, RXR
, and p300 in the cell. The cellular level of TR3 and p300 may act as a signal switch leading to diverse pathways: cell growth inhibition or cell proliferation. For example, a high level of TR3 may serve as a potent inhibitor of certain transcription factors by competing with p300 or disturbing p300 histone acetyltransferase activity directly. To address this possibility, more detailed analysis of other transcription factors should be carried out in future.
Previously, we found that RXR-selective retinoids SR11246 and SR11345 can induce the transcriptional activity of RXR
(28). However, we showed here that 9-cis retinoic acid, another well-known ligand for RXR
, promoted RXR
/TR3 translocation, rather than RXR
transcriptional activity. Such an effect of 9-cis retinoic acid appears to be contradictory to its known transcriptional activation of RXR
. In fact, our previous study found that RXR
undergoes nucleocytoplasmic shuttling (3). Like other nuclear receptors, it is not always statically associated with chromatin (29, 30, 31). Thus, it is likely that the fate of cellular RXR
may depend on distinct stimuli and cell contexts. For example, p300 facilitates RXR
DNA binding through acetylation, whereas 9-cis retinoic acid enhances the interaction of TR3 with RXR
and induces TR3/RXR
translocation. The difference between current (using 9-cis retinoic acid) and previous (using RXR-selective retinoids SR11246 and SR11345) results can be explained by the possibility that whether transcriptional activity or translocation of RXR
will be activated may depend on the natural properties of the compound. In support of this viewpoint, a published report revealed that the nonsteroidal antiinflammatory drug R-etodolac binds RXR
and acts as a RXR
antagonist to inhibit its transactivation, an event that is associated with its tumor-selective induction of apoptosis in animals (32). Our current observation that RXR
exhibits nucleocytoplasmic shuttling by itself and acts as a carrier for TR3 translocation from the nucleus to the mitochondria in response to 9-cis retinoic acid (3) also provides collateral evidence. Accordingly, RXR
nucleocytoplasmic localization appears to be one of the major factors determining 9-cis retinoic acid sensitivity.
Although increasing evidence supports the view that p300 can be under aberrant control in tumor cells (33), the importance of p300 in malignancy remains to be elucidated. RXRs usually form heterodimers with many members of the nuclear receptors (1, 2) and therefore play an essential role in regulation of multiple nuclear hormone-signaling pathways through their unique and potent dimerization capacity. Intriguingly, RXR
alone did not impair the BrdU incorporation rate, whereas coexpression of p300 increased the BrdU incorporation rate effectively, indicating that p300 might enhance the mitogenic ability by RXR
acetylation in HeLa cells. The fact that p300DY lost its ability to affect cell proliferation even in the presence of RXR
further verified that p300-stimulated cell proliferation was correlated with its ability to acetylate RXR
. More importantly, overexpression of TR3 diminished p300-induced cell proliferation by interacting with RXR
and cooperated with RXR
for apoptosis induction by translocating to the mitochondria in HeLa cells. There is no doubt that gaining further insights into the significance of this modification and translocation will be a benefit in facilitating the design of new approaches toward controlling malignancy of cancers.
In summary, different p300/RXR
and TR3/RXR
heterodimers in cells may exist in a dynamic equilibrium depending on their cellular environment. Abundant p300 may induce a dimerization interface switch that promotes RXR
DNA binding to ensure p300/RXR
colocalization and efficient transcriptional regulation, which finally contributes to cell proliferation. In contrast, TR3 may sequestrate RXR
from p300 and preferentially heterodimerize with RXR
through their mutual interaction. The TR3/RXR
heterodimer then translocates to the mitochondria to induce cell apoptosis. Our study reveals an unexpected role of TR3 in the cross-talk between orphan receptor and retinoid receptors and suggests that competition of TR3 and p300 for the regulation of RXR
acetylation might control a dynamic process between cell proliferation and cell apoptosis.
 |
MATERIALS AND METHODS
|
|---|
Cell Culture and Transient Transfection
The cell lines cervical cancer HeLa, human breast cancer MCF-7, and human embryonic kidney (HEK) 293T were obtained from American Type Culture Collection (Rockville, MD). All the cell lines were cultured in DMEM supplemented with 10% fetal bovine serum, 100 IU penicillin, and 100 µg/ml streptomycin. Transfection was performed using a calcium phosphate precipitation method for 293T cells as described previously (22) and liposomal transfection reagent (Fugene 6; Roche Molecular Biochemicals, Indianapolis, IN) for HeLa and MCF-7 cells according to the manufacturers instructions.
Coimmunoprecipitation and Western Blotting
Cells were transfected with various plasmids as required and incubated for 36 h before analysis. Cell lysate preparation, immunoprecipitation, and Western blotting were performed as described previously (7). Briefly, cell lysates were incubated with the appropriate antibody for 1 h and subsequently incubated with protein A-Sepharose beads for 1 h. The protein-antibody complexes that were recovered on beads were subjected to Western blot analysis after separation by SDS-PAGE. The immunoreactive products were detected by using enhanced chemiluminescence (Amersham, Arlington Heights, IL).
In Vivo Acetylation Assay
Cell lysates were extracted in cell lysis buffer [20 mmol/liter HEPES (pH7.5), 0.1 mol/liter KCl, 0.4 mmol/liter EDTA, 0.2% Nonidet P-40, 10 mmol/liter β-mercaptoethanol, 0.1 mmol/liter phenylmethylsulfonyl fluoride, 10 µg pepstatin/ml, 1 µg NaVO4/ml] and immunoprecipitated with anti-GFP antibody or anti-RXR
antibody (Santa Cruz Biotechnology, Santa Cruz, CA). The immunoprecipitates were then separated by SDS-PAGE and blotted with specific anti-acetyl-lysine antibody (Upstate Biotechnology, Lake Placid, NY).
Immunofluorescent Staining and Microscopic Observation
Cells seeded on coverglass overnight were fixed in 4% paraformaldehyde. To stain exogenous proteins including Myc-RXR
, HA-p300, and Flag-TR3 proteins, cells were incubated with different primary antibodies, including anti-Myc, anti-HA, or anti-Flag antibody, followed by the corresponding secondary antibodies. For observation of endogenous RXR
, TR3, or heat-shock protein 60 (Hsp60), cells were incubated with anti-RXR
, anti-TR3, or anti-Hsp60 (Santa Cruz) antibody, respectively, followed by fluorescein isothiocyanate (FITC)-, Texas red-, or Alexa fluor 350-conjugated secondary antibody. Nucleus was stained by 4',6-diamidino-2-phenylindole (DAPI) (Roche). Stained cells were visualized with confocal microscope (Leica TCS SP2 SE).
Luciferase Assay
Cells were transfected with various plasmids, including luciferase-linked reporter gene (Luc-RARE) (34), β-galactosidase (β-gal) expression vector, and the vector expressing RXR
, TR3, or p300 as required. After 36 h after transfection, luciferase activity was normalized for transfection efficiency using corresponding β-gal activity. The ratios of luciferase/β-gal activity were used as indicators for activity of RARE. All transfections were performed in duplicate, and the data are presented as means ± SD of at least three separate experiments.
EMSA
EMSA was done using a LightShift chemiluminescent EMSA kit (Pierce Chemical Co., Rockford, IL) with biotin-labeled oligonucleotide, corresponding to cellular retinol binding protein type II (CRBPII) RXRE (AGCTTCAGGTCAGAGGTCAGAGAGC; Invitrogen, Carlsbad, CA). After binding reaction, samples were loaded onto 6% polyacrylamide gel in 0.5x Tris-borate-EDTA buffer and electrophoresed at 100 V at 4 C for 2 h. Biotin-labeled, double-stranded DNA was electrophoretically transferred to positively charged nylon membrane (Hybond-N; Amersham Pharmacia Biotech, Little Chalfont, UK). After cross-linking the transferred DNA to membrane, biotin-labeled DNA was integrated with streptavidin-horseradish peroxidase conjugate. Finally, chemiluminescence was detected using enhanced chemiluminescence. For the supershift experiment, 5.0 µg nuclear extract was incubated with 200 ng anti-GFP antibody for 2 h (Santa Cruz) before incubation with the biotin-labeled probe.
ChIP Assay
Cells were cross-linked with 0.75% formaldehyde for 10 min, and then the cross-linking was stopped by adding glycine. Cells were collected in PBS and resuspended in FA lysis buffer [50 mM HEPES-KOH (pH 8.0), 140 mM NaCl, and 1% Triton X-100] with 1x protease inhibitor cocktail (Roche) and then sonicated. After centrifugation, 10% of the total supernatant was saved as total input control. The remaining supernatant was diluted 10-fold in dilution buffer [1.0% Triton X-100, 2 mM EDTA, 150 mM NaCl, and 20 mM Tris-HCl (pH 8.0)] and divided into two parts, incubating with or without 2 µg polyclonal anti-Myc antibody (Santa Cruz) overnight at 4 C separately. After immunoprecipitation, 30 µl protein A/G-Sepharose was added, and cells were incubated for another 2 h at 4 C. Sepharose beads were washed sequentially in low-salt wash buffer [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl (pH 8.0), and 150 mM NaCl] three times and in high-salt wash buffer [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl (pH 8.0), and 500 mM NaCl] one time, and beads were then extracted with 200 µl elution buffer (1% SDS, 0.1 M NaHCO3). Two microliters of RNase A (0.5 mg/ml) were added and then heated at 65 C for 5 h to reverse the formaldehyde cross-linking. DNA fragments were purified with a DNA purification kit. For quantitative PCR, the primer sequence (RARβ promoter) was as follows: sense 5'-CTCCTCCCCTGCTCATTTTA-3' and antisense 5'-CTGCCTCTGAACAGCTCACT-3'.
BrdU Assay
Cells were incubated with 5-bromo-2'-deoxyuridine (5-BrdU, 20 µmol/liter; Sigma Chemical Co., St. Louis, MO) for 2 h. After washing with PBS, cells were fixed with 4% paraformaldehyde for 30 min at 4 C and then incubated with saponin (0.1%) for another 10 min. The cells were washed twice with PBS containing 0.1% saponin and resuspended in PBS containing 30 µg DNase I. After incubation with anti-BrdU antibody (Santa Cruz) for 1 h, cells were given two PBS washes and then incubated with phycoerythrin-linked antimouse antibody. Finally, cells were washed with PBS, and analyzed by flow cytometry (Beckman Coulter, Inc., Fullerton, CA).
 |
ACKNOWLEDGMENTS
|
|---|
We are grateful to Dr. Tso-pang Yao (Duke University, Durham, NC) for Myc-p300DY vector, Dr. Mirjam T. Epping (The Netherlands Cancer Institute, Amsterdam, The Netherlands) for RARE3-TK-LUC vector, and Dr. Richard Eckner (University of New Jersey, Newark, NJ) for HA-p300 vector.
 |
FOOTNOTES
|
|---|
This work was supported by the National Outstanding Young Science Foundation (30425014), The National Natural Science Foundation (30570936), grants from the Ministry of Science and Technology of China (2004CCA02100 and 2007CB914402), and a grant from the Ministry of Education of China (IRT0649).
Disclosure Summary: The authors have nothing to disclose.
First Published Online August 30, 2007
Abbreviations: BrdU, Bromodeoxyuridine; ChIP, chromatin immunoprecipitation; FITC, fluorescein isothiocyanate; β-gal, β-galactosidase; GFP, green fluorescent protein; Hsp60, heat-shock protein 60; RAR, retinoic acid receptor; RARE, retinoic acid response element; RXR, retinoid X receptor; RXRE, RXR response element; siRNA, small interfering RNA; TR, thyroid hormone receptor.
Received for publication February 26, 2007.
Accepted for publication August 22, 2007.
 |
REFERENCES
|
|---|
- Mangelsdorf DJ, Evans RM 1995 The RXR heterodimers and orphan receptors. Cell 83:841–850[CrossRef][Medline]
- Kastner P, Mark M, Chambon P 1995 Nonsteroid nuclear receptors: what are genetic studies telling us about their role in real life? Cell 83:859–869[CrossRef][Medline]
- Lin XF, Zhao BX, Chen HZ, Ye XF, Yang CY, Zhou HY, Zhang MQ, Lin SC, Wu Q 2004 RXR
acts as a carrier for TR3 nuclear export in a 9-cis retinoic acid-dependent manner in gastric cancer cells. J Cell Sci 117:5609–5621[Abstract/Free Full Text] - Cao X, Liu W, Lin F, Li H, Kolluri SK, Lin B, Han YH, Dawson MI, Zhang XK 2004 Retinoid X receptor regulates Nur77/TR3-dependent apoptosis [corrected] by modulating its nuclear export and mitochondrial targeting. Mol Cell Biol [Erratum (2005) 25:524] 24:9705–9725[CrossRef]
- Li H, Kolluri SK, Gu J, Dawson MI, Cao X, Hobbs PD, Lin B, Chen G, Lu J, Lin F, Xie Z, Fontana JA, Reed JC, Zhang X 2000 Cytochrome c release and apoptosis induced by mitochondrial targeting of nuclear orphan receptor TR3. Science 289:1159–1164[Abstract/Free Full Text]
- Wu Q, Liu S, Ye XF, Huang ZW, Su WJ 2002 Dual roles of Nur77 in selective regulation of apoptosis and cell cycle by TPA and ATRA in gastric cancer cells. Carcinogenesis 23:1583–1592[Abstract/Free Full Text]
- Zhao BX, Chen HZ, Lei NZ, Li GD, Zhao WX, Zhan YY, Liu B, Lin SC, Wu Q 2006 p53 mediates the negative regulation of MDM2 by orphan receptor TR3. EMBO J 25:5703–5715[CrossRef][Medline]
- Fu M, Wang C, Zhang X, Pestell RG 2004 Acetylation of nuclear receptors in cellular growth and apoptosis. Biochem Pharmacol 68:1199–1208[CrossRef][Medline]
- Bannister AJ, Miska EA, Gorlich D, Kouzarides T 2000 Acetylation of importin-
nuclear import factors by CBP/p300. Curr Biol 10:467–470[CrossRef][Medline] - Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87:953–959[CrossRef][Medline]
- Gu W, Roeder RG 1997 Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell 90:595–606[CrossRef][Medline]
- Martinez-Balbas MA, Bauer UM, Nielsen SJ, Brehm A, Kouzarides T 2000 Regulation of E2F1 activity by acetylation. EMBO J 19:662–671[CrossRef][Medline]
- Munshi N, Merika M, Yie J, Senger K, Chen G, Thanos D 1998 Acetylation of HMG I(Y) by CBP turns off IFNβ expression by disrupting the enhanceosome. Mol Cell 2:457–467[CrossRef][Medline]
- Soutoglou E, Katrakili N, Talianidis I 2000 Acetylation regulates transcription factor activity at multiple levels. Mol Cell 5:745–751[CrossRef][Medline]
- Kiernan RE, Vanhulle C, Schiltz L, Adam E, Xiao H, Maudoux F, Calomme C, Burny A, Nakatani Y, Jeang KT, Benkirane M, Van LC 1999 HIV-1 tat transcriptional activity is regulated by acetylation. EMBO J 18:6106–6118[CrossRef][Medline]
- Fu M, Wang C, Wang J, Zhang X, Sakamaki T, Yeung YG, Chang C, Hopp T, Fuqua SA, Jaffray E, Hay RT, Palvimo JJ, Janne OA, Pestell RG 2002 Androgen receptor acetylation governs trans activation and MEKK1-induced apoptosis without affecting in vitro sumoylation and trans-repression function. Mol Cell Biol 22:3373–3388[Abstract/Free Full Text]
- Fu M, Rao M, Wang C, Sakamaki T, Wang J, Di VD, Zhang X, Albanese C, Balk S, Chang C, Fan S, Rosen E, Palvimo JJ, Janne OA, Muratoglu S, Avantaggiati ML, Pestell RG 2003 Acetylation of androgen receptor enhances coactivator binding and promotes prostate cancer cell growth. Mol Cell Biol 23:8563–8575[Abstract/Free Full Text]
- Wang C, Fu M, Angeletti RH, Siconolfi-Baez L, Reutens AT, Albanese C, Lisanti MP, Katzenellenbogen BS, Kato S, Hopp T, Fuqua SA, Lopez GN, Kushner PJ, Pestell RG 2001 Direct acetylation of the estrogen receptor
hinge region by p300 regulates transactivation and hormone sensitivity. J Biol Chem 276:18375–18383[Abstract/Free Full Text] - Kim MY, Woo EM, Chong YT, Homenko DR, Kraus WL 2006 Acetylation of estrogen receptor
by p300 at lysines 266 and 268 enhances the deoxyribonucleic acid binding and transactivation activities of the receptor. Mol Endocrinol 20:1479–1493[Abstract/Free Full Text] - Hsu CH, Chang MD, Tai KY, Yang YT, Wang PS, Chen CJ, Wang YH, Lee SC, Wu CW, Juan LJ 2004 HCMV IE2-mediated inhibition of HAT activity downregulates p53 function. EMBO J 23:2269–2280[CrossRef][Medline]
- Perlmann T, Jansson L 1995 A novel pathway for vitamin A signaling mediated by RXR heterodimerization with NGFI-B and NURR1. Genes Dev 9:769–782[Abstract/Free Full Text]
- Wu Q, Li Y, Liu R, Agadir A, Lee MO, Liu Y, Zhang X 1997 Modulation of retinoic acid sensitivity in lung cancer cells through dynamic balance of orphan receptors nur77 and COUP-TF and their heterodimerization. EMBO J 16:1656–1669[CrossRef][Medline]
- Heyman RA, Mangelsdorf DJ, Dyck JA, Stein RB, Eichele G, Evans RM, Thaller C 1992 9-cis retinoic acid is a high affinity ligand for the retinoid X receptor. Cell 68:397–406[CrossRef][Medline]
- Levin AA, Sturzenbecker LJ, Kazmer S, Bosakowski T, Huselton C, Allenby G, Speck J, Kratzeisen C, Rosenberger M, Lovey A 1992 9-cis retinoic acid stereoisomer binds and activates the nuclear receptor RXR
. Nature 355:359–361[CrossRef][Medline] - Yao TP, Oh SP, Fuchs M, Zhou ND, Chng LE, Newsome D, Bronson RT, Li E, Livingston DM, Eckner R 1998 Gene dosage-dependent embryonic development and proliferation defects in mice lacking the transcriptional integrator p300. Cell 93:361–372[CrossRef][Medline]
- Yuan ZM, Huang Y, Ishiko T, Nakada S, Utsugisawa T, Shioya H, Utsugisawa Y, Shi Y, Weichselbaum R, Kufe D 1999 Function for p300 and not CBP in the apoptotic response to DNA damage. Oncogene 18:5714–5717[CrossRef][Medline]
- Prufer K, Barsony J 2002 Retinoid X receptor dominates the nuclear import and export of the unliganded vitamin D receptor. Mol Endocrinol 16:1738–1751[Abstract/Free Full Text]
- Wu Q, Dawson MI, Zheng Y, Hobbs PD, Agadir A, Jong L, Li Y, Liu R, Lin B, Zhang XK 1997 Inhibition of trans-retinoic acid-resistant human breast cancer cell growth by retinoid X receptor-selective retinoids. Mol Cell Biol 17:6598–6608[Abstract/Free Full Text]
- McNally JG, Muller WG, Walker D, Wolford R, Hager GL 2000 The glucocorticoid receptor: rapid exchange with regulatory sites in living cells. Science 287:1262–1265[Abstract/Free Full Text]
- Tyagi RK, Lavrovsky Y, Ahn SC, Song CS, Chatterjee B, Roy AK 2000 Dynamics of intracellular movement and nucleocytoplasmic recycling of the ligand-activated androgen receptor in living cells. Mol Endocrinol 14:1162–1174[Abstract/Free Full Text]
- Baumann CT, Maruvada P, Hager GL, Yen PM 2001 Nuclear cytoplasmic shuttling by thyroid hormone receptors. Multiple protein interactions are required for nuclear retention. J Biol Chem 276:11237–11245[Abstract/Free Full Text]
- Kolluri SK, Corr M, James SY, Bernasconi M, Lu D, Liu W, Cottam HB, Leoni LM, Carson DA, Zhang XK 2005 The R-enantiomer of the nonsteroidal antiinflammatory drug etodolac binds retinoid X receptor and induces tumor-selective apoptosis. Proc Natl Acad Sci USA 102:2525–2530[Abstract/Free Full Text]
- Chan HM, La Thangue NB 2001 p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J Cell Sci 114:2363–2373[Abstract/Free Full Text]
- Epping MT, Wang L, Edel MJ, Carlee L, Hernandez M, Bernards R 2005 The human tumor antigen PRAME is a dominant repressor of retinoic acid receptor signaling. Cell 122:835–847[CrossRef][Medline]
NURSA Molecule Pages Link:
- Nuclear Receptors:
RXRα
|
RXRβ
|
RXRγ
|
NGFIB
- Coregulators:
p300
- Ligands:
9-cis-Retinoic acid
This article has been cited by other articles:

|
 |

|
 |
 
N.-z. Lei, X.-y. Zhang, H.-z. Chen, Y. Wang, Y.-y. Zhan, Z.-h. Zheng, Y.-m. Shen, and Q. Wu
A feedback regulatory loop between methyltransferase PRMT1 and orphan receptor TR3
Nucleic Acids Res.,
February 1, 2009;
37(3):
832 - 848.
[Abstract]
[Full Text]
[PDF]
|
 |
|