| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Howard Hughes Medical Institute and Department of Pharmacology (L.J.B.-Y., A.L.L., J.L.M.), University of Colorado School of Medicine, Aurora, Colorado 80045; and Marine Sciences Institute (P.T.), University of Texas, Port Aransas, Texas 78373
Address all correspondence and requests for reprints to: James Maller, Howard Hughes Medical Institute, Department of Pharmacology, 8303, 12801 East 17th Avenue, P.O. Box 6511, Aurora, Colorado 80045. E-mail: Jim.Maller{at}uchsc.edu.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Initial cloning of a novel membrane progestin receptor (mPR
) from sea trout ovary (12) has provided a candidate progesterone-sensitive GPCR. Subsequent cloning of mPR in fish, Xenopus, mice, and humans identified three homologs of mPR that are widely distributed in different tissues (12, 13). All the mPR homologs are predicted to have seven-transmembrane domains (13), and mPR
was shown in stably transfected MDA-MB-231 cells to inhibit cAMP production in a pertussis toxin-sensitive manner, as predicted for a GPCR linked to adenylyl cyclase (13, 14). Coimmunoprecipitation experiments provided direct evidence that endogenous mPR
and mPRß in myometrial cells associate with G
i before hormonal stimulation and dissociate after progesterone treatment (14). Interestingly, the involvement of a GPCR in mammalian meiotic maturation has been recently reported in an opposite regulatory context, where it is involved in the prevention of oocyte maturation. GPR3, a constitutively active orphan receptor, was shown to maintain meiotic arrest in mammalian oocytes (15). Knockout mice lacking this Gs-linked receptor resume meiosis within the antral follicles, circumventing inhibitory signals within the follicle. Subfertility and premature ovarian aging were also reported in a second Gpr3 null mouse strain (16). Ablation of another GPCR, GPR12 in rat oocytes, also resulted in meiotic resumption (17). It is interesting that different GPCRs have been suggested to regulate oocyte prophase arrest in different species. mPRs were also recently suggested to belong to a novel PAQR (progestin and Adipo Q receptors) family. PAQR is a conserved family of proteins spanning the plant to animal kingdoms (18). This family was identified by a novel motif, UPF0073 (Pfam domain, PF03006), consisting of seven-transmembrane domains (18, 19). All three mPR homologs contain this motif.
In this study we explore the role of the Xenopus laevis ortholog mPRß in promoting progesterone-induced oocyte maturation.
| RESULTS |
|---|
|
|
|---|
|
, ß, and
, expressed differently among various species. To verify whether mPR is present in Xenopus oocytes, we performed RT-PCR analysis. XmPRß transcripts were found in stage VI oocytes, and the transcript level did not change even after GVBD (Fig. 1B
-related transcripts (data not shown).
To determine the expression and localization of XmPRß protein, plasma membranes from oocytes were manually removed and extracted, and the level of the protein was verified by immunoblotting with specific antibodies raised against an N-terminal peptide of XmPRß. In nondenaturing gels, XmPRß from oocytes expressing the recombinant protein was detected as a single 60-kDa protein in oocyte membranes but not in the cytoplasm (Fig. 1C
). The expression of ß-integrin confirms the membranal fractionation. Specificity of the antibody was verified by its ability to immunoprecipitate Myc-tagged XmPRß (Fig. 1D
). The receptor was also recognized in reciprocal Myc-immunoprecipitates immunoblotted with the N-terminal antibody. Preincubation of the antibody with the corresponding peptide reduced the XmPRß signal detected from oocytes (data not shown). These results indicate that Xenopus oocytes express the ß-ortholog of the mPR family on the plasma membrane.
Neutralizing Antibodies Prevent Oocyte Maturation
The presence of both the XmPRß transcript and protein supports the hypothesis that XmPRß may be involved in mediating the effect of progesterone on meiosis. To determine whether XmPRß is required for progesterone-induced maturation, loss of function studies were performed by microinjecting oocytes before progesterone treatment with affinity-purified antibodies raised against two different regions of XmPRß, as described in Materials and Methods. Oocytes injected with control IgG or preimmune sera underwent GVBD normally after addition of progesterone, but GVBD was dramatically inhibited by both XmPRß-specific antibodies (Fig. 2A
). Verification of antibody recognition of XmPRß was carried out by immunoprecipitation of in vitro transcribed and translated 35S-labeled XmPRß (Fig. 2B
). Both antibodies immunoprecipitated the radiolabeled protein.
|
Overexpression of XmPRß Enhances Progesterone-Induced Oocyte Maturation
To further investigate the role of XmPRß in oocyte maturation, stage VI oocytes were microinjected with mRNA encoding either Myc-XmPRß or Myc-green fluorescent protein (GFP). Immunoblotting with anti-Myc antibody verified that the expression levels of both recombinant proteins in total oocyte lysates were comparable (Fig. 3A
). Plasma membranes from mRNA injected-oocytes were manually removed and extracted, and the level of the overexpressed protein was verified by immunoblotting. Only XmPRß, not the GFP control, was found to be expressed in the membrane (Fig. 3B
). The expression of ß-integrin confirms membranal localization and equal loading of samples on the gel. To exclude that cytoplasmic contamination accounts for the presence of Myc-XmPRß in the membrane extract, the level of MEK1, a highly abundant cytoplasmic protein, was examined. No detectable level of MEK1 was found in manually dissected plasma membranes (Fig. 3B
).
|
Progesterone Binding to Plasma Membranes of Cells Transfected with XmPRß
Characterization of progesterone binding to XmPRß was carried out in Chinese hamster ovary (CHO) cells transiently transfected with cDNAs encoding Myc-XmPRß or Myc-GFP as described in Materials and Methods. Immunoprecipitation of XmPRß or GFP was carried out utilizing an antibody against the Myc tag, and the immunoprecipitated proteins were analyzed in a radioligand binding assay. Whereas negligible specific binding of radiolabeled progesterone was detected in control GFP-transfected cells, specific progesterone binding was detected in XmPRß-transfected cells (Fig. 4A
). To verify the ligand specificity of the receptor, competition was performed by binding in the presence of an excess cold steroid. A 100-fold excess of testosterone or 17ß-estradiol did not reduce the binding of progesterone to the immunoprecipitated receptor (Fig. 4B
), whereas the same concentration of progesterone reduced the binding by at least 60% (Fig. 4B
).
|
|
| DISCUSSION |
|---|
|
|
|---|
Because progesterone induces biochemical events in enucleated oocytes and inhibition of transcription by actinomycin D has no effect on maturation (22), a nongenomic steroid receptor mechanism has been attributed to this receptor. In addition, the rate with which biological effects could be measured ruled out genomic effects, e.g. a decrease in intracellular cAMP detected within seconds of progesterone addition (28). Perhaps the most compelling evidence for a membrane receptor came from studies in several laboratories that showed steroid-dependent inhibition of adenylyl cyclase in isolated plasma membranes in a GTP-dependent manner (2, 3, 4, 5, 6, 7).
In this study we set out to examine the role in oocyte maturation of a Xenopus ortholog of a novel family of mPRs. In principle, several distinct criteria must be satisfied to qualify as a relevant membrane progesterone receptor: specific progesterone binding; membranal localization; and biological effects on oocyte maturation (29). Our studies provide evidence for expression on the oocyte plasma membrane of endogenous as well as ectopic XmPRß. Similarly, in mammalian cells stably transfected with XmPRß, the protein was found to be expressed only in the plasma membrane. Moreover, mPR expressed in mammalian cells responded to progesterone by rapid activation of MAPK (Ref. 13 and Fig. 5
) as well as by reduced cAMP production (13). A key role for XmPRß in progesterone-mediated oocyte maturation is evident from loss of function studies with two specific antibodies raised against distinct regions of the protein (Fig. 2
). In addition, the enhancement of maturation by XmPRß expression (Fig. 3
) supports the idea that this receptor is linked to signaling pathways that control the resumption of meiosis. We conclude that XmPRß fulfills all the criteria for a progesterone receptor involved in oocyte maturation.
However, our results do not exclude the possibility that some effects of progesterone in oocytes may be mediated by the classic iPR, because overexpression of iPR also accelerates the rate of oocyte maturation (8, 9). Because the majority of iPR was reported to be localized in the cytoplasm, it is plausible that its effects are thorough the direct activation of MAPK, evading membrane-initiated signaling. Studies in our laboratory have shown that activation of v-Src and other agents that activate MAPK and its substrate Rsk1 lead to an accelerated rate of GVBD (30, 31), and the ability of iPR to accelerate the rate of GVBD depends on the praline-rich motif of mPR that interacts with c-Src (11). In this paper we provide evidence of additional progesterone signaling through the novel mPRß homolog pathway that is membrane initiated and nongenomic. The interplay between the two receptor subtypes may contribute additively to activation of the meiotic process, because the requirement of 50100 nM progesterone for GVBD, higher than the 1 nM required for transcriptional activation by iPR, suggests a requirement for mPR binding, the apparent Kd of which for progesterone is 200 nM (Fig. 5
). Similarly, RU486, an antagonist of iPR, does not block progesterone-induced GVBD and instead has a weak agonist effect on oocyte maturation (32). Whether RU486 binds mPR is unknown, but Xenopus iPR, as well as chicken and hamster iPR, lack the glycine residue reported to be essential for PR binding of RU486 (33).
The mPR family of proteins consists of three different paralogs that have been cloned in fish and other vertebrate species including humans (12, 13). The archetype
ortholog was cloned from a spotted sea trout ovarian cDNA library, and the localization of this transcript is confined to reproductive and neuroendocrine tissues (ovary, testes, and pituitary) (13). Representatives of mPR have been found in other organisms including various fish, frog, mice, pigs, and humans (12). In higher eukaryotes all three mPR subtypes were identified and found to have distinct tissue distributions. We report here the involvement of the ß-ortholog in Xenopus oocyte maturation. Similar findings of mPRß expression were reported in rainbow trout oocytes (34) as well as in rat corpus lutea (35). The dual presence of both
- and ß-transcripts was demonstrated in zebrafish ovaries (36), and, in catfish ovaries, all three transcripts,
, ß, and
, are present (37). It cannot be excluded at this time that the
-paralog is also present and involved in Xenopus oocyte maturation, but extensive efforts to clone a Xenopus
-ortholog have been unsuccessful (Ref. 12 and data not shown).
Ectopic expression of XmPRß in immature oocytes results in an accelerated rate of GVBD, which is dramatic under conditions of suboptimal concentrations of progesterone (Fig. 3
). XmPRß is present in stage IV oocytes unable to resume meiosis in response to progesterone, and even higher expression of mPRß after mRNA injection did not result in acquisition of meiotic competence, indicating that the deficiency may not be related to whether or not mPR is present. In addition, adenylyl cyclase activity stimulated by guanyl-5'-yl-imidodiphosphate is equally inhibited by progesterone in plasma membranes from both stages, and injection of PKI, the inhibitor of cAMP-dependent protein kinase, induces oocyte maturation only in stage VI, not stage IV, oocytes (23). Other studies have reported that membranes of even smaller stage IIII oocytes do not bind progesterone (38).
Another group of steroids, androgens, have also been implicated in induction of Xenopus oocyte maturation. Androgens have been detected in the serum and ovaries of ovulating frogs, and both androstenedione and testosterone are able to promote oocyte maturation, possibly through the classical androgen receptor present in oocytes (38). Furthermore, cytochrome P450-17, steroid 17
-hydroxylase, which can convert progesterone to androstenedione, is present in oocytes (38, 39, 40), suggesting that androgens stimulate a pathway promoting maturation. However, inhibition of the classical androgen receptor by the androgen receptor antagonist flutamide had no effect on progesterone-mediated maturation, arguing against androstenedione as the final mediator of progesterone action (38). Additionally, prevention of progesterone conversion to androstenedione by inhibition of cytochrome P450-17 had no deleterious effect on progesterone-mediated maturation (39, 40). In any case the results reported here demonstrate testosterone does not compete for progesterone binding (Fig. 4
), and therefore the pathway mediated by XmPRß does not involve androgens.
Although the downstream effectors of mPR remain elusive, evidence suggests a mutual requirement for both G
s and Gß
. Activation of G
s by cholera toxin has been shown to potently inhibit progesterone-induced oocyte maturation (28, 41). The direct involvement of G
s was demonstrated in loss of function experiments that resulted in spontaneous oocyte maturation (42, 43), and overexpression of G
s resulted in inhibition of progesterone-dependent oocyte maturation (43). Moreover, G
s-dependent AC activity activated by cholera toxin is inhibited by progesterone in oocyte plasma membranes (2). Interestingly, the XG
s sequence is 92% identical to the human one, but the in vitro translated Xenopus ortholog is unable to activate AC in G
s-deficient S49 cells (44). Conversely, regulation of oocyte maturation by the ß
subunits of heterotrimeric G proteins has been reported. Overexpression of Gß
inhibits progesterone-dependent oocyte maturation (38, 45), whereas its inhibition initiated spontaneous maturation (45) or enhanced progesterone-induced oocyte maturation (38). These results suggest an antagonizing effect of progesterone on activity mediated by a constitutively active, inhibitory Gß
. Evidence supporting a mutual requirement for both G
s and Gß
has come from studies on AC isoforms in oocytes. An ortholog of AC7 was cloned from Xenopus oocytes, which is a Gß
-activated isoform (46, 47). Similar to findings in mammals (48), Gß
stimulation of AC in oocyte membranes was dependent on G
s activation, and interference with AC/Gß
association accelerated progesterone-induced GVBD (46).
The progesterone binding of mPR, a putative GPCR, raises the possibility that some of the orphan GPCRs may have a steroidal ligand. Indeed, GPR30 has been recently shown to possess all the binding and signaling characteristics of a membranal estrogen receptor (49, 50). A membranal androgen-binding receptor that has not yet been cloned is also reported to activate G proteins (51). Only future structural analysis will verify whether these steroid receptors all belong to a superfamily of steroid-binding membrane receptors or constitute distinct families. In any case, the results presented here show that mPRß in a physiological context has the appropriate biological effects, expression, binding characteristics, and membrane localization to be implicated as a relevant progesterone receptor for Xenopus oocyte maturation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of Recombinant Proteins and Antibodies
Recombinant protein was isolated from the bacterial strain Rosetta(DE3)pLysS (Novagen) after treatment for 4 h at 37 C with 500 µM isopropyl 1-thio-D-galactopyranoside. The GST-tagged protein was isolated from the post-28,000 x g pellet in 3 M guanidine using glutathione-agarose beads. The bead-bound protein was solubilized in sample buffer and loaded onto an SDS-PAGE, and the appropriate band was excised from an unfixed gel after visualization in 0.5 M KCl.
Antibodies against XmPRß were produced by immunization of rabbits with the peptides mPR1-CPVPEKYFPGSCDFIGHGH or mPR2-QVVPAGLAYILDISPVVHR, corresponding to two distinct regions within the molecule. Peptides were covalently bound to keyhole limpet hemocyanin (KLH) before immunization. The antibodies to N-terminal XmPRß were raised against the bacterially produced GST-tagged polypeptide encoding amino acids 1100 of XmPRß. Affinity purification of anti-mPR1 and -2 was performed by conjugating the appropriate peptide to Affi-gel 10 (Bio-Rad Laboratories, Hercules, CA), following the manufacturers instructions. Antibodies were eluted with 100 mM glycine (pH 2.5), followed by base elution with triethylamine (pH 11.5). Eluted antibodies were immediately neutralized in 100 mM Tris (pH 8.0), concentrated on a Microcon 20 spin column (Millipore Corp., Bedford, MA), and stored at 4 C. Preimmune serum was used as control. In addition, IgG in the flowthrough of the affinity column after three consecutive purifications was further purified on a Protein A column, eluted in 100 mM glycine (pH 2.5), neutralized with 100 mM Tris (pH 8.0), and concentrated on a spin column. The antibodies to N-terminal XmPRß were purified by retroelution. Serum was incubated overnight at 4 C with a polyvinylidine difluoride membrane strip containing 50 µg of GST N-terminal XmPRß. After several washes with PBS, the antibodies were retroeluted with 100 mM glycine (pH 2.5), neutralized in 100 mM Tris (pH 8.0), and stored at 4 C.
Isolation of Xenopus Oocytes and Meiotic Maturation
Oocytes were isolated from ovarian fragments taken from frogs primed with 35 IU of pregnant mare serum gonadotropin (Calbiochem) 72 h before the experiment. Oocytes were collected by manual dissection or by consecutive incubation in dispase (0.5 mg/ml) for 2 h followed by digestion with collagenase type 1A (0.8 mg/ml) for 1 h or longer, until the oocytes were clearly free of blood vessels. To induce meiotic maturation, oocytes were incubated in the presence of 100 ng/ml (3 x 107 M) progesterone (Sigma Chemical Co., St. Louis, MO) or increasing concentrations of BSA-conjugated progesterone (Steraloids, Wilton, CT). The appearance of a white spot in the center of the animal pole, indicative of GVBD and reentry into meiosis from the G2 arrested state, was scored with a dissecting microscope. Manual dissection of plasma membranes was performed by careful puncturing of the oocytes in Merriam Buffer (10 mM HEPES, pH 7.6; 88 mM NaCl; 1 mM KCl; 0.33 mM Ca(NO3)2; 0.41 mM CaCl2; 0.82 mM MgSO4) and gentle removal of membranes with a watchman forceps in membrane dissection buffer (10 mM HEPES, pH 7.9; 10 mM NaCl) (2). Membranes were collected and frozen in membrane lysis buffer (50 mM Tris-HCl, pH 7.4; 80 mM ß-glycerophosphate; 20 mM EDTA; 3 µM microcystin LR; 1% Triton X-100) and complete EDTA-free protease inhibitor cocktail (Roche Clinical Laboratories, Indianapolis, IN). All animal experimentation was conducted in accordance with accepted standards of humane animal care.
Generation of mRNAs
XmPRß and GFP mRNAs were produced from NotI-linearized pCS26MTLIC XmPRß and pCS26MTGFP plasmids using the SP6 mMessage mMachine kit (Ambion, Inc., Austin, TX). Stage VI oocytes were injected with mRNA (3050 ng) in 3050 nl water, and recombinant protein was allowed to accumulate overnight at 18 C. To obtain oocytes that had undergone GVBD, 100 ng/ml progesterone was added the next morning to induce maturation. Oocytes were monitored for GVBD and collected at the desired time points, and kept at 80 C until assay.
RT-PCR Analysis
Total RNA was extracted from 10 oocytes at various stages of meiosis using the Trizol reagent (Invitrogen) according to the manufacturers instructions. The RNA was reverse transcribed using the SuperScript first-strand synthesis system (Invitrogen). PCR amplification was carried out with 2 µl of cDNA using Accuprime II mix (Invitrogen), and oligonucleotide primers for XmPRß (forward, GGCTCACTACTACTACACTTCC; and reverse, GCATAAACGGCAGTGAAGGTGC) and primers for Elongation factor 1
(EF1
) (forward, CCTGAACCACCCAGGCCAGATTGGTG; and reverse, GAGGGTAGTCAGAGAAGCTCTCCACG). Multiplex PCR was performed by addition of the XmPRß primers for the first 10 cycles followed by Ef1
primers for 25 additional cycles. The PCR products were run on a 2% agarose gel and visualized by ethidium bromide treatment for 10 min, followed by several washes in deionized water. The images were captured with a Fluorchem 8900 analyzer (Alpha Innotech, San Leandro, CA). PCR products were sequenced and were found to be 99% identical to reported sequences of XmPRß and 100% identical to reported Ef1a (52).
Microinjection of XmPRß Neutralizing Antibodies
To assess the effect of XmPRß antibodies on maturation, oocytes were injected with the appropriate antibody (50 nl of 0.1 to 1 mg/ml) for 2 h before progesterone addition. Control oocytes were injected with preimmune sera, XmPRß-depleted IgG at the same concentration, or affinity-purified antibodies preincubated for 2 h with an excess amount of the peptide used for immunization. Injected oocytes were monitored for GVBD, frozen at the desired time points, and kept at 80 C until assay.
Generation of a Stable XmPRß-Expressing CHO Cell Line and Radioligand Binding Assay
CHO-K1 cells were transiently transfected with either pCS26Myc LIC XmPRß or pCS26MycGFP using Lipofectamine 2000 (Invitrogen), following the manufacturers suggested protocol. The Flp-In CHO cell line (Invitrogen) was stably transfected with pcDNA5 FRT TOPO 6 Myc-XmPRß, using Lipofectamine 2000 (Invitrogen), following the manufacturers suggested protocol and placed in Hygromycin B (Invitrogen) 48 h after transfection. Positive clones were identified by immunoblotting as well as by immunofluorescence of Myc-tagged protein. Cells transiently transfected with 6 Myc-XmPRß or Myc-GFP were extracted with HAED buffer (25 mM HEPES; 10 mM NaCl; 1 mM EDTA, pH 7.6), washed once, and sonicated for 9 sec. The nuclei, mitochondria, and cellular debris were removed after centrifugation at 1000 x g at 4 C for 5 min. The supernatant was then centrifuged at 40,000 x g for 40 min at 4 C, and the clarified extract was subjected to immunoprecipitation with agarose-conjugated Myc antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) for 2 h at 4 C. After several washes with HAED buffer, equal aliquots of the bead-bound immunoprecipitates were assayed for progesterone binding. Triplicate aliquots were incubated with 30 nM progesterone [1,2,6,7-3H (N)] S.A. 102 Ci/mmol (PerkinElmer, Wellesley, MA) for 30 min at 4 C. For competition studies, binding was performed in the presence of a 100-fold excess of cold progesterone, 17ß-estradiol, or testosterone (Sigma). The binding reaction was stopped by six consecutive washes with HAEW buffer (25 mM HEPES; 1 mM NaCl; 1 mM EDTA, pH 7.6). The beads were then resuspended in 100 µl HAEW buffer and transferred to scintillation cocktail, and radioactivity was determined in a Beckman LS 6000 scintillation counter. Alternatively, membranes from Flp-In CHO cells stably expressing XmPRß were collected by centrifugation at 40,000 x g and resuspended in HAED buffer. The binding assay on 100-µg membrane samples was performed as described previously (13). Briefly, samples were incubated for 30 min at 4 C with increasing concentrations of radiolabeled progesterone [1,2,6,7-3H (N)] S.A. 102 Ci/mmol (PerkinElmer) in the absence or presence of a 100-fold excess of cold progesterone. The binding reaction was stopped by filtration onto GF/B fiberglass filters (Whatman, Clifton, NJ) using a sampling manifold filtration system (Millipore). Each filter was rinsed with 50 ml of HAEW buffer, allowed to vacuum dry, and counted in a scintillation counter. Each sample was assayed in triplicate, and specific binding in each sample was calculated by deducting nonspecific binding from total binding.
SDS-PAGE, Western Blotting, and Immunoprecipitation
Oocytes were lysed in extraction buffer (EB) (50 mM Tris-HCl pH 7.4, 80 mM ß-glycerophosphate, 20 mM EDTA, 1 mM dithiothreitol, 3 µM microcystin LR, 0.2% Triton X-100) plus protease inhibitor cocktail and centrifuged at 10,000 x g for 5 min. In general, extract supernatant corresponding to one oocyte was loaded per lane. For detection of XmPRß and Xß-integrin, oocytes were extracted in nondenaturing buffer (lacking either dithiothreitol or ß-mercaptoethanol). After SDS-PAGE, the proteins were transferred to polyvinylidine difluoride membranes using a semidry apparatus. The membrane was blocked with 2.5% BSA, 0.5% OVA, 2.5% dry skim milk, 10 mM Tris, 150 mM NaCl for 1 h at room temperature. Primary antibodies were incubated overnight at 4 C, followed by multiple washes in Tris-buffered saline-Tween 20. The appropriate horseradish peroxidase-conjugated secondary antibodies were incubated in the blocking solution for 1 h at room temperature, followed by multiple washes with Tris-buffered saline-Tween 20. Chemiluminescence was detected using a PerkinElmer enhanced chemiluminescence kit in accordance with the manufacturers protocol.
In vitro transcribed and translated 35S-labeled XmPRß protein was produced with a TNT quick kit (Promega). The labeled protein solution was precleared with protein A agarose beads that were precoated with 10% BSA. About 5 µg of affinity-purified XmPRß antibodies were then incubated with the precleared XmPRß solution for 2 h at 4 C and precipitated with protein A-Sepharose beads (50% slurry) in EB. Immunoprecipitates were washed twice with low-salt buffer (100 mM NaCl in EB), twice with high-salt buffer (500 mM NaCl in EB), and once with EB. The immunoprecipitates were separated on SDS-PAGE, followed by fixation and incubation with Amplify Fluorographic Reagent (Amersham Pharmacia Biotech, Arlington Heights, IL). The dried gel was exposed to Kodak BioMAX MR film (Eastman Kodak Co., Rochester, NY) for 24 h at 70 C.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Disclosure Statement: The authors have nothing to disclose.
First Published Online December 21, 2006
Abbreviations: AC, Adenylyl cyclase; CHO, Chinese hamster ovary; EB, extraction buffer; GFP, green fluorescent protein; GPCR, G protein-coupled receptor; GST, glutathione-S-transferase; GVBD, germinal vesicle breakdown; iPR, intracellular progestin receptor; mPR, membrane progestin receptor; XmPR, Xenopus progestin receptor.
Received for publication June 21, 2006. Accepted for publication December 1, 2006.
| REFERENCES |
|---|
|
|
|---|
S subunit, a component of the plasma membrane and yolk platelet membranes. J Cell Biol 130:275284
s levels regulate Xenopus laevis oocyte maturation. Mol Reprod Dev 63:104109[CrossRef][Medline]
reveal a new region important for its activation of adenylyl cyclase. FEBS Lett 340:249254[CrossRef][Medline]
subunits. Curr Biol 11:405416[CrossRef][Medline]
stimulated adenylyl cyclase is involved in Xenopus laevis oocyte maturation. J Cell Physiol 202:223229[CrossRef][Medline]
and Gß
in maintaining G2 arrest in Xenopus oocytes. J Cell Physiol 202:3240[CrossRef][Medline]
and ß
subunits. Cold Spring Harb Symp Quant Biol 57:135144
and may be a stage-specific elongation factor. J Cell Biol 112:237243NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
L. Sun, S. Haun, R. C. Jones, R. D. Edmondson, and K. Machaca Kinase-dependent Regulation of Inositol 1,4,5-Trisphosphate-dependent Ca2+ Release during Oocyte Maturation J. Biol. Chem., July 24, 2009; 284(30): 20184 - 20196. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Gellersen, M.S. Fernandes, and J.J. Brosens Non-genomic progesterone actions in female reproduction Hum. Reprod. Update, January 1, 2009; 15(1): 119 - 138. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Deng, S. Lang, C. Wylie, and S. R. Hammes The Xenopus laevis Isoform of G Protein-Coupled Receptor 3 (GPR3) Is a Constitutively Active Cell Surface Receptor that Participates in Maintaining Meiotic Arrest in X. laevis Oocytes Mol. Endocrinol., August 1, 2008; 22(8): 1853 - 1865. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Pang, J. Dong, and P. Thomas Estrogen Signaling Characteristics of Atlantic Croaker G Protein-Coupled Receptor 30 (GPR30) and Evidence It Is Involved in Maintenance of Oocyte Meiotic Arrest Endocrinology, July 1, 2008; 149(7): 3410 - 3426. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Stormshak and C. V. Bishop BOARD-INVITED REVIEW: Estrogen and progesterone signaling: Genomic and nongenomic actions in domestic ruminants J Anim Sci, February 1, 2008; 86(2): 299 - 315. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Hammes and E. R. Levin Extranuclear Steroid Receptors: Nature and Actions Endocr. Rev., December 1, 2007; 28(7): 726 - 741. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schumacher, R. Guennoun, A. Ghoumari, C. Massaad, F. Robert, M. El-Etr, Y. Akwa, K. Rajkowski, and E.-E. Baulieu Novel Perspectives for Progesterone in Hormone Replacement Therapy, with Special Reference to the Nervous System Endocr. Rev., June 1, 2007; 28(4): 387 - 439. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |