help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2006-0059
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Al-Dhaheri, M. H.
Right arrow Articles by Rowan, B. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Al-Dhaheri, M. H.
Right arrow Articles by Rowan, B. G.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Breast Cancer
Hazardous Substances DB
*ESTRADIOL
*TAMOXIFEN
Molecular Endocrinology 21 (2): 439-456
Copyright © 2007 by The Endocrine Society

Protein Kinase A Exhibits Selective Modulation of Estradiol-Dependent Transcription in Breast Cancer Cells that Is Associated with Decreased Ligand Binding, Altered Estrogen Receptor {alpha} Promoter Interaction, and Changes in Receptor Phosphorylation

Mariam H. Al-Dhaheri and Brian G. Rowan

Department of Biochemistry and Cancer Biology, Health Science Campus, University of Toledo, Toledo, Ohio 43614

Address all correspondence and requests for reprints to: Brian G. Rowan, Ph.D., Department of Structural & Cellular Biology, SL49, Tulane University School of Medicine and the Louisiana Cancer Research Consortium, 1430 Tulane Avenue, New Orleans, Louisiana 70112. E-mail: browan{at}tulane.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Inhibition of protein kinase A (PKA) promotes estrogen-dependent growth of MCF7 breast cancer cells, although the mechanisms by which PKA regulates estrogen receptor (ER) function remain unclear. In this study elevation of cAMP by forskolin/3-isobutyl-1-methylxanthine (F/I) suppressed estradiol-dependent MCF7 and T47D breast cancer cell growth but not tamoxifen-resistant MCF7-LCC2 cells. Although F/I induced ligand independent activation of ER{alpha}, F/I also decreased estradiol-dependent reporter gene transcription. Overexpression of PKA or PKA inhibitor (PKI) demonstrated that F/I effects on repression of estradiol action occurred through the PKA pathway. 8CPT-2Me-cAMP, a selective inducer of non-PKA signaling, did not alter ER-dependent transcription. In contrast to F/I effects on reporter genes, F/I exhibited gene-specific effects on endogenous, ER-regulated genes. F/I enhanced estradiol induction of pS2 and cMyc but repressed estradiol induction of cyclin D1 mRNA and protein in MCF7 cells. To explore likely mechanisms by which F/I regulated ER, experiments examined estradiol binding, Hsp90 interaction, promoter recruitment, and ER{alpha} phosphorylation. F/I decreased estradiol binding and increased Hsp90 association with ER{alpha}. Chromatin immunoprecipitation revealed that F/I recruited ER{alpha} to both pS2 and cMyc promoters at earlier times than estradiol, and F/I shifted estradiol recruitment of ER{alpha} to earlier time points. F/I induced a unique ER{alpha} phosphorylation profile (increase in serine 305 and decrease in serine 118 phosphorylation) that was distinct from estradiol and estradiol + F/I. Taken together, F/I signaling through PKA selectively regulates estradiol-dependent genes in breast cancer, which is associated with reduced ligand binding and changes in promoter interaction and ER{alpha} phosphorylation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE ESTROGEN RECEPTOR (ER) is a ligand-dependent transcription factor involved in normal growth and differentiation of mammary tissue. However, uncontrolled ER signaling can initiate and promote the growth of breast cancer. Regulation of the ER signaling pathway is a complex process that involves ER subtype ligand-ER conformation, DNA response element, homo- vs. heterodimerization, coregulators, and cellular kinases/phosphatases among other events (for review, see Refs. 1, 2, 3, 4).

In the classical, ligand-dependent activation of ER, estrogen binding increases ER phosphorylation at specific sites (4) that facilitate ER dimerization and direct interaction with estrogen response elements (EREs) in the promoter of estrogen target genes (5). Liganded ER recruits a set of transcriptional coactivators with associated histone acetyltransferase activity that facilitates transcriptional activation. At some promoters, ER regulates transcription not through direct interaction with DNA but through binding to other transcription factors at the promoter including Sp-1 (6, 7), activator protein 1 (AP-1) (8, 9), GATA-1 (10), and nuclear factor-{kappa}B (11). In addition to ligand-dependent activation, ER may also be activated in the absence of ligand by cross talk with signal transduction pathways that is associated with changes in receptor and coregulator phosphorylation (12, 13, 14, 15, 16, 17, 18).

Protein kinase A (PKA), a holoenzyme composed of two regulatory subunits and two catalytic subunits, phosphorylates substrate proteins on serine/threonine residues. cAMP-dependent pathways govern many endocrine and neural functions. Elevated intracellular cAMP binds to the regulatory subunit of PKA causing phosphorylation of the catalytic subunit of PKA. The phosphorylated catalytic subunit then translocates to the nucleus and phosphorylates transcription factors such as cAMP response element (CRE)-binding protein (CREB) and CRE modulator (19). In addition to activating PKA signaling, cAMP also activates Epac (exchange protein directly activated by cAMP), a pathway that exhibits guanine nucleotide exchange activity (20, 21).

PKA signaling promotes ligand-independent activation of ER{alpha} and regulates ligand-dependent ER{alpha} activation (1, 18, 22, 23, 24). Fujimoto and Katzenellenbogen (23) showed that activation of PKA in MCF7 breast cancer cells alters the agonist/antagonist balance of antiestrogens. PKA phosphorylates ER at serine 236 within the DNA-binding domain, and this phosphorylation inhibits ER dimerization in the absence of estradiol (15). Activation of the PKA signaling protects ER{alpha} from estrogen-induced degradation and promotes ER protein stability (25). In addition, PKA phosphorylates ER{alpha} at S305, which is associated with tamoxifen resistance (26) and reduced ER{alpha} acetylation (27).

Activated PKA inhibits both human breast cancer proliferation (28) and estrogen-regulated cell growth (29) in which ER{alpha} contributes to cAMP level and activity (28, 29). However, the mechanisms by which PKA inhibits ER{alpha}-positive breast cancer growth and affects both ligand-dependent and ligand-independent activation of ER{alpha} in breast cancer remain unclear. Here we demonstrate gene-specific regulation of ER-dependent genes by forskolin/3-isobutyl-1-methylxanthine (F/I) that may underlie F/I suppression of breast cancer proliferation. We further describe the molecular signaling pathways and mechanisms that occur during ligand-independent activation by F/I and F/I suppression of estradiol action in breast cancer cells.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
cAMP Signaling through PKA Decreases Estradiol Activation of ER-Dependent Promoters
Forskolin is a well-known inducer of cAMP signaling in tamoxifen-sensitive MCF7 breast cancer cells (30). To measure the effect of F/I on ER transcriptional activity, MCF7 cells was transfected with the ER-dependent ERE2e1b-luciferase [estrogen response element (ERE)-TATA-luc] or ERE2TK-luciferase (ERE-TK-luc) reporter genes. F/I induced ligand-independent activation of ERE-TATA-luc (Fig. 1AGo, bar 4) and ERE2TK-luciferase (Fig. 1BGo, bar 4) in MCF7 cells. Although the magnitude of the ligand-independent activation by F/I relative to estradiol activation varied among experiments, the ligand-independent activation by F/I was consistently and quantitatively less than estradiol activation. This variability of the ligand-independent activation was likely due to subtle changes in intracellular kinase/phosphatase activity present during different experiments. Remarkably, F/I reduced full reporter activation by estradiol for both the ERE-TATA-luc and the ERE-TK-luc reporters (Fig. 1Go, A and B, bars 5). 4-hydroxytamoxifen [4-(OH)-Tam] did not activate ERE-TATA-luc or ERE-TK-luc (Fig. 1Go, A and B, bars 3) and repressed the basal transcriptional activity of these ERE-containing promoters. Basal reporter activity could be the result of residual estrogen present in the charcoal-stripped fetal bovine serum (FBS) and/or the result of ER{alpha} ligand-independent activation by growth factors present in the medium.


Figure 1
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 1. F/I Induced Ligand-Independent Activation of ER{alpha} and Decreased Estradiol (E2)-Dependent Transcription in MCF7 Cells

A and B, MCF7 cells were plated in six-well plates (0.5 x 106/well) for 24 h in phenol red-free DMEM containing 10% FBS that had been treated with charcoal to remove endogenous steroids. Each well was transfected with ERE-TATA-Luc (500 ng) (A) or ERE-TK-luc (500 ng) (B) for 24 h, followed by incubation with estradiol (10–8 M), 4-(OH)-tamoxifen (10–7 M), or F/I (forskolin, 10 µM; IBMX, 100 µM) for an additional 18 h. Cell extracts were prepared, and standard luciferase reporter activity was measured as described in Materials and Methods. Data were normalized to the total protein amount of each sample. *, Significant difference compared with vehicle treatment; {dagger}, Significant difference compared with estradiol treatment. P < 0.05 was considered significant. Data are representative of results from at least three separate experiments. RLU, Relative luciferase units.

 
Elevation of cAMP by F/I can activate both PKA and the Epac effectors of cAMP signaling (20). To determine whether the F/I suppression of estradiol-dependent reporter activation occurred through the PKA or Epac pathways, ER-dependent reporter activity was measured after selective activation/inhibition of PKA or the Epac signaling pathways. Overexpression of PKA or PKA inhibitor (PKI) was used to measure PKA effects on reporter activity. Incubation of cells with 8CPT-2Me-cAMP, a specific activator of the Epac signaling pathway, was used to measure Epac effects on reporter activity.

Overexpression of PKA, but not PKI, significantly repressed estradiol activation of ERE-TK-luc (Fig. 2AGo). In these experiments, tamoxifen antagonist action was assessed by the ability of tamoxifen to repress estradiol activation of the reporter gene (Fig. 2AGo, bar 2 vs. bar 4). Overexpression of PKA completely repressed estradiol activation of the reporter (Fig. 2AGo, bar 2 vs. bar 5) and enhanced the tamoxifen repression of estradiol activation (Fig. 2AGo, bar 4 vs. bar 6). In contrast, overexpression of PKI had only modest effects on estradiol activation (Fig. 2AGo, bar 2 vs. bar 7) and did not alter tamoxifen repression of estradiol activation (Fig. 2AGo, bar 4 vs. bar 8). Results similar to those described in Fig. 2AGo were found with the ERE-TATA-luc reporter (data not shown).


Figure 2
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 2. F/I Decreased Estradiol (E2) Activation of ER{alpha} via PKA Signaling and Reversed Tamoxifen (Tam) Resistance in MCF7-LCC2 Cells

MCF7 (A, B, E, and F), T47D (C), and MCF7-LCC2 (D) cells were plated in six-well plates (0.5 x 106/well) in medium containing 5% charcoal-stripped FBS for 24 h. Each well was transfected with ERE-TK-Luc (500 ng) (A–D) or CRE-Luc (500 ng) (E and F) along with empty vector, PKA, or PKI expression vector for 24 h. Cells were incubated with estradiol (10–8 M), 4-(OH)-tamoxifen (10–7 M), F/I (forskolin, 10 µM; IBMX, 100 µM), or 8CPT-2Me-cAMP (10 µM) as indicated for an additional 18 h. Cell extracts were prepared, and standard luciferase reporter activity was measured as described in Materials and Methods. Data were normalized to the total protein amount of each sample. *, Significant difference compared with vehicle treatment; {dagger}, significant difference compared with estradiol treatment. P < 0.05 was considered significant. Data are representative of results from at least three separate experiments. RLU, Relative luciferase units.

 
Epac signaling is a separate pathway downstream of elevated cAMP. In contrast to the PKA pathway, activation of the Epac pathway by 8CPT-2ME-cAMP had no significant effect on estradiol-induced reporter activation in MCF7 cells (Fig. 2BGo). Examination of another tamoxifen-sensitive breast cancer cell line (T47D) revealed that overexpression of PKA in T47D cells decreased estradiol-dependent reporter activation (Fig. 2CGo, bar 2 vs. bar 5), whereas overexpression of PKI actually increased estradiol-dependent reporter activation (Fig. 2CGo, bar 2 vs. bar 6). Similar to MCF7 cells, 8CPT-2Me-cAMP had no significant effect on estradiol-dependent reporter activity in T47D cells (data not shown).

MCF7-LCC2 cells are resistant to tamoxifen antagonism of estradiol reporter activation (Fig. 2DGo, bar 2 vs. bar 4). Interestingly, overexpression of PKA repressed both estradiol reporter activation and estradiol + tamoxifen reporter activation in MCF7-LCC2 cells (Fig. 2DGo, bars 2 and 4 vs. bars 5 and 6). In contrast, overexpression of PKI had no significant effect on estradiol alone (Fig. 2DGo, bar 2 vs. bar 7) and only partially blocked estradiol + tamoxifen reporter activation in MCF7-LCC2 cells (Fig. 2DGo, bar 4 vs. bar 8). Incubation of cells with 8CPT-2ME-cAMP exhibited effects similar to that found with overexpression of PKI in MCF7-LCC2 cells (data not shown). To confirm the functional activity of the PKA and PKI expression vectors and of F/I treatment, MCF7 cells were cotransfected with the cAMP and PKA-activated CRE-luciferase (CRE-luc) reporter. Overexpression of PKA (Fig. 2EGo) or incubation of cells with F/I (Fig. 2FGo) resulted in significant activation of the CRE-luc reporter. In contrast, PKI reduced basal CRE-luc reporter activity (Fig. 2EGo). Incubation of cells with 8CPT-2Me-cAMP showed no significant effect on reporter activity (Fig. 2FGo). Nonspecific effects of F/I on general transcription were assessed by transfection of MCF7 cells with the constitutive Rous sarcoma virus (RSV)-Luc reporter. F/I, at the concentrations used in this study, had no effect on RSV-Luc activation (data not shown). The results presented above are consistent with F/I regulation of ER-dependent reporter gene activity occurring through selective activation of PKA, but not Epac signaling.

Gene-Selective Effects of F/I on ER-Dependent Transcription
The above data indicated that elevation of cAMP induced ligand-independent activation of ER and also suppressed full estradiol activation of ER-dependent reporter genes. To more comprehensively assess F/I effects on ER-regulated gene expression, four well-characterized ER-regulated genes in MCF7 cells were measured using real-time RT-PCR. F/I exhibited distinct differences in regulation of cMyc, pS2, progesterone receptor (PR), and cyclin D1 mRNA, and this regulation was markedly different from F/I effects on the ER-dependent reporter genes. F/I alone induced the expression of pS2, PR, and cMyc mRNA in MCF7 cells (Fig. 3Go, panels A, B, and C, respectively). However, in stark contrast to F/I effects on the ERE-TATA-luc and ERE-TK-luc reporters, F/I in combination with estradiol actually elevated mRNA for pS2 and cMyc above that of estradiol alone (Fig. 3Go, A and C, {square} vs. {blacksquare}). The relative effects of F/I or F/I + estradiol on cMyc mRNA corresponded to similar changes observed with cMyc protein levels (Fig. 3DGo). Although all treatments (F/I, F/I + estradiol, and estradiol) resulted in a rapid induction of cyclin D1 mRNA at 2 h, only estradiol treatment resulted in induction of cyclin D1 protein (Fig. 3FGo, lane 2) as previously reported (31, 32, 33). However, the rapid and transient induction of cyclin D1 mRNA at 2 h by F/I and F/I + estradiol was not sufficient to induce cyclin D1 protein. Notably, only estradiol treatment resulted in a reproducible and significant induction of cyclin D1 mRNA at 18 h treatment. It is likely that the sustained induction of cyclin D1 mRNA by estradiol at later time points was responsible for the increased cyclin D1 protein. F/I induction of ER target gene mRNA was ER-dependent because both 4-hydroxytamoxifen (Fig. 3GGo) and ICI 182,780 (data not shown) significantly reduced F/I induction of cMyc mRNA. F/I induction of PR, cyclin D1, and pS2 mRNA was also blocked by 4-hydroxytamoxifen and ICI 182,780 (data not shown).


Figure 3
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 3. Gene-Selective Effects of F/I on ER-Dependent Transcription

MCF7 cells (4 x 106) were plated in 10-cm dishes for 3 d in phenol red-free DMEM containing 5% charcoal-stripped FBS. Cells were incubated with estradiol (E2) (10–8 M), F/I (forskolin, 10 µM; IBMX, 100 µM), 4-(OH)-tamoxifen (Tam)(10–7 M), or combinations for the indicated times or for 2 h in panel G. Cells were harvested, and RNA was extracted and reverse transcribed to cDNA. Gene expression of pS2 (A), progesterone receptor (PR) (B), cMyc (C and G), and cyclin D1 (E) was measured by real-time RT-PCR normalized to GAPDH. For protein expression, MCF7 cells were incubated with estradiol (10–8 M), 4-(OH)-tamoxifen (10–7 M), F/I, or a combination of ligand + F/I for 24 h. Cells were harvested and total cellular extract was prepared in high-salt lysis buffer. cMyc (D) and cyclin D1 (F) protein expression was measured by Western blot normalized to ß actin. *, Significant difference compared with vehicle treatment. P < 0.05 was considered significant. Data are representative of results from at least three separate experiments.

 
The differences between F/I effects in reporter gene assays vs. endogenous gene expression are probably related to fundamental differences between the artificial and natural promoters. The ERE-e1b reporter gene assay represents a simple ERE-driven promoter that is not subject to regulation by other transcription factors. In contrast, endogenous genes are subject to more complex regulation by other transcription factors. Whereas endogenous genes represent a more realistic appraisal of the overall effects of F/I on gene expression, reporter gene analysis has utility in assessing direct effects of F/I on ER{alpha} transcriptional activity. Reporter gene assays were used in conjunction with endogenous gene expression to assess overall effects on gene expression.

F/I Rapidly Recruits ER{alpha} to pS2 and cMyc Promoters and Alters Estradiol-ER{alpha} Cyclic Recruitment
Estradiol-activated ER{alpha} can bind directly to ERE sequences in promoters or may interact with DNA indirectly through protein-protein interactions with other transcription factors (e.g. AP-1 and SP1 proteins) (4). ER{alpha} is recruited to promoters in a cyclic fashion involving successive rounds of recruitment and dissociation (34, 35, 36). The ER{alpha} recognition sequences in the cMyc and pS2 promoters have been well characterized. ER{alpha} is recruited to the ERE region of the pS2 promoter (37) (Fig. 4AGo) and ERE and AP-1 regions of the cMyc promoter (38) (Fig. 4BGo). To measure the effect of activated cAMP on ER{alpha} association with cMyc and pS2 promoters, quantitative chromatin immunoprecipitation (ChIP) assays were performed as previously described by our laboratory (13). Incubation of MCF7 cells with F/I for 45 min significantly increased the association of ER{alpha} with ERE sequences in the pS2 promoter (Fig. 4CGo, closed bar) and with the ERE/AP1 sequences in the cMyc promoter (Fig. 4CGo, open bar). In contrast, treatment with estradiol or F/I + estradiol did not recruit ER{alpha} to these promoters at this early (45 min) time point (Fig. 4CGo). However, at longer incubation periods (2 h), incubation with estradiol, but not F/I or F/I + estradiol, significantly increased ER{alpha} association with the pS2 promoter (Fig. 4DGo, closed bar) and with the cMyc promoter (Fig. 4DGo, open bars). To further examine time-dependent ER{alpha} recruitment to the cMyc promoter and to determine the relative differences between F/I and estradiol, time course recruitment of ER{alpha} to the cMyc gene was assessed. ER{alpha} regulates cMyc transcription through both ERE and AP-1 sequences that are in close proximity to one another. Consequently, ChIP assays for the cMyc promoter assessed combined ER{alpha} recruitment to ERE and AP1 sequences. ER{alpha} recruitment to the cMyc promoter was significantly increased by F/I at 1 h, F/I + estradiol at 1.5 h, and estradiol at 2 h (Fig. 4EGo, bullet, {blacksquare}, and {square}, respectively). A similar trend was observed for the ERE sequence of the pS2 promoter (data not shown).


Figure 4
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 4. F/I Rapidly Recruits ER{alpha} to pS2 and cMyc Promoters and Alters Estradiol (E2) Time-Dependent Cycling of ER{alpha}

A and B represent a schematic map of ERE and AP-1 sequence in the pS2 and cMyc promoters. MCF7 cells (10 x 106) were plated in 15-cm dishes in phenol red-free DMEM containing 5% charcoal-stripped FBS for 3 d. Cells were incubated for 45 min (C), 2 h (D), and for the indicated time (E) with estradiol (10–8 M), F/I (forskolin, 10 µM; IBMX, 100 µM) or F/I + estradiol, and cells were prepared for quantitative ChIP with antibody to ER{alpha} as described in Materials and Methods. DNA was purified and ER target promoter sequences of pS2 and cMyc were amplified by the real-time PCR method. Data were normalized to the input values. *, Significant difference compared with vehicle treatment. P < 0.05 was considered significant. Data are representative of results from at least three separate experiments.

 
These preceding data reveal several features about F/I vs. estradiol effects on ER{alpha} promoter recruitment in MCF7 cells. F/I, but not estradiol, induces a rapid recruitment of ER{alpha} to pS2 and cMyc promoters. Promoter recruitment by estradiol is delayed (2 h), but this delay is shifted to earlier time points (1.5 h) by the addition of F/I to estradiol treatments.

F/I Reduces Estradiol Binding to ER{alpha} and Is Accompanied by Increased Association of ER{alpha} with Hsp90
To examine possible mechanisms by which PKA represses estradiol-dependent transcription of selected genes, the effect of F/I on estradiol binding in intact cells was examined in MCF7 (Fig. 5AGo), MCF7-LCC2 (Fig. 5BGo), and T47D cells (Fig. 5CGo). F/I significantly reduced estradiol binding by 45% in all cell lines. Because ER{alpha} is expressed approximately 4-fold higher than ERß in MCF7 cells (Fig. 5DGo), the reduced estradiol binding by F/I was due predominantly to effects on ER{alpha}. ERß protein expression in MCF7 cells was low compared with ER{alpha} (Fig. 5DGo) as previously reported (39), and detection by Western blot using crude cellular extract was weak. To confirm expression of ERß in MCF-7 cells, ERß was immunoprecipitated from cells followed by detection by Western blot (Fig. 5EGo). Notably, decreased ligand binding by F/I was not the result of reduced ER{alpha} protein because F/I as well as estradiol did not significantly alter ER{alpha} protein levels at 2 h incubation and earlier (refer to Fig. 7BGo). Interestingly, F/I had no effect on estradiol binding to purified ER{alpha} (Fig. 5FGo), indicating that other cellular processes, and not direct F/I interaction with ER{alpha}, were required for reduced ligand binding. Although reduced ligand binding may contribute to F/I antagonism of estradiol activation of cyclin D1 and the ERE-TATA-luc and ERE-TK-luc reporters, the reduced ligand binding by F/I was not sufficient to suppress estradiol induction of cMyc, pS2, and PR.


Figure 5
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 5. F/I Blocks Estradiol Binding to ER{alpha} in MCF7, MCF7-LCC2, and T47D Cells

MCF7 (A), MCF7-LCC2 (B), and T47D (C) cells (0.5 x 106/well) were plated in six-well plates for 3 d and pretreated with F/I (forskolin, 10 µM; IBMX, 100 µM) for 1 h. Cells were incubated with 1.5 nM 3H-labeled estradiol in the presence or absence of 1.5 µM cold estradiol for 1 h. Cells were washed with PBS and incubated with absolute ethanol for 20 min at room temperature. Samples were collected, and radioactivity was measured and normalized to the total protein amount. D, ER{alpha} and ERß in crude cellular extract of MCF7 cells were detected by Western blot and quantified based on the signal of the purified ER{alpha} and ERß (50 ng). E, MCF7 cells were plated in a 15-cm dish for 3 d and harvested, and total cellular extract was prepared. ERß antibody were incubated first with Protein A Sepharose beads for 2 h, and the beads were washed twice with PBS and then incubated with the total cellular extraction at 4 C for 18 h with rotation. Beads were washed three times with PBS/0.1% Triton X-100, and ERß was eluted by boiling 5 min in SDS loading buffer. ERß was detected by Western blot. F, Purified ER{alpha} (500 ng) was preincubated with FI, vehicle, or ICI 182,780 (10–9 M) for 1 h. [3H]estradiol (1 µM) was added with or without 10 mM cold estradiol and incubated on ice for 1 h. DCC slurry was added for 30 sec, and DCC was separated by centrifugation. Supernatant samples were collected and radioactivity was measured in counts per min. *, Significant difference compared with vehicle treatment. P < 0.05 was considered significant. Data are representative of results from at least three separate experiments. H.C., Heavy chain; L.C., light chain.

 

Figure 7
View larger version (41K):
[in this window]
[in a new window]

 
Fig. 7. F/I-Regulated Changes in Estradiol (E2)-Dependent ER{alpha} Phosphorylation

A, Schematic presentation of human ER{alpha} phosphorylation sites. B, MCF7 cells (4 x 106) were plated in 10-cm dishes in phenol red-free DMEM containing 5% stripped FBS for 3 d and incubated with estradiol (10–8 M), F/I (forskolin, 10 µM; IBMX, 100 µM), or combination of estradiol and F/I for 2 h. Cells were harvested, lysed in high-salt buffer, and subjected to Western blot analysis by using the indicated phosphoantibody. Phosphorylation of ER{alpha} was normalized to ER{alpha} expression level. C and D, Western blot signals were quantified for S118 phosphorylation (C) and S305 phosphorylation (D) after different treatments. Phosphoantibody signal was normalized to the total ER{alpha} protein expression. *, Significant difference compared with vehicle treatment. P < 0.05 was considered significant. Data are representative of results from three separate experiments. Ph-, Phospho.

 
Because Hsp90 dissociates from ER upon ligand binding (40), it was of interest to determine whether reduced ligand binding by F/I altered Hsp90 interaction with ER{alpha}. F/I significantly increased Hsp90 association with ER{alpha} in MCF7 cells (Fig. 6AGo). As a control we assessed ligand binding and Hsp90 interaction in HeLa cells, an ER-negative cell line in which ER{alpha} is activated by F/I (Fig. 6BGo) as previously reported (16). In HeLa cells transfected with ER{alpha} expression vector, F/I had no effect on estradiol binding (Fig. 6CGo). In parallel, F/I did not alter the Hsp90 interaction with ER{alpha} in HeLa cells (Fig. 6DGo). These data suggest that increased association of Hsp90 with ER{alpha} may be related to the selective attenuation of estradiol binding by F/I in MCF7 cells and may further lead to selective gene activation by F/I (currently under investigation).


Figure 6
View larger version (26K):
[in this window]
[in a new window]

 
Fig. 6. F/I-Regulated Decrease in Estradiol (E2) Binding Is Accompanied by Increased Association of Hsp90 with ER{alpha} in MCF7 Cells

A, MCF7 cells (4 x 106) were plated in 10-cm dishes for 3 d in phenol red-free DMEM containing 5% stripped serum. Cells were incubated with vehicle or F/I (forskolin, 10 µM; IBMX, 100 µM) for 2 h, and cells were harvested and lysed in HEMG buffer. ER{alpha} (D12) antibody was incubated with protein A Sepharose beads for 2 h at room temperature. Beads were added to the cellular extract and incubated at 4 C for 18 h. Beads were collected and washed, and ER was eluted by adding SDS loading buffer and boiling samples for 5 min. Samples were subjected to Western blot analysis by immunoblotting with Hsp90 antibody, and the signal was normalized to ER{alpha} expression. B, HeLa cells (0.5 x 106/well) were plated in six-well plates, and each well was transfected with ERE-TK-luc (500 ng) along with ER{alpha} expression vector for 24 h followed by incubation with vehicle, estradiol (10–8 M), or F/I [forskolin (10 µM) + IBMX (100 µM)] for an additional 18 h. Luciferase activity was measured as described in Materials and Methods, and data were normalized to the total protein amount of each sample. C, HeLa cells (4 x 106) were plated in 10-cm dishes for 24 h and transfected with ER{alpha} expression vector for 24 h. Cells were harvested, (1 x 106), and then were replated in six-well plates for 24 h, and ligand binding was measured as described in Materials and Methods. D, HeLa cells (4 x 106) were plated in 10-cm dishes and transfected with ER{alpha} expression vector (500 ng) for 24 h. Cells were treated with vehicle or F/I for 2 h, and coimmunoprecopitation was applied as described above in panel A. *, Significant difference compared with vehicle treatment. P < 0.05 was considered significant. Data are representative of results from at least three separate experiments. RLU, Relative luciferase units; H.C., heavy chain.

 
F/I Alters the Phosphorylation Profile of ER{alpha}
ER{alpha} is phosphorylated on eight residues (Fig. 7AGo), and receptor phosphorylation is known to regulate multiple receptor functions including nuclear translocation, ligand binding, ER dimerization, and transcriptional activation (3, 41). To identify F/I-induced changes in ER{alpha} phosphorylation that may contribute to altered gene expression, phospho-specific antibodies to each ER{alpha} phosphorylation site were developed (42) and used to profile ER{alpha} phosphorylation in MCF7 cells. The major effect of F/I on ER{alpha} phosphorylation was the induction of S305 phosphorylation, reduction of S118 phosphorylation, and suppression of the estradiol-induced S118 phosphorylation (Fig. 7Go, B–D). Other effects of F/I and estradiol on ER{alpha} phosphorylation were less pronounced although consistent: estradiol induced phosphorylation at sites S104, S106, S118, S167, S236, S305, T311, and Y537 (Fig. 7BGo, lane 2); F/I suppressed estradiol induction of S118, S236, and Y537 (Fig. 7BGo, lane 2 vs. lane 4). F/I repression of estradiol-induced phosphorylation likely contributed to F/I-regulated decreases in ligand binding and estradiol-dependent gene activation. The effects of F/I and F/I + estradiol on S167 phosphorylation were inconsistent (data not shown). F/I and estradiol effects of ER{alpha} phosphorylation were not the result of changes in ER{alpha} protein level. Although previous reports showed that estradiol significantly decreased ER{alpha} protein in MCF7 cells by 4 h and inhibition of PKA by H-89 decreased ligand-free ER{alpha} protein in MCF7 cells (43), at incubation periods used in the present study (2 h and earlier) estradiol and F/I did not alter ER{alpha} protein levels (Figs. 5–7GoGoGo).

F/I resulted in a distinct ER{alpha} phosphorylation profile (decreased S118 and increased S305 phosphorylation) that was markedly different from vehicle or estradiol-induced phosphorylation. S118 is a MAPK consensus site that is phosphorylated after estradiol treatment and via cross talk with ERK1/ERK2 signaling (3, 17). PKA phosphorylates ER{alpha} at S305 (26). Further experimentation investigated the involvement of S305 and S118 phosphorylation in F/I action. Because F/I decreased basal S118 phosphorylation, the effect of F/I on ERK1/ERK2 signaling was examined by Western blot analysis using phospho-specific antibodies to activated ERK1/ERK2. Activation/inhibition of ERK1/ERK2 by PKA is cell line and tissue dependent (33, 44, 45, 46). Overexpression of PKA in MCF-7 cells decreased basal phosphorylation of ERK1/ERK2 (Fig. 8AGo, lane 2). In addition, incubation of MCF-7 cells with F/I resulted in rapid decrease in ERK1/ERK2 phosphorylation (Fig. 8AGo, lanes 4–7). These data suggest that in MCF-7 breast cancer cells, PKA repressed S118 phosphorylation via reduced ERK1/ERK2 activation.


Figure 8
View larger version (26K):
[in this window]
[in a new window]

 
Fig. 8. F/I Regulation of ERK1/ERK2 Phosphorylation and Role of S305 Phosphorylation in F/I Regulation of ER{alpha}

A, MCF7 cells (4 x 106) were plated in 10-cm dishes for 3 d in phenol red-free DMEM containing 5% charcoal-stripped FBS. Cells were transfected with empty or PKA expressing vector for 48 h or incubated with F/I (forskolin, 10 µM; IBMX, 100 µM) for the indicated times. Cells were harvested, and total cellular extract was prepared in high-salt lysis buffer. ERK1/ERK2 phosphorylation was detected by Western blot normalized to the total ERK1/ERK2 protein expression. B, MCF7 cells were plated in six-well plates (0.5 x 106/well) for 24 h in phenol red-free DMEM containing 10% FBS that had been treated with charcoal to remove endogenous steroids. Each well was cotransfected with ERE-TK-luc (500 ng) along with wild-type ER{alpha} (25 ng) or ER{alpha}S305A vector (25 ng) for 24 h, followed by incubation with estradiol (E2) (10–8 M), F/I (forskolin, 10 µM; IBMX, 100 µM), or a combination for an additional 18 h. Cell extracts were prepared, and standard luciferase reporter activity was measured as described in Materials and Methods. Data were normalized to the total protein amount of each sample and expressed as percent vehicle treatment for each expressing vector. *, Significant difference compared with vehicle treatment. {dagger}, Significant difference compared with estradiol treatment. P < 0.05 was considered significant. Data are representative of results from three separate experiments. Ph-, Phospho.

 
Mutation of S118 to alanine results in reduced ligand-dependent and ligand-independent activation of ER{alpha} (13, 48, 49) and therefore F/I suppression of S118 phosphorylation likely contributes to F/I effect on reducing estradiol activation of selected genes. However, ligand-independent activation of ER{alpha} by F/I would not likely be explained by suppression of S118 phosphorylation. To investigate the involvement of S305 in F/I action, ER{alpha} wild type or ER{alpha}S305A mutant was overexpressed in MCF7 cells, and ERE-TK-luc reporter activity was measured. F/I induced ligand independent activation of wild-type ER{alpha} and decreased estradiol-dependent activation of ERE-TK-luc (Fig. 8BGo). With overexpression of ER{alpha}S305A, there was reduced ligand-independent activation by F/I compared with overexpression of wild-type ER{alpha}, and F/I did not significantly reduce estradiol activation of the reporter. This suggests that S305 contributes to both F/I ligand-independent activation of ER{alpha} and to the F/I-dependent attenuation of estradiol activation of the reporter.

In summary, F/I, estradiol, and estradiol + F/I resulted in three distinct ER{alpha} phosphorylation profiles in MCF7 cells. These profiles likely represent three different ER{alpha} conformations that are important for differences in time-dependent recruitment of ER{alpha} to pS2 and cMyc promoters and define the gene-selective action of F/I and estradiol.

F/I Suppresses MCF7 Cell Growth
MCF7 cells are dependent upon estradiol for proliferation (30), and forskolin exhibits an antiproliferative effect in MCF7 cells through activation of PKA signaling (29). The effect of F/I on estradiol-dependent growth of several ER{alpha}-positive breast cancer cell lines was measured at different times. At 72 h estradiol significantly induced growth of MCF7 (Fig. 9AGo, {blacksquare}) and T47D cells (Fig. 9BGo, {blacksquare}) but did not promote growth of tamoxifen-resistant MCF7-LCC2 cells (data not shown) as previously reported (50). F/I alone (10 µM) decreased growth of MCF7 (Fig. 9AGo, {square}) and T47D cells (Fig. 9BGo, {square}) but had no effect on MCF7-LCC2 cells (data not shown). Similar results were observed at lower concentrations of F/I (1 and 5 µM) for MCF-7 cells (data not shown). Remarkably, F/I significantly inhibited the estradiol-dependent growth of MCF7 and T47D cells ({blacktriangleup} in Fig. 9Go, A and B, respectively).


Figure 9
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 9. F/I Suppressed MCF7 and T47D Breast Cancer Cell Growth

MCF7 (A) or T47D (B) cells (20 x 103) were plated in 24-well plates in medium containing 5% charcoal-stripped FBS. After 24 h, cells were incubated with vehicle, estradiol (E2) (10–8 M), F/I (Forskolin 10 µM; IBMX, 100 µM), or a combination in triplicate with one additional treatment at 48 h. Cell growth was measured by MTT assay at the indicated time points as described in Materials and Methods. *, Significant difference compared with vehicle treatment; {dagger}, significant difference compared with 48-h time point. P < 0.05 was considered significant. Data are representative of results from at least three separate experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Previous studies using reporter gene analysis indicate that ligand-independent activation of ER amplifies estradiol action and disrupts the agonist/antagonist balance of tamoxifen, the end result being promotion of breast cancer cell proliferation (23, 51) Similar to MAPK (18), PKA induced ligand-independent activation of ER{alpha} (18), although activated PKA also inhibited breast cancer cell growth (28, 52) and estrogen-induced cell growth (29). The present study investigated F/I-activated signaling pathways leading to regulation of ER{alpha} transcriptional activity in breast cancer cells. F/I induced ligand-independent activation of ER{alpha} but decreased estradiol activation of ER{alpha}-dependent reporter genes specifically through PKA signaling. In contrast to general effects on reporter genes, F/I had gene-selective effects on endogenous ER-regulated transcription in which F/I induced PR, cMyc, and pS2 but repressed cyclin D1 expression. Associated with the gene-selective effects of F/I was decreased estradiol binding, increased ER{alpha} association with Hsp90, rapid recruitment of ER{alpha} to cMyc and pS2 promoters, and a unique ER{alpha} phosphorylation profile that was distinct from basal and estrogen-induced phosphorylation. F/I and activation of PKA suppressed breast cancer cell growth and inhibited estradiol-dependent cell growth in accordance with a previous study showing that inhibition of PKA signaling promoted estradiol-dependent cell growth (29). Possibly, the inhibition of cyclin D1 by F/I and PKA is involved in PKA suppression of estradiol-dependent cell growth.

Elevation of cAMP by F/I resulted in ER{alpha} ligand-independent activation in MCF7, T47D, and MCF7-LCC2 breast cancer cell lines but, unexpectedly, F/I decreased ER{alpha} activation by estradiol for selected genes. Dissecting the cAMP effect on estradiol-dependent reporter activity revealed that the PKA signaling pathway attenuated estradiol-dependent reporter activity in all cell lines and also reversed tamoxifen resistance in MCF7-LCC2 cells. Unlike PKA, activating Epac signaling (20) by 8CPT-2Me-cAMP treatment had no significant effect on ER{alpha} activation and only partially reversed tamoxifen resistance in MCF7-LCC2 cells. To our knowledge, this is the first report that separates the Epac pathway from effects on ER{alpha} signaling in breast cancer cells after elevation of intracellular cAMP.

Previous studies demonstrated conflicting results for PKA effects on ER-dependent reporters. Inhibition of PKA by H-89 significantly stimulated ligand-independent activation of ER{alpha} and enhanced estradiol-dependent transcriptional activity in MCF7 cells stably transfected with an ERE-luc reporter (43). In contrast, Katzenellenbogen and co-workers (23) reported that overexpression of PKA or treatment with cholera toxin (CT)/3-isobutyl-1-methylxanthine (I) induced estradiol-dependent activity of (ERE)2-TATA-CAT but not ERE-TK-CAT. In addition, PKA or CT/I treatment altered tamoxifen antagonism but had no significant effect on ligand-independent activation of ER{alpha} in MCF7 cells. Data presented here using endogenous ER-regulated genes regulated by different promoters provide evidence that the conflicting data with reporter genes are likely related to the gene-specific effects of F/I.

Although F/I attenuated estradiol activation of reporter genes, F/I demonstrated a selective activation of endogenous genes containing complex promoters. F/I had no effect on estradiol-dependent transcription of PR and exhibited an additive effect on estradiol-dependent transcription of cMyc and pS2 mRNA. Similar results with pS2 were reported by El Tanani and Green (53) in which elevation of cAMP by CT/I exhibited an additive effect on estradiol-dependent transcription of the pS2 and LIV-1 genes in MCF7 cells. In the present study, F/I induced cyclin D1 mRNA at early time points similar to results with estradiol treatment. However, at later time points F/I repressed estradiol induction of cyclin D1 mRNA with the end result being suppression of estradiol-induced cyclin D1 protein. The differences in the ER-regulated promoter sequences in each of these genes may provide clues to the F/I-selective repression of cyclin D1 but not cMyc, PR, or pS2. (The role of specific ERE sequences in ER promoter interaction is reviewed in Ref. 54 .) Estradiol regulates cMyc transcription through ERE and AP-1 sequences (38), PR transcription through ERE, AP-1, and SP1 sequences (55, 56), and pS2 transcription through ERE, SP1, and SP3 sequences (37, 57). In contrast, although cyclin D1 contains a partial and imperfect ERE (58), ER regulates cyclin D1 predominantly through a cAMP response element (CRE) in MCF7 cells (31). In addition, Nadella and Kirschner (59) provided clear genetic evidence that cyclin D1 expression was regulated by PKA signaling. ATF-2 binding to the CRE is crucial for activation of the cyclin D1 promoter, and it is possible that F/I treatment disrupts this interaction. Although Sabbah et al. (31) reported that forskolin had no effect on cyclin D1 promoter activity in MCF7 cells, the effect of forskolin or F/I on ATF-2 binding to the CRE was not investigated. It was reported that PKA inhibits the cyclin D1 promoter by phosphorylation of CREB that binds to the CRE (32). CREB may compete with ATF-2 for binding to the CRE and prevent cyclin D1 activation by ER.

There are likely both direct and indirect effects of F/I on ER{alpha}. F/I induction of ER target genes was ER dependent, i.e. both 4-hydroxytamoxifen or ICI, 182,780 were able to reverse F/I induction of ER target genes. F/I reduced ER{alpha} ligand binding and increased association of ER{alpha} with Hsp90. Some of these effects of F/I on ER function are likely related to direct effects of F/I on altering ER{alpha} phosphorylation at serines 305 and 118. However, these data do not exclude the possibility that F/I regulates ER function through indirect mechanisms.

This is the first report to demonstrate ligand-independent recruitment of ER{alpha} to pS2 and cMyc promoters induced by F/I. Recruitment of ER{alpha} by F/I was rapid and, similar to estradiol, occurred in a cyclic fashion. However, a clear correlation between F/I recruitment of ER{alpha} to promoters and levels of mRNA induction could not be made. It will be of interest to profile the proteins associated with ER{alpha} at each promoter during both ligand-independent activation and ligand-dependent activation to determine whether different protein complexes contribute to selective gene activation by F/I and PKA signaling (currently under investigation).

It is widely accepted that ligand binding is regulated by both Hsp90 association and nuclear receptor phosphorylation (4, 41, 60, 61, 62). In the absence of ligand, Hsp90 interacts with the ligand-binding domain of ER{alpha} (63) and dissociates upon ligand binding, leading to tight association of ER{alpha} with the nuclear compartment (60). In the present study, F/I increased Hsp90 association with ER{alpha}, which was accompanied with a decrease in ligand binding. As shown in HeLa and MCF7 cells, the F/I effect on ligand binding was correlated with Hsp90 association with ER{alpha}. This suggests that F/I induces conformational changes in ER{alpha} and/or Hsp90 that decrease estradiol binding and increase Hsp90 association (the effect of estradiol or F/I + estradiol on Hsp90 association with ER{alpha} could not be examined because estradiol results in tight association of ER{alpha} with nuclear structures, thereby preventing extraction for coimmunoprecipitation assays). Remarkably, decreased estradiol binding and increased association of ER{alpha} with Hsp90 by F/I did not prevent ER{alpha} recruitment to promoters, suggesting that an ER{alpha}-Hsp90 complex may be present at the promoter as previously suggested for the GR-Hsp90 complex (64).

F/I, estradiol, and F/I + estradiol resulted in three distinct ER{alpha} phosphorylation profiles. In general, ligand-independent activity of ER{alpha} results from changes in AF-1 (A/B) domain phosphorylation (4), S118 phosphorylation, a MAPK site that is enhanced by estradiol (2), is required for full ER{alpha} transcriptional activity by estradiol (13, 17). S118 phosphorylation was dramatically reduced by F/I and F/I + estradiol compared with vehicle. It is likely that activation of PKA by F/I in MCF7 cells blocks MAPK phosphorylation. In this context, PKA suppression of MAPK could also reduce steroid receptor coactivator 1 regulation of ER (46) because steroid receptor coactivator 1 contains several MAPK consensus sites that are required for full coactivator activity (63, 65). S305 is contained within a PKA consensus sequence located at the interface of the hinge (D) domain and the ligand binding (E/F) domain and within the nuclear localization region (63). A previous study showed that forskolin results in phosphorylation of S305 in U2OS osteosarcoma cells (26) and Cos-1 cells transfected with wild-type ER{alpha} (42). The present study demonstrates the involvement of S305 in the ligand-independent activity as well as in repressing estradiol-dependent transcription of ERE-luciferase-containing promoter. The dual effect of PKA on ER{alpha} phosphorylation in MCF7 cells (induction of S305 and suppression of S118 phosphorylation) may explain both the ligand-independent activity (induction of S305) and suppression of estradiol-dependent activity (suppression of S118), at least for the simple promoters present in the reporter genes.

Interestingly, F/I did not induce phosphorylation of S236, a PKA consensus site (15), but instead modestly inhibited estradiol-dependent phosphorylation of S236 as well as Y537. S236 phosphorylation prevents ER{alpha} dimerization in the absence of estradiol (15). Y537 phosphorylation regulates ligand binding and transcriptional activity (60, 61). Similar to suppression of S118 phosphorylation, F/I inhibition of S236 and Y537 would be consistent with the reduced estradiol binding and reduced ligand-dependent activation observed here. A similar effect of forskolin was reported by Blok et al. (66) where forskolin blocked androgen binding to its cognate receptor by dephosphorylating androgen receptor. Remarkably, F/I in combination with estradiol resulted in a unique and distinct phosphorylation profile compared with estradiol or F/I alone (phosphorylation of S104, S106, S305, and T311). S104 and S106 can be phosphorylated by estradiol binding or by cross talk with cyclin A/cyclin-dependent kinase 2 signaling (67), and these sites potentiate estradiol action and induce ligand-independent activation of ER{alpha} (67). T311 is phosphorylated by a P38{alpha}/SAPK2a complex and regulates ER{alpha} nuclear localization (68).

It is widely believed that ER{alpha} posttranslational modifications, including phosphorylation, affect chromatin remodeling and ER{alpha} promoter occupancy (69). Therefore, the differences in ER{alpha} phosphorylation profiles represented by the three different treatment regimens (estradiol, F/I, or estradiol + F/I) likely result in distinct receptor conformations that impact the dynamic association of ER{alpha} with ER target promoters. F/I regulated dual phosphorylation events (induction of S305 phosphorylation and repression of S118 phosphorylation) that were correlated with rapid recruitment of ER{alpha} to pS2 and cMyc promoters. Recently, Kumar and co-workers (70) found that mutation of S118 to alanine (mimic dephosphorylation) and mutation of S305 to glutamic acid (mimic phosphorylation) inhibited estradiol-dependent transcription. This dual mutant is very similar to the ER{alpha} phosphorylation pattern induced by F/I and reproduces the F/I suppression of estradiol activation of the reporter. F/I + estradiol treatment resulted in three additional phosphorylation events (phosphorylation of S104, S106, and T311) and was associated with a delay in ER{alpha} promoter recruitment compared with F/I alone, whereas estradiol alone resulted in phosphorylation of eight ER{alpha} phosphorylation sites and was associated with further delay in promoter recruitment.

F/I alone inhibited growth of ER{alpha}-positive, tamoxifen-sensitive MCF7 and T47D breast cancer cells but not ER{alpha} positive, tamoxifen-resistant MCF7-LCC2 cells. Furthermore, F/I blocked estradiol-dependent growth of tamoxifen-sensitive breast cancer cells. Previous studies reported an antiproliferative effect of cAMP in MCF7 cells in which ER{alpha} contributed to cAMP levels and activity (28, 29), and ER{alpha} predicted the antiproliferative effect of cAMP (29). However, activated cAMP also suppressed growth of ER{alpha}-negative MDA-MB-231 breast cancer cells (28), suggesting an ER{alpha}-independent pathway for cAMP growth suppression. de Cremoux and colleagues (71) characterized tamoxifen-resistant sublines of MCF7 cells and found that both ER{alpha} and PR mRNA were decreased and ERß mRNA was increased in MCF7-LCC2 cells compared with parental, tamoxifen-sensitive MCF7 cells. In addition, the differences in the bcl-2/bax ratio and overexpression of TGFß in MCF7-LCC2 cells possibly contributed to resistance (72). It is likely that combined changes in ER{alpha} expression, TGFß expression, and the bcl-2/bax ratio contribute to the inability of F/I to have an antiproliferative effect on MCF7-LCC2 cells.

It is likely that the inhibition of cyclin D1 by F/I contributes to suppression of estradiol-dependent growth of breast cancer cells. Typically, estradiol regulates cell cycle progression from the G0–G1 phase by induction of cMyc and cyclin D1 followed by activation of Cdk4 and Cdc25A enzymatic activity in a time-dependent manner (73). It is possible that the antiproliferative effect of PKA is mediated, in part, by inhibition of cyclin D1, which in turn blocks cells at G0–G1. F/I induction of cMyc alone would not be sufficient for cells to progress through the G1 phase.

A model for estradiol and F/I effects on ER{alpha} activation in breast cancer cells is presented in Fig. 10Go. Estradiol treatment dissociated the Hsp90-ER{alpha} complex and induced all ER{alpha} phosphorylation sites, resulting in transcription of reporter genes and endogenous genes (cMyc, pS2, PR, and cyclin D1) and breast cancer cell growth (Fig. 10AGo). In contrast, F/I (Fig. 10BGo) increased Hsp90-ER{alpha} association, decreased estradiol binding, induced S305, and repressed S118 phosphorylation. This was accompanied by ligand-independent activation of ER{alpha} and decrease of estradiol-dependent reporter activity in a PKA-dependent manner. However, the F/I effect on estradiol-dependent transcription was gene specific, resulting in inhibition of cyclin D1 expression and inhibition of breast cancer cell growth. Cross talk between PKA and estradiol signaling (Fig. 10CGo) resulted in a unique phosphorylation profile and also inhibited estradiol induction of cyclin D1 expression that may inhibit estradiol-dependent growth of breast cancer cells (29).


Figure 10
View larger version (23K):
[in this window]
[in a new window]

 
Fig. 10. Model for F/I Regulation of ER{alpha} Gene Expression in Breast Cancer Cells

A, Estradiol-dependent activation of ER{alpha} in breast cancer cells. Estradiol binds to ER{alpha}, causing dissociation of Hsp90 and phosphorylation of ER{alpha}. Activated ER{alpha} induces the transcription of ER target genes and promotes breast cancer cell growth. B, cAMP-dependent activation of ER{alpha} in breast cancer cells. PKA induces S305 phosphorylation and increases Hsp90 association with ER{alpha} that results in selective gene expression. Inhibition of cyclin D1 is associated with decrease in tamoxifen-sensitive breast cancer cell growth. C, Cross talk between PKA and estradiol signaling results in phosphorylation of ER{alpha} at S104, S106, S305, and T311 that is associated with decreased ligand binding. Cross talk between PKA and estradiol also inhibited cyclin D1 expression that is likely involved in PKA inhibition of estradiol-dependent cell growth.

 

    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Reagents
17ß-Estradiol and 4-hydroxytamoxifen (4-(OH)-Tam) were purchased from Sigma (St. Louis, MO). Forskolin, Coleus forskohlii, and 3-isobutyl-1-methylxanthine (IBMX) were purchased from Calbiochem (San Diego, CA). 8CPT-2Me-cAMP was purchased from Tocris (Ellisville, MO). Cyclin D1 (DCS-6), cMyc (C-8), ER{alpha} (D12), and actin (C-11) antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). ER-P-S104, ER-P-S106, ER-P-S118, ER-P-S167, ER-P-S236, ER-P-S305, ER-P-T311, and ER-P-Y537 antibodies were provided by Bethyl Laboratories (Montgomery, TX). ER{alpha} (VP-E613) antibody, peroxidase-labeled antimouse and peroxidase-labeled antirabbit were purchased from Vector Laboratories (Burlingame, CA). ERß (14C8) antibody was purchased from GeneTex (San Antonio, TX). Protein A Sepharose beads (CL-4B) were purchased from Amersham Biosciences (Piscataway, NJ). Protein A magnetic beads were purchased from New England Biolabs (Ipswich, MA).

Cell Culture
MCF7 ER{alpha}-positive tamoxifen-sensitive breast cancer cells and HeLa cells were maintained in phenol red-free DMEM containing 10% FBS, 1% Penicillin/streptomycin, and 2% glutamine. T47D ER{alpha}-positive tamoxifen-sensitive breast cancer cells were maintained in phenol red-free RPMI media containing 10% FBS, 1% Penicillin/streptomycin, and 5 µg/ml insulin. MCF7-LCC2 ER{alpha}-positive tamoxifen-resistance breast cancer cells were maintained in phenol red-free incomplete MEM containing 5% stripped FBS (FBS were incubated with dextran-coated charcoal to remove steroids). All cells were incubated at 37 C and 5% CO2.

Luciferase Assay
MCF7, T47D, MCF7-LCC2, or HeLa cells (0.5 x 106) were plated in each well of six-well plates in medium containing 5% stripped FBS for 48 h. Cells were transfected with ERE2e1b-firefly luciferase, ERE2TK-firefly luciferase, or CRE-firefly luciferase by using Fugene 6 (Roche Diagnostics, Indianapolis, IN) for 24 h. In experiments in which overexpression of PKA, PKI, wild-type ER{alpha}, or ER{alpha}S305A was performed, ER{alpha}S305A (obtained from Dr. Rakesh Kumar, University of Texas M.D. Anderson Cancer Center), pFC-PKA, RSV-PKI (obtained from Dr. Mario Ascoli, University of Iowa), ER{alpha}-pCR3.1, or empty vector were transfected along with the reporter constructs. Cells were incubated with vehicle, 17ß-estradiol (10–8 M), 4-hydroxytamoxifen (4-(OH)-Tam) (10–7 M), forskolin (10 µM) + IBMX (100 µM) (F/I), or 8CPT-2Me-cAMP for 18 h. Media were replaced with 400 µl of 1x sodium dodecyl sulfate (SDS) lysis buffer and incubated for 1 h at –70 C, and firefly luciferase activity was measured using the Luciferase Assay System Kit from Promega Corp. (Madison, WI). Relative luciferase units were normalized to the total protein content of each sample. Constitutive Renilla luciferase [1-phRL-null reporter vector (Promega)] and pCMV-ß-gal reporters were markedly activated by F/I treatment and/or overexpression of PKA and PKI precluding normalization of ERE2e1b-firefly luciferase and ERE2TK-firefly luciferase assays to transfection efficiency (data not shown).

Real-Time RT-PCR
Real-time RT-PCR was performed as previously described by our laboratory (13, 74). Briefly, MCF7 cells (4 x 106) were plated in 10-cm dishes in phenol red-free DMEM containing 5% stripped FBS for 3 d followed by incubation with vehicle, estradiol (10–8 M), F/I (10 µM/100 µM) (F/I), 4-(OH)-Tam (10–7 M), or combination for 2, 6, 12, 18, or 24 h. Cells were harvested and total RNA was extracted using the Trizol (Invitrogen, Carlsbad, CA)/chloroform method. Total mRNA was adjusted to 200 ng/reaction and reverse transcribed using the TaqMan Reverse Transcription Kit (Applied Biosystems, Foster City, CA). cDNA was measured by real-time RT-PCR as previously described (13, 74, 75). The following primers and probes were used.

Progesterone receptor (PR): forward (FWD), 5'-CTATGCA-GGACATGACAACACAAA-3',

Reverse (REV), 5'-TGCCTCTCGCCTAGTTGATTAAG-3',

Probe-5'/56FAM/CCTGACACCTCCAGTTCTTTGCTGACAAG/3BHQ-1/-3'

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH): FWD, 5'-CAACGGATTTGGTGGTATTGG-3',

REV, 5'-GCAACAATATCCACTTTACCAGAGTT-3',

Probe-5'/56FAM/CGCCTGGTCACCAGGGCTGCT/3BHQ-1/-3'

cMyc: FWD, 5'-CGTCTCCACACATCAGCACAA-3',

REV, 5'-TCTTGGCAGCAGGATAGTCCTT-3',

Probe-5'/56FAM/ACGCAGCGCCTCCCTCCACTC/3BHQ-1/-3'

pS2: FWD, 5'-CGTGAAAGACAGAATTGTGGTTTT-3'

REV, 5'-CGTCGAAACAGCAGCCCTTA-3'

Probe-5'/56FAM/TGTCACGCCCTCCCAGTGTGCA/3BHQ-1/-3'

Cyclin D1: FWD, 5'-TGGGTCTGTGCATTTCTGGTT-3'

REV, 5'-GCTGGAAACATGCCGGTTAC-3'

Probe-5'/56FAM/CGGCGCTTCCCAGCACCAA/3BHQ-1/-3'

The CT value of the gene of interest was normalized to GAPDH and calibrated to vehicle treatment CT value to obtain the fold difference.

Western Blot
MCF7 cells (4 x 106) were plated in 10-cm dishes in phenol red-free DMEM containing 5% charcoal-stripped FBS for 3 d. Fresh medium was replaced before treatment, and cells were incubated with vehicle, estradiol (10–8 M), 4-(OH)-Tam (10–7 M), F/I (10 µM/100 µM) (F/I), or a combination of F/I + ligand for 2 or 24 h. To detect ERK1/ERK2 phosphorylation, cells were either transfected with empty vector or PKA expression vector, or incubated with F/I for 5, 10, 15, or 30 min. Cells were harvested in PBS and cell pellets were lysed with high-salt lysis buffer (0.4 M NaCl; 5 mM sodium fluoride; 10 mM Tris, pH 8; 2 mM EDTA; 2 mM EGTA; 1 mM sodium orthovanadate; 0.1% Triton X-100, 10 mM ß-mercaptoethanol, 5 mM ß-glycerophosphate, protease inhibitor mix; 0.1 mM PMSF) for 10 min on ice, and cellular debris was removed by centrifugation at 20,000 x g for 10 min. SDS loading buffer was added to the total cellular extract, and samples were boiled for 2 min. Proteins were separated by 10% SDS-PAGE analysis and transferred to nitrocellulose membrane. Protein expression and ER{alpha} phosphorylation were determined by Western blotting with specific antibodies listed above, and expression signals were obtained by enhanced chemiluminescence. Protein expression was normalized to ß-actin levels. ER{alpha} and ERK1/ERK2 phosphorylation was normalized to the total ER{alpha} and ERK1/ERK2 protein expression, respectively. Relative quantification of ER{alpha} and ERß in MCF-7 crude cell extract by Western blot was determined by comparison of signal intensity to a known amount of purified ER{alpha} and ERß.

Quantitative ChIP Assay
Quantitative ChIP assays were applied as previously described by our laboratory with little modification (13, 76). MCF7 cells (10 x 106) were plated in 15-cm dishes in phenol red-free DMEM containing 5% stripped FBS for 3 d. Medium was replaced before cells were incubated with vehicle, estradiol (10–8 M), F/I (10 µM/100 µM), or a combination of estradiol and F/I for 45 min, 1 h, 1.5 h, and 2 h. Chromatin and proteins were cross-linked with formaldehyde (final concentration, 1%) for 15 min at 37 C. Cells were washed with PBS, harvested, and lysed in SDS lysis buffer (1% SDS; 10 mM EDTA, pH 8.0; 50 mM Tris-HCl, pH 8.0) that contained protease inhibitors and phosphatase inhibitors. Cells were incubated in lysis buffer for 10 min followed by sonication on ice (four times, 10 sec each, with 40-sec intervals). Cellular debris was removed by centrifugation of samples at 20,000 x g rpm for 10 min, and the total cellular extract was diluted 10-fold in ChIP dilution buffer (0.01% SDS; 1.1% Triton X-100; 1.2 mM EDTA, pH 8.0; 16.7 mM Tris-HCl, pH 8.0; 167 mM NaCl) that contained protease inhibitors and phosphatase inhibitors. Ten percent of the diluted samples were frozen at –70 C for use as input. Samples were precleared with 2 µg of normal mouse IgG (Santa Cruz), 3 µg of sheared salmon sperm DNA, and 100 µl of protein A Sepharose beads in PBS (1:1) for 2 h at 2 C. Beads were removed by centrifugation at 1500 x g for 5 min, and samples were incubated with 2 µg of ER{alpha} (D-12) antibody for 18 h at 4 C with rotation. Negative control samples were incubated with normal mouse IgG. Sheared salmon sperm DNA (3 µg) and Protein A magnetic beads (5 µl) were added, and samples were incubated for 2 h at 4 C with rotation. Beads were separated and washed twice with ChIP washing buffer (0.1% SDS; 1% Triton X-100; 2 mM EDTA, pH 8.0; 20 mM Tris-HCl, pH 8.0; 150 mM NaCl) and once with TE buffer (10 mM Tris-HCl, pH 8.0; and 1 mM EDTA, pH 8.0). Protein-chromatin complexes were eluted and reverse cross-linked by incubating beads with elution buffer (1% SDS, 0.1 mM NaHCO3) at 65 C for 12 h (input samples were also incubated at this step). The DNA was purified with QIAquick PCR purification kit (QIAGEN, Chatsworth, CA) and resuspended in 50 µl of ddH2O. ChIP was measured by applying validated primers and probes for real-time RT-PCR for pS2 and cMyc as previously described (13). The CT value of the sequence of interest was normalized to input samples and calibrated to the vehicle treatment CT value to obtain the fold difference.

Ligand Binding in Intact Cells
MCF7, MCF7-LCC2, T47D cells (0.5 x 106/well) were plated in six-well plates for 3 d in medium containing charcoal-stripped FBS. Medium was replaced and cells were pretreated with vehicle or F/I for 1 h. Cells were incubated with 1.5 nM [2,4,6,7-3H(N)]estradiol, (20 µCi; PerkinElmer, Boston, MA) in the presence or absence of 1.5 µM of estradiol (cold) for 1 h. Cells were washed and incubated with 700 µl of absolute ethanol for 20 min at room temperature. Samples (500 µl) were collected, and radioactivity was measured and normalized to the total protein amount. HeLa cells were plated in 10-cm dishes in phenol red-free DMEM containing stripped FBS for 2 d, cells were transfected with ER{alpha} (500 µg) for 24 h, harvested, and replated (1 x 106) in six-well plates for 1 d. Ligand binding was performed as described above.

In Vitro Ligand Binding
Purified ER{alpha} (500 ng) was preincubated with F/I, vehicle, or ICI 182,780 (10–9 M) for 1 h in TESH buffer (10 mM Tris, 1.5 mM EDTA, 1 mM dithiothreitol, pH 7.4) on ice. [2,4,6,7-3H(N)]Estradiol (1 µM) was added with or without 10 mM estradiol (cold), and samples were incubated on ice for 1 h. Dextran-coated charcoal (DCC) slurry (1.0 g charcoal, 0.05 g dextran T-70 in 100 ml of TESH buffer) was added for 30 sec and DCC was separated by immediate centrifugation at 5000 x g for 5 min at 4 C. Supernatant was collected and radioactivity was measured.

Immunoprecipitation of ERß
MCF7 cells were plated in 15-cm dishes in phenol red-free DMEM containing 5% charcoal-stripped FBS for 3 d. Cells were washed with PBS and harvested, and cell pellets were lysed with high-salt lysis buffer for 15 min on ice. Cellular debris was removed by centrifugation at 20,000 x g for 10 min. Protein A Sepharose beads were incubated with ERß antibody for 2 h at room temperature and washed twice with PBS. Total cellular extract was diluted with PBS and incubated with beads for 18 h at 4 C with rotation. Beads were washed twice with PBS, and SDS loading buffer was added to the beads and boiled for 2 min. Immunoprecipitated ERß was detected by Western blot as described above.

Coimmunoprecipitation of ER{alpha} and Hsp90
MCF7 and HeLa cells were plated in 10-cm dishes in phenol red-free DMEM containing 5% stripped FBS for 2 d. HeLa cells were transfected with human ER{alpha} (500 µg) for 24 h using Fugene 6. Cells were incubated with vehicle or F/I for 2 h and harvested. Cell pellets were incubated with HEMG buffer [10 mM HEPES, 3 mM EDTA, 20 mM sodium molybdate, 5% glycerol (pH 7.4), containing protease and phosphatase inhibitors] on ice for 10 min and ruptured using a Dounce homogenizer (60 strokes). Debris was removed by centrifugation at 20,000 x g for 30 min at 4 C. ER{alpha} (D-12) antibody (2 µg) was incubated with protein A Sepharose beads (in PBS) for 3 h at room temperature. Beads were washed three times in PBS and added to the total cellular extract. Samples were incubated at 4 C for 18 h with rotation. Beads were washed with coimmunoprecipitation buffer (10 mM Tris-HCl; 3 mM EDTA; 10% glycerol; 50 mM NaCl; 20 mM sodium molybdate, pH 7.4) three times for 5 min each with rotation. The ER-protein complex was eluted by boiling beads in SDS loading buffer for 5 min. Samples were subjected to standard Western blot analysis with Hsp90{alpha}/ß (F8) antibody (Santa Cruz). To normalize the Western blot signals, blots were stripped by incubating membrane in stripping buffer (2% SDS; 100 mM 2-ß-mercaptoethanol; 62.5 mM Tris HCl, pH 6.8) at 55 C for 30 min with rotation. Membranes were reprobed with ER{alpha} antibody (Vector Laboratories, Inc., Burlingame, CA).

3-(4,5-Dimethylthiazolyl-2)-2,5-Diphenyl Tetrazolium (MTT) Assay
MCF7, MCF7-LCC2, or T47D cells (20 x 103cells per well) were plated in 24-well plates in medium containing 5% stripped FBS for 24 h. Cells were incubated with vehicle, estradiol (10–8 M), F/I (1 µM/100 µM; 5 µM/100 µM; or 10 µM/100 µM), or a combination of estradiol and F/I in triplicate for 24 h, 48 h, or 72 h. Treatments were repeated after 24 h and 48 h. Buffer (5x) (50 mg/10 ml of 1x PBS) for MTT reagent (MP Biomedicals, Aurora, OH) was prepared. MTT buffer (100 µl; final concentration 1x) was added to each well, and plates were incubated for 20 min at 37 C. Medium was replaced with 300 µl dimethylsulfoxide, and plates were incubated for 15 min at room temperature with shaking. Each sample (200 µl) was transferred to 96-well plates, and optical density was measured at 595 nM. Cell growth was calculated as percent of vehicle treatment.

Statistical Analysis
Data are expressed as mean ± SD. P values were calculated using ANOVA, Dunnett’s t test, and independent t test. P values < 0.05 were considered significant.


    ACKNOWLEDGMENTS
 
We thank Dr. Richard Maurer (Oregon Health Sciences University) for the RSV-PKI plasmid (47 ) and Dr. Rakesh Kumar (University of Texas M.D. Anderson Cancer Center) for the ER{alpha}S305A plasmid.


    FOOTNOTES
 
This work was supported by National Institutes of Health Grant RO1 DK06832 (to B.G.R.) and by a Department of Defense Breast Cancer Research Program Idea Award (DAMD17-02-1-0531) and Career Development Award (DAMD17-02-1-0530) (to B.G.R).

There are no disclosures of potential conflict of interest associated with this manuscript by the authors.

First Published Online October 26, 2006

Abbreviations: AP-1, Activator protein 1; ChIP, chromatin immunoprecipitation; CRE, cAMP response element; CREB, CRE-binding protein; CT, cholera toxin; DCC, dextran-coated charcoal; Epac, exchange protein directly activated by cAMP; ER, estrogen receptor; ERE, estrogen response element; FBS, fetal bovine serum; F/I, forskolin/3-isobutyl-1-methylxanthine; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Hsp90, horseradish peroxidase 90; IBMX, 3-isobutyl-1-methylxanthine; MTT, 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyl tetrazolium; 4-(OH)-Tam, 4-hydroxytamoxifen; PKA, protein kinase A; PKI, PKA inhibitor; RSV, Rous sarcoma virus; SDS, sodium dodecyl sulfate.

Received for publication February 1, 2006. Accepted for publication October 20, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Le Goff P, Montano MM, Schodin DJ, Katzenellenbogen BS 1994 Phosphorylation of the human estrogen receptor. Identification of hormone-regulated sites and examination of their influence on transcriptional activity. J Biol Chem 269:4458–4466[Abstract/Free Full Text]
  2. Joel PB, Traish AM, Lannigan DA 1995 Estradiol and phorbol ester cause phosphorylation of serine 118 in the human estrogen receptor. Mol Endocrinol 9:1041–1052[Abstract/Free Full Text]
  3. Lannigan DA 2003 Estrogen receptor phosphorylation. Steroids 68:1–9[CrossRef][Medline]
  4. Nilsson S, Makela S, Treuter E, Tujague M, Thomsen J, Andersson G, Enmark E, Pettersson K, Warner M, Gustafsson JA 2001 Mechanisms of estrogen action. Physiol Rev 81:1535–1565[Abstract/Free Full Text]
  5. Loven MA, Wood JR, Nardulli AM 2001 Interaction of estrogen receptors {alpha} and ß with estrogen response elements. Mol Cell Endocrinol 181:151–163[CrossRef][Medline]
  6. Stoner M, Wormke M, Saville B, Samudio I, Qin C, Abdelrahim M, Safe S 2004 Estrogen regulation of vascular endothelial growth factor gene expression in ZR-75 breast cancer cells through interaction of estrogen receptor {alpha} and SP proteins. Oncogene 23:1052–1063[CrossRef][Medline]
  7. Bruning JC, Lingohr P, Gillette J, Hanstein B, Avci H, Krone W, Muller-Wieland D, Kotzka J 2003 Estrogen receptor-{alpha} and Sp1 interact in the induction of the low density lipoprotein-receptor. J Steroid Biochem Mol Biol 86:113–121[CrossRef][Medline]
  8. Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson J, Kushner PJ, Scanlan TS 1997 Differential ligand activation of estrogen receptors ER{alpha} and ERß at AP1 sites. Science 277:1508–1510[Abstract/Free Full Text]
  9. Kushner PJ, Agard DA, Greene GL, Scanlan TS, Shiau AK, Uht RM, Webb P 2000 Estrogen receptor pathways to AP-1. J Steroid Biochem Mol Biol 74:311–317[CrossRef][Medline]
  10. Davis DL, Burch JB 1996 The chicken vitellogenin II gene is flanked by a GATA factor-dependent estrogen response unit. Mol Endocrinol 10:937–944[Abstract/Free Full Text]
  11. Cerillo G, Rees A, Manchanda N, Reilly C, Brogan I, White A, Needham M 1998 The oestrogen receptor regulates NF{kappa}B and AP-1 activity in a cell-specific manner. J Steroid Biochem Mol Biol 67:79–88[CrossRef][Medline]
  12. Feng W, Webb P, Nguyen P, Liu X, Li J, Karin M, Kushner PJ 2001 Potentiation of estrogen receptor activation function 1 (AF-1) by Src/JNK through a serine 118-independent pathway. Mol Endocrinol 15:32–45[Abstract/Free Full Text]
  13. Shah YM, Rowan BG 2005 The Src kinase pathway promotes tamoxifen agonist action in Ishikawa endometrial cells through phosphorylation-dependent stabilization of estrogen receptor {alpha} promoter interaction and elevated steroid receptor coactivator 1 activity. Mol Endocrinol 19:732–748[Abstract/Free Full Text]
  14. Sun M, Paciga JE, Feldman RI, Yuan Z, Coppola D, Lu YY, Shelley SA, Nicosia SV, Cheng JQ 2001 Phosphatidylinositol-3-OH kinase (PI3K)/AKT2, activated in breast cancer, regulates and is induced by estrogen receptor {alpha} (ER{alpha}) via interaction between ER{alpha} and PI3K. Cancer Res 61:5985–5991[Abstract/Free Full Text]
  15. Chen D, Pace PE, Coombes RC, Ali S 1999 Phosphorylation of human estrogen receptor {alpha} by protein kinase A regulates dimerization. Mol Cell Biol 19:1002–1015[Abstract/Free Full Text]
  16. Coleman KM, Dutertre M, El Gharbawy A, Rowan BG, Weigel NL, Smith CL 2003 Mechanistic differences in the activation of estrogen receptor-{alpha} (ER {alpha})- and ER ß-dependent gene expression by cAMP signaling pathway(s). J Biol Chem 278:12834–12845[Abstract/Free Full Text]
  17. Joel PB, Traish AM, Lannigan DA 1998 Estradiol-induced phosphorylation of serine 118 in the estrogen receptor is independent of p42/p44 mitogen-activated protein kinase. J Biol Chem 273:13317–13323[Abstract/Free Full Text]
  18. El Tanani MK, Green CD 1997 Two separate mechanisms for ligand-independent activation of the estrogen receptor. Mol Endocrinol 11:928–937[Abstract/Free Full Text]
  19. Sassone-Corsi P 1998 Coupling gene expression to cAMP signalling: role of CREB and CREM. Int J Biochem Cell Biol 30:27–38[CrossRef][Medline]
  20. de Rooij J, Zwartkruis FJ, Verheijen MH, Cool RH, Nijman SM, Wittinghofer A, Bos JL 1998 Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cyclic AMP. Nature 396:474–477[CrossRef][Medline]
  21. Kawasaki H, Springett GM, Mochizuki N, Toki S, Nakaya M, Matsuda M, Housman DE, Graybiel AM 1998 A family of cAMP-binding proteins that directly activate Rap1. Science 282:2275–2279[Abstract/Free Full Text]
  22. Schreihofer DA, Resnick EM, Lin VY, Shupnik MA 2001 Ligand-independent activation of pituitary ER: dependence on PKA-stimulated pathways. Endocrinology 142:3361–3368[Abstract/Free Full Text]
  23. Fujimoto N, Katzenellenbogen BS 1994 Alteration in the agonist/antagonist balance of antiestrogens by activation of protein kinase A signaling pathways in breast cancer cells: antiestrogen selectivity and promoter dependence. Mol Endocrinol 8:296–304[Abstract/Free Full Text]
  24. Lamb J, Ladha MH, McMahon C, Sutherland RL, Ewen ME 2000 Regulation of the functional interaction between cyclin D1 and the estrogen receptor. Mol Cell Biol 20:8667–8675[Abstract/Free Full Text]
  25. Tsai HW, Katzenellenbogen JA, Katzenellenbogen BS, Shupnik MA 2004 Protein kinase A activation of estrogen receptor {alpha} transcription does not require proteasome activity and protects the receptor from ligand-mediated degradation. Endocrinology 145:2730–2738[Abstract/Free Full Text]
  26. Michalides R, Griekspoor A, Balkenende A, Verwoerd D, Janssen L, Jalink K, Floore A, Velds A, van’t Veer L, Neefjes J 2004 Tamoxifen resistance by a conformational arrest of the estrogen receptor {alpha} after PKA activation in breast cancer. Cancer Cell 5:597–605[CrossRef][Medline]
  27. Cui Y, Zhang M, Pestell R, Curran EM, Welshons WV, Fuqua SA 2004 Phosphorylation of estrogen receptor {alpha} blocks its acetylation and regulates estrogen sensitivity. Cancer Res 64:9199–9208[Abstract/Free Full Text]
  28. Fontana JA, Miksis G, Miranda DM, Durham JP 1987 Inhibition of human mammary carcinoma cell proliferation by retinoids and intracellular cAMP-elevating compounds. J Natl Cancer Inst 78:1107–1112[Medline]
  29. Zivadinovic D, Gametchu B, Watson CS 2005 Membrane estrogen receptor-{alpha} levels in MCF-7 breast cancer cells predict cAMP and proliferation responses. Breast Cancer Res 7:R101–R112
  30. Kiefer T, Ram PT, Yuan L, Hill SM 2002 Melatonin inhibits estrogen receptor transactivation and cAMP levels in breast cancer cells. Breast Cancer Res Treat 71:37–45[CrossRef][Medline]
  31. Sabbah M, Courilleau D, Mester J, Redeuilh G 1999 Estrogen induction of the cyclin D1 promoter: involvement of a cAMP response-like element. Proc Natl Acad Sci USA 96:11217–11222[Abstract/Free Full Text]
  32. Musa NL, Ramakrishnan M, Li J, Kartha S, Liu P, Pestell RG, Hershenson MB 1999 Forskolin inhibits cyclin D1 expression in cultured airway smooth-muscle cells. Am J Respir Cell Mol Biol 20:352–358[Abstract/Free Full Text]
  33. Mantovani G, Bondioni S, Ferrero S, Gamba B, Ferrante E, Peverelli E, Corbetta S, Locatelli M, Rampini P, Beck-Peccoz P, Spada A, Lania AG 2005 Effect of cyclic adenosine 3',5'-monophosphate/protein kinase a pathway on markers of cell proliferation in nonfunctioning pituitary adenomas. J Clin Endocrinol Metab 90:6721–6724[Abstract/Free Full Text]
  34. Reid G, Hubner MR, Metivier R, Brand H, Denger S, Manu D, Beaudouin J, Ellenberg J, Gannon F 2003 Cyclic, proteasome-mediated turnover of unliganded and liganded ER{alpha} on responsive promoters is an integral feature of estrogen signaling. Mol Cell 11:695–707[CrossRef][Medline]
  35. Shang Y, Hu X, DiRenzo J, Lazar MA, Brown M 2000 Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103:843–852[CrossRef][Medline]
  36. Metivier R, Penot G, Hubner MR, Reid G, Brand H, Kos M, Gannon F 2003 Estrogen receptor-{alpha} directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115:751–763[CrossRef][Medline]
  37. Stack G, Kumar V, Green S, Ponglikitmongkol M, Berry M, Rio MC, Nunez AM, Roberts M, Koehl C, Bellocq P, Gairard B, Renaud R, Chambon P 1988 Structure and function of the pS2 gene and estrogen receptor in human breast cancer cells. Cancer Treat Res 40:185–206:185–206[Medline]
  38. Dubik D, Shiu RP 1992 Mechanism of estrogen activation of c-myc oncogene expression. Oncogene 7:1587–1594[Medline]
  39. Shaw LE, Sadler AJ, Pugazhendhi D, Darbre PD 2006 Changes in oestrogen receptor-{alpha} and -ß during progression to acquired resistance to tamoxifen and fulvestrant (Faslodex, ICI 182,780) in MCF7 human breast cancer cells. J Steroid Biochem Mol Biol 99:19–32[CrossRef][Medline]
  40. Devin-Leclerc J, Meng X, Delahaye F, Leclerc P, Baulieu EE, Catelli MG 1998 Interaction and dissociation by ligands of estrogen receptor and Hsp90: the antiestrogen RU 58668 induces a protein synthesis-dependent clustering of the receptor in the cytoplasm. Mol Endocrinol 12:842–854[Abstract/Free Full Text]
  41. Orti E, Bodwell JE, Munck A 1992 Phosphorylation of steroid hormone receptors. Endocr Rev 13:105–128[Abstract/Free Full Text]
  42. Al Dhaheri MH, Rowan BG 2006 Application of phosphorylation site-specific antibodies to measure nuclear receptor signaling: characterization of novel phosphoantibodies for estrogen receptor {alpha}. Nucl Recept Signal 4:7–14
  43. Marsaud V, Gougelet A, Maillard S, Renoir JM 2003 Various phosphorylation pathways, depending on agonist and antagonist binding to endogenous estrogen receptor alpha (ER{alpha}), differentially affect ER{alpha} extractability, proteasome-mediated stability, and transcriptional activity in human breast cancer cells. Mol Endocrinol 17:2013–2027[Abstract/Free Full Text]
  44. Weissinger EM, Eissner G, Grammer C, Fackler S, Haefner B, Yoon LS, Lu KS, Bazarov A, Sedivy JM, Mischak H, Kolch W 1997 Inhibition of the Raf-1 kinase by cyclic AMP agonists causes apoptosis of v-abl-transformed cells. Mol Cell Biol 17:3229–3241[Abstract]
  45. Davis MI, Ronesi J, Lovinger DM 2003 A predominant role for inhibition of the adenylate cyclase/protein kinase A pathway in ERK activation by cannabinoid receptor 1 in N1E-115 neuroblastoma cells. J Biol Chem 278:48973–48980[Abstract/Free Full Text]
  46. Rowan BG, Garrison N, Weigel NL, O’Malley BW 2000 8-Bromo-cyclic AMP induces phosphorylation of two sites in SRC-1 that facilitate ligand-independent activation of the chicken progesterone receptor and are critical for functional cooperation between SRC-1 and CREB binding protein. Mol Cell Biol 20:8720–8730[Abstract/Free Full Text]
  47. Van Patten SM, Howard P, Walsh DA, Maurer RA 1992 The {alpha}- and ß-isoforms of the inhibitor protein of the 3',5'-cyclic adenosine monophosphate-dependent protein kinase: characteristics and tissue- and developmental-specific expression. Mol Endocrinol 6:2114–2122[Abstract/Free Full Text]
  48. Kato S, Endoh H, Masuhiro Y, Kitamoto T, Uchiyama S, Sasaki H, Masushige S, Gotoh Y, Nishida E, Kawashima H, Metzger D, Chambon P 1995 Activation of the estrogen receptor through phosphorylation by mitogen-activated protein kinase. Science 270:1491–1494[Abstract/Free Full Text]
  49. Bunone G, Briand PA, Miksicek RJ, Picard D 1996 Activation of the unliganded estrogen receptor by EGF involves the MAP kinase pathway and direct phosphorylation. EMBO J 15:2174–2183[Medline]
  50. Lilling G, Hacohen H, Nordenberg J, Livnat T, Rotter V, Sidi Y 2000 Differential sensitivity of MCF-7 and LCC2 cells, to multiple growth inhibitory agents: possible relation to high bcl-2/bax ratio? Cancer Lett 161:27–34[CrossRef][Medline]
  51. Ali S, Coombes RC 2002 Endocrine-responsive breast cancer and strategies for combating resistance. Nat Rev Cancer 2:101–112[CrossRef][Medline]
  52. Schneider SM, Offterdinger M, Huber H, Grunt TW 1999 Involvement of nuclear steroid/thyroid/retinoid receptors and of protein kinases in the regulation of growth and of c-erbB and retinoic acid receptor expression in MCF-7 breast cancer cells. Breast Cancer Res Treat 58:171–181[CrossRef][Medline]
  53. El Tanani MK, Green CD 1996 Interaction between estradiol and cAMP in the regulation of specific gene expression. Mol Cell Endocrinol 124:71–77[CrossRef][Medline]
  54. Klinge CM 2001 Estrogen receptor interaction with estrogen response elements. Nucleic Acids Res 29:2905–2919[Abstract/Free Full Text]
  55. Petz LN, Ziegler YS, Schultz JR, Kim H, Kemper JK, Nardulli AM 2004 Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites. J Steroid Biochem Mol Biol 88:113–122[CrossRef][Medline]
  56. Schultz JR, Petz LN, Nardulli AM 2005 Cell- and ligand-specific regulation of promoters containing activator protein-1 and Sp1 sites by estrogen receptors {alpha} and ß. J Biol Chem 280:347–354[Abstract/Free Full Text]
  57. Sun JM, Spencer VA, Li L, Yu CH, Yu J, Davie JR 2005 Estrogen regulation of trefoil factor 1 expression by estrogen receptor {alpha} and Sp proteins. Exp Cell Res 302:96–107[CrossRef][Medline]
  58. Altucci L, Addeo R, Cicatiello L, Dauvois S, Parker MG, Truss M, Beato M, Sica V, Bresciani F, Weisz A 1996 17ß-Estradiol induces cyclin D1 gene transcription, p36D1–p34cdk4 complex activation and p105Rb phosphorylation during mitogenic stimulation of G(1)-arrested human breast cancer cells. Oncogene 12:2315–2324[Medline]
  59. Nadella KS, Kirschner LS 2005 Disruption of protein kinase a regulation causes immortalization and dysregulation of D-type cyclins. Cancer Res 65:10307–10315[Abstract/Free Full Text]
  60. Zhong L, Skafar DF 2002 Mutations of tyrosine 537 in the human estrogen receptor-{alpha} selectively alter the receptor’s affinity for estradiol and the kinetics of the interaction. Biochemistry 41:4209–4217[CrossRef][Medline]
  61. Yudt MR, Vorojeikina D, Zhong L, Skafar DF, Sasson S, Gasiewicz TA, Notides AC 1999 Function of estrogen receptor tyrosine 537 in hormone binding, DNA binding, and transactivation. Biochemistry 38:14146–14156[CrossRef][Medline]
  62. Beato M, Klug J 2000 Steroid hormone receptors: an update. Hum Reprod Update 6:225–236[Abstract/Free Full Text]
  63. Klinge CM 2000 Estrogen receptor interaction with co-activators and co-repressors. Steroids 65:227–251[CrossRef][Medline]
  64. Freeman BC, Yamamoto KR 2002 Disassembly of transcriptional regulatory complexes by molecular chaperones. Science 296:2232–2235[Abstract/Free Full Text]
  65. Rowan BG, Weigel NL, O’Malley BW 2000 Phosphorylation of steroid receptor coactivator-1. Identification of the phosphorylation sites and phosphorylation through the mitogen-activated protein kinase pathway. J Biol Chem 275:4475–4483[Abstract/Free Full Text]
  66. Blok LJ, de Ruiter PE, Brinkmann AO 1998 Forskolin-induced dephosphorylation of the androgen receptor impairs ligand binding. Biochemistry 37:3850–3857[CrossRef][Medline]
  67. Rogatsky I, Trowbridge JM, Garabedian MJ 1999 Potentiation of human estrogen receptor {alpha} transcriptional activation through phosphorylation of serines 104 and 106 by the cyclin A-CDK2 complex. J Biol Chem 274:22296–22302[Abstract/Free Full Text]
  68. Lee H, Bai W 2002 Regulation of estrogen receptor nuclear export by ligand-induced and p38-mediated receptor phosphorylation. Mol Cell Biol 22:5835–5845[Abstract/Free Full Text]
  69. Huang J, Li X, Qiao T, Bambara RA, Hilf R, Muyan M 2006 A tale of two estrogen receptors (ERs): how differential ER-estrogen responsive element interactions contribute to subtype-specific transcriptional responses. Nucl Recept Signal 4:15–18
  70. Rayala SK, Talukder AH, Balasenthil S, Tharakan R, Barnes CJ, Wang RA, Aldaz M, Khan S, Kumar R 2006 P21-activated kinase 1 regulation of estrogen receptor-{alpha} activation involves serine 305 activation linked with serine 118 phosphorylation. Cancer Res 66:1694–1701[Abstract/Free Full Text]
  71. de Cremoux P, Tran-Perennou C, Brockdorff BL, Boudou E, Brunner N, Magdelenat H, Lykkesfeldt AE 2003 Validation of real-time RT-PCR for analysis of human breast cancer cell lines resistant or sensitive to treatment with antiestrogens. Endocr Relat Cancer 10:409–418[Abstract]
  72. Arteaga CL, Koli KM, Dugger TC, Clarke R 1999 Reversal of tamoxifen resistance of human breast carcinomas in vivo by neutralizing antibodies to transforming growth factor-ß. J Natl Cancer Inst 91:46–53[Abstract/Free Full Text]
  73. Foster JS, Henley DC, Ahamed S, Wimalasena J 2001 Estrogens and cell-cycle regulation in breast cancer. Trends Endocrinol Metab 12:320–327[CrossRef][Medline]
  74. Kershah SM, Desouki MM, Koterba KL, Rowan BG 2004 Expression of estrogen receptor coregulators in normal and malignant human endometrium. Gynecol Oncol 92:304–313[CrossRef][Medline]
  75. Shah YM, Basrur V, Rowan BG 2004 Selective estrogen receptor modulator regulated proteins in endometrial cancer cells. Mol Cell Endocrinol 219:127–139[CrossRef][Medline]
  76. Narayanan R, Adigun AA, Edwards DP, Weigel NL 2005 Cyclin-dependent kinase activity is required for progesterone receptor function: novel role for cyclin A/Cdk2 as a progesterone receptor coactivator. Mol Cell Biol 25:264–277[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   ERα  |  ERβ
Ligands:   17β-Estradiol  |  4-Hydroxytamoxifen  |  Fulvestrant



This article has been cited by other articles:


Home page
EndocrinologyHome page
I. S. Fenne, T. Hoang, M. Hauglid, J. V. Sagen, E. A. Lien, and G. Mellgren
Recruitment of Coactivator Glucocorticoid Receptor Interacting Protein 1 to an Estrogen Receptor Transcription Complex Is Regulated by the 3',5'-Cyclic Adenosine 5'-Monophosphate-Dependent Protein Kinase
Endocrinology, September 1, 2008; 149(9): 4336 - 4345.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
J. K. Nagpal, S. Nair, D. Chakravarty, R. Rajhans, S. Pothana, D. W. Brann, R. R. Tekmal, and R. K. Vadlamudi
Growth Factor Regulation of Estrogen Receptor Coregulator PELP1 Functions via Protein Kinase A Pathway
Mol. Cancer Res., May 1, 2008; 6(5): 851 - 861.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Al-Dhaheri, M. H.
Right arrow Articles by Rowan, B. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Al-Dhaheri, M. H.
Right arrow Articles by Rowan, B. G.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Breast Cancer
Hazardous Substances DB
*ESTRADIOL
*TAMOXIFEN


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals