help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2006-0256
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Josefsberg Ben-Yehoshua, L.
Right arrow Articles by Maller, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Josefsberg Ben-Yehoshua, L.
Right arrow Articles by Maller, J. L.
Molecular Endocrinology 21 (3): 664-673
Copyright © 2007 by The Endocrine Society

The Role of Xenopus Membrane Progesterone Receptor ß in Mediating the Effect of Progesterone on Oocyte Maturation

Liat Josefsberg Ben-Yehoshua, Andrea L. Lewellyn, Peter Thomas and James L. Maller

Howard Hughes Medical Institute and Department of Pharmacology (L.J.B.-Y., A.L.L., J.L.M.), University of Colorado School of Medicine, Aurora, Colorado 80045; and Marine Sciences Institute (P.T.), University of Texas, Port Aransas, Texas 78373

Address all correspondence and requests for reprints to: James Maller, Howard Hughes Medical Institute, Department of Pharmacology, 8303, 12801 East 17th Avenue, P.O. Box 6511, Aurora, Colorado 80045. E-mail: Jim.Maller{at}uchsc.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Rapid, nongenomic membranal effects of progesterone were demonstrated in amphibian oocytes more than 30 y ago. Recently, a distinct family of membrane progestin receptors (mPRs) has been cloned in fish and other vertebrate species. In this study we explore the role of mPR in promoting oocyte maturation in Xenopus laevis. RT-PCR analysis indicates that Xenopus oocytes contain transcripts for the mPRß ortholog, similar to what has been reported in zebrafish oocytes, and Western blotting shows that the protein is expressed on the oocyte plasma membrane. Microinjection of mPRß-specific antibodies into oocytes resulted in a dramatic inhibition of progesterone-dependent oocyte maturation, whereas microinjection of mRNA encoding Myc-Xenopus mPR (XmPR)ß resulted in an accelerated rate of progesterone-induced oocyte maturation, concomitant with membranal localization of the protein. Binding studies in mammalian cells expressing XmPRß confirmed specific binding of progesterone by the expressed protein. These results suggest that XmPRß is a physiological progesterone receptor involved in initiating the resumption of meiosis during maturation of Xenopus oocytes.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PROGESTERONE INDUCTION OF oocyte maturation in amphibian oocytes has been suggested to occur via a nongenomic mechanism mediated by a receptor at the cell surface (reviewed in Ref. 1). GTP-dependent inhibition of oocyte plasma membranal adenylyl cyclase (AC) by progesterone has indicated that this receptor may be a G protein-coupled protein receptor (GPCR) (2, 3, 4, 5, 6, 7). Several reports in recent years have focused on the identity of the progestin receptor (PR). The classic intracellular (nuclear) PR (iPR) is present in Xenopus oocytes, and when overexpressed it enhances the rate of progesterone-induced germinal vesicle breakdown (GVBD), whereas oocytes injected with antisense oligonucleotides against the receptor are impaired in their response (8, 9). Subsequently the iPR was reported to be localized at the oocyte membrane (10), possibly through interaction of its proline-rich motif with the SH3 domain of the c-Src protooncogene (11).

Initial cloning of a novel membrane progestin receptor (mPR{alpha}) from sea trout ovary (12) has provided a candidate progesterone-sensitive GPCR. Subsequent cloning of mPR in fish, Xenopus, mice, and humans identified three homologs of mPR that are widely distributed in different tissues (12, 13). All the mPR homologs are predicted to have seven-transmembrane domains (13), and mPR{alpha} was shown in stably transfected MDA-MB-231 cells to inhibit cAMP production in a pertussis toxin-sensitive manner, as predicted for a GPCR linked to adenylyl cyclase (13, 14). Coimmunoprecipitation experiments provided direct evidence that endogenous mPR{alpha} and mPRß in myometrial cells associate with G{alpha}i before hormonal stimulation and dissociate after progesterone treatment (14). Interestingly, the involvement of a GPCR in mammalian meiotic maturation has been recently reported in an opposite regulatory context, where it is involved in the prevention of oocyte maturation. GPR3, a constitutively active orphan receptor, was shown to maintain meiotic arrest in mammalian oocytes (15). Knockout mice lacking this Gs-linked receptor resume meiosis within the antral follicles, circumventing inhibitory signals within the follicle. Subfertility and premature ovarian aging were also reported in a second Gpr3 null mouse strain (16). Ablation of another GPCR, GPR12 in rat oocytes, also resulted in meiotic resumption (17). It is interesting that different GPCRs have been suggested to regulate oocyte prophase arrest in different species. mPRs were also recently suggested to belong to a novel PAQR (progestin and Adipo Q receptors) family. PAQR is a conserved family of proteins spanning the plant to animal kingdoms (18). This family was identified by a novel motif, UPF0073 (Pfam domain, PF03006), consisting of seven-transmembrane domains (18, 19). All three mPR homologs contain this motif.

In this study we explore the role of the Xenopus laevis ortholog mPRß in promoting progesterone-induced oocyte maturation.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Xenopus Oocytes Express Xenopus mPRß (XmPRß)
The surface location of a progesterone receptor was established in previous studies in isolated oocytes incubated with nonpermeable progesterone reagents (20, 21), as well as by the inability of injected progesterone to stimulate oocyte maturation (22). To verify the membranal location of a progesterone receptor, we used a BSA-conjugated progesterone ligand unable to diffuse into the cell, hence acting at the surface only. This compound has been reported not to stimulate the transcriptional activity of iPR when incubated with mammalian cells (14). However, oocyte maturation was induced by BSA-conjugated progesterone in a dose-dependent manner (Fig. 1AGo).


Figure 1
View larger version (31K):
[in this window]
[in a new window]

 
Fig. 1. Xenopus Oocytes Express the XmPRß Ortholog

A, Immature oocytes were placed into media containing the indicated concentrations of BSA-conjugated progesterone, and the fraction of oocytes undergoing GVBD was determined as described in Materials and Methods. B, RT-PCR analysis of XmPRß and EF1-{alpha} RNA in stage VI oocytes in the absence or presence of progesterone (100 ng/ml) for 6 h (GVBD was evident at 4 h). C, XmPRß is detected in manually dissected membranes of stage VI oocytes by a specific antibody to the N terminus of XmPRß. Lower panel, Immunoblot of Xß-integrin serves as a membrane marker. Both antibodies require the use of nondenaturing sample buffer as described in Materials and Methods. The positions of molecular weight markers are shown on the left. D, Oocytes were injected with mRNA for myc-mPRß and incubated overnight before preparation of lysates for analysis. Upper panel, The N-terminal antibody immunoprecipitates Myc-tagged XmPRß; lower panel, the N-terminal antibody specifically immunoblots immunoprecipitated Myc-tagged XmPRb. IB, Immunoblot; IP, immunoprecipitate; N-term, N-terminal; Prog, progesterone.

 
Membrane actions of progesterone could be mediated by a novel family of mPRs (12, 13). The mPR family consists of three paralogs, {alpha}, ß, and {gamma}, expressed differently among various species. To verify whether mPR is present in Xenopus oocytes, we performed RT-PCR analysis. XmPRß transcripts were found in stage VI oocytes, and the transcript level did not change even after GVBD (Fig. 1BGo). Stage IV oocytes, unable to undergo GVBD in response to progesterone (23), express similar levels of XmPRß RNA, with no detectable changes in its expression after progesterone treatment (data not shown). BLAST search of sequence databases as well as direct PCR and plaque-lifting screens did not detect XmPR{alpha}-related transcripts (data not shown).

To determine the expression and localization of XmPRß protein, plasma membranes from oocytes were manually removed and extracted, and the level of the protein was verified by immunoblotting with specific antibodies raised against an N-terminal peptide of XmPRß. In nondenaturing gels, XmPRß from oocytes expressing the recombinant protein was detected as a single 60-kDa protein in oocyte membranes but not in the cytoplasm (Fig. 1CGo). The expression of ß-integrin confirms the membranal fractionation. Specificity of the antibody was verified by its ability to immunoprecipitate Myc-tagged XmPRß (Fig. 1DGo). The receptor was also recognized in reciprocal Myc-immunoprecipitates immunoblotted with the N-terminal antibody. Preincubation of the antibody with the corresponding peptide reduced the XmPRß signal detected from oocytes (data not shown). These results indicate that Xenopus oocytes express the ß-ortholog of the mPR family on the plasma membrane.

Neutralizing Antibodies Prevent Oocyte Maturation
The presence of both the XmPRß transcript and protein supports the hypothesis that XmPRß may be involved in mediating the effect of progesterone on meiosis. To determine whether XmPRß is required for progesterone-induced maturation, loss of function studies were performed by microinjecting oocytes before progesterone treatment with affinity-purified antibodies raised against two different regions of XmPRß, as described in Materials and Methods. Oocytes injected with control IgG or preimmune sera underwent GVBD normally after addition of progesterone, but GVBD was dramatically inhibited by both XmPRß-specific antibodies (Fig. 2AGo). Verification of antibody recognition of XmPRß was carried out by immunoprecipitation of in vitro transcribed and translated 35S-labeled XmPRß (Fig. 2BGo). Both antibodies immunoprecipitated the radiolabeled protein.


Figure 2
View larger version (33K):
[in this window]
[in a new window]

 
Fig. 2. Antibodies to XmPRß Inhibit Progesterone-Induced GVBD

A, Before progesterone treatment, oocytes were microinjected with affinity-purified antibodies raised against two different regions of XmPRß (anti-mPR1 and mPR2) or with control antibodies, as indicated. Oocytes were then incubated with progesterone (3 x 10–7 M) for the indicated times and monitored for oocyte maturation (GVBD). Preimmune sera and anti-XmPRß-depleted IgG serve as negative controls. B, XmPRß is recognized by two antibodies raised against two distinct regions of the protein (mPR1 and mPR2). 35S-labeled XmPRß translated in rabbit reticulocyte lysate was immunoprecipitated with anti-mPR1 and -2 antibodies. The immunoprecipitates were analyzed by SDS-PAGE and autoradiography as described in Materials and Methods. C, Biochemical markers of oocyte maturation are blocked by XmPRß neutralizing antibodies. Lysates of antibody-microinjected oocytes 6 h after progesterone administration were separated by SDS-PAGE and immunoblotted for active-phosphorylated MAPK, total MAPK, and Tyr-15-phosphorylated (inactive) Cdc2. D, The neutralizing effect of anti-mPR is eliminated by peptide competition. mPR2 antibody was pretreated with its peptide immunogen before microinjection. The fraction of oocytes that had matured 6 h after progesterone (3 x 10–6 M) addition is shown for noninjected oocytes, and those injected with neutralizing antibodies with or without the peptide or with peptide alone. Prog, Progesterone.

 
The neutralizing effect of the antibodies was further verified by examination of various biochemical markers of oocyte molecular activation: Mos synthesis (data not shown) as well as MAPK activation and Cdc2 dephosphorylation (Fig. 2CGo) were evident after progesterone treatment in control uninjected oocytes, as well as in oocytes injected with preimmune sera or flowthrough mPR-depleted IgG (Fig. 2CGo). In sharp contrast, the antibody-injected oocytes displayed neither Mos synthesis (data not shown) nor MAPK activation or dephosphorylated Cdc2 (Fig. 2CGo). This inhibitory effect of injected anti-XmPRß antibodies was dose-dependent, and oocyte maturation (supplemental Fig. S1A published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org) as well as MAPK activation (supplemental Fig. S1B) were blocked when 40 nl of 0.5 mg/ml of antibody was injected. Pretreatment of the antibodies with the peptide immunogen blocked their inhibitory effects on GVBD (Fig. 2DGo).

Overexpression of XmPRß Enhances Progesterone-Induced Oocyte Maturation
To further investigate the role of XmPRß in oocyte maturation, stage VI oocytes were microinjected with mRNA encoding either Myc-XmPRß or Myc-green fluorescent protein (GFP). Immunoblotting with anti-Myc antibody verified that the expression levels of both recombinant proteins in total oocyte lysates were comparable (Fig. 3AGo). Plasma membranes from mRNA injected-oocytes were manually removed and extracted, and the level of the overexpressed protein was verified by immunoblotting. Only XmPRß, not the GFP control, was found to be expressed in the membrane (Fig. 3BGo). The expression of ß-integrin confirms membranal localization and equal loading of samples on the gel. To exclude that cytoplasmic contamination accounts for the presence of Myc-XmPRß in the membrane extract, the level of MEK1, a highly abundant cytoplasmic protein, was examined. No detectable level of MEK1 was found in manually dissected plasma membranes (Fig. 3BGo).


Figure 3
View larger version (33K):
[in this window]
[in a new window]

 
Fig. 3. Ectopic XmPRß in Oocytes Is Localized to the Membrane and Enhances Progesterone-Induced Oocyte Maturation

Immature oocytes were microinjected with either Myc-tagged XmPRß or Myc-tagged GFP mRNA and incubated overnight. A, Total level of XmPRß and GFP expression in microinjected oocytes. Oocytes were lysed in buffer containing 1% Triton X-100 and immunoblotted for Myc (one oocyte per lane). The bottom panel is a loading control detecting the abundance of MEK1. B, Membranes from injected oocytes were manually removed, extracted, and immunoblotted with anti-Myc antibodies; the level of Xß-integrin serves as a membranal loading control, and MEK serve as a cytoplasmic marker. C, Oocytes injected with mRNA encoding Myc-GFP or Myc-XmPRß were incubated with progesterone (3 x 10–7 M) for the indicated times and monitored for oocyte maturation (GVBD). D, Oocytes, injected as in panel C were incubated with a suboptimal concentration of progesterone (3 x 10–8 M) for the indicated times and monitored for oocyte maturation (GVBD). MEK, MAPK kinase.

 
Next, oocytes injected with either Myc-XmPRß or Myc-GFP mRNA were incubated with progesterone and monitored for GVBD. Overexpression of XmPRß resulted in enhancement of progesterone-induced oocyte maturation. The time required for 50% of the oocytes to reach GVBD was reduced by about 40 min in the Myc-tagged XmPRß-injected oocytes as compared with GFP-injected ones (Fig. 3CGo). Dramatic enhancement of maturation occurred with suboptimal concentrations of progesterone (3 x 10–8 M) (Fig. 3DGo). XmPRß-expressing oocytes resumed meiosis hours before control GFP-injected oocytes, and the percentage of oocytes resuming meiosis increased. XmPRß migrating with the same apparent Mr was also evident in plasma membranes of smaller 0.95-mm diameter oocytes (data not shown) that do not undergo GVBD with progesterone (23). We also investigated whether even overexpression of XmPRß in stage IV oocytes could produce competence for progesterone-dependent maturation. Expression of Myc-XmPRß in stage IV oocytes did not result in induction of oocyte maturation by progesterone, despite the presence of additional translated mPRß protein (data not shown) and iPR levels comparable to stage VI oocytes (24).

Progesterone Binding to Plasma Membranes of Cells Transfected with XmPRß
Characterization of progesterone binding to XmPRß was carried out in Chinese hamster ovary (CHO) cells transiently transfected with cDNAs encoding Myc-XmPRß or Myc-GFP as described in Materials and Methods. Immunoprecipitation of XmPRß or GFP was carried out utilizing an antibody against the Myc tag, and the immunoprecipitated proteins were analyzed in a radioligand binding assay. Whereas negligible specific binding of radiolabeled progesterone was detected in control GFP-transfected cells, specific progesterone binding was detected in XmPRß-transfected cells (Fig. 4AGo). To verify the ligand specificity of the receptor, competition was performed by binding in the presence of an excess cold steroid. A 100-fold excess of testosterone or 17ß-estradiol did not reduce the binding of progesterone to the immunoprecipitated receptor (Fig. 4BGo), whereas the same concentration of progesterone reduced the binding by at least 60% (Fig. 4BGo).


Figure 4
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 4. Specific Binding of Radiolabeled Progesterone to XmPRß

A, Characterization of progesterone binding to XmPRß was carried out in CHO cells transiently transfected with cDNA encoding Myc-XmPRß or Myc-GFP. Myc immunoprecipitates were incubated with [3H]progesterone (30 nM) in the presence or absence a 100-fold excess of cold progesterone. Nonspecific, The radioligand count in the presence of cold progesterone. Specific, The difference between total and nonspecific binding of the radioligand. The results are shown as the mean ± SEM (n = 3). B, Radioligand binding was performed on Myc immunoprecipitates in the absence or presence of a 100-fold excess of cold progesterone, testosterone, or 17ß-estradiol (*, P < 0.07). Prog, Progesterone.

 
It was highly desirable to study binding in a stable cell line rather than after transient transfection, and therefore further characterization of XmPRß was carried out in stably transfected Flp-IN CHO cells as described in Materials and Methods. Expression of the protein in the cells revealed that the majority of the expressed protein is localized to the plasma membrane (Fig. 5AGo). Next, MAPK activation was assayed in the absence or presence of progesterone; phosphorylated MAPK was detected 10 min after the addition of progesterone in XmPRß-expressing cells, but not in control cells (Fig. 5BGo). Binding assays performed with membranes of XmPRß-transfected cells confirmed that progestin binding to the stably transfected cells was saturable (Fig. 5CGo). Scatchard analysis showed the presence of a single class of high-affinity binding sites [dissociation constant (Kd), 200 nM; Bmax, 1789 pmol/mg; Fig. 5CGo). This apparent Kd is near the effective EC50 for induction of maturation by progesterone (100 nM).


Figure 5
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 5. XmPRß Expression in a Stable CHO Cell Line

Stably transfected Flp-In CHO-K1 cells express a functional XmPRß protein. A, Cell fractionation reveals membranal localization of Myc-XmPRß (20 µg of protein loaded in each lane). To rule out any cytoplasmic contamination, {alpha}-tubulin was immunoblotted. B, XmPRß-expressing and control cells were serum starved overnight. Progesterone (30 nM) was added for 10 min, and cell extracts were then prepared and immunoblotted for phosphorylated (active) and total MAPK. C, Scatchard analysis of membrane steroid binding in Flp-In CHO cells stably expressing XmPRß. Binding was carried out as described in Materials and Methods. Inset, Representative plot of specific [3H]progesterone binding to membrane extracts. Open circles, Total binding; open triangles, specific binding; open squares, nonspecific binding.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The induction of oocyte maturation by progesterone is a classic example of a rapid, nongenomic effect of a steroid, postulated to be mediated by a surface receptor. The nongenomic, surface receptor characteristics of progesterone-dependent oocyte maturation were reported more than three decades ago (reviewed in Ref. 1). In the original experiments by Masui and Markert (22) and Smith and Ecker (25), oocyte maturation was induced by incubating the oocyte in media containing progesterone, whereas injection of progesterone into the oocyte failed to induce oocyte maturation. Contrasting reports of maturation in progesterone-injected oocytes (26) are likely a result of external leakage of the injected steroid, because microinjection of steroid in oil also results in maturation of adjacent, but not distant, oocytes in the culture dish (Ref. 22) and Y. Masui, personal communication). Polymer-linked progesterone, which cannot penetrate the oocyte, was reported to induce oocyte maturation, but was inactive when injected into the oocytes (20). Similarly, steroid-bound agarose beads induced GVBD when in contact with oocytes but not in oocytes placed apart from the beads (21). Addition of progesterone to a prophase extract has no detectable biochemical effects, consistent with progesterone action on a plasma membrane receptor removed by centrifugation during preparation of the extract (27). Induction of maturation by BSA-conjugated progesterone in this study (Fig. 1Go) also supports surface expression of the receptor mediating maturation.

Because progesterone induces biochemical events in enucleated oocytes and inhibition of transcription by actinomycin D has no effect on maturation (22), a nongenomic steroid receptor mechanism has been attributed to this receptor. In addition, the rate with which biological effects could be measured ruled out genomic effects, e.g. a decrease in intracellular cAMP detected within seconds of progesterone addition (28). Perhaps the most compelling evidence for a membrane receptor came from studies in several laboratories that showed steroid-dependent inhibition of adenylyl cyclase in isolated plasma membranes in a GTP-dependent manner (2, 3, 4, 5, 6, 7).

In this study we set out to examine the role in oocyte maturation of a Xenopus ortholog of a novel family of mPRs. In principle, several distinct criteria must be satisfied to qualify as a relevant membrane progesterone receptor: specific progesterone binding; membranal localization; and biological effects on oocyte maturation (29). Our studies provide evidence for expression on the oocyte plasma membrane of endogenous as well as ectopic XmPRß. Similarly, in mammalian cells stably transfected with XmPRß, the protein was found to be expressed only in the plasma membrane. Moreover, mPR expressed in mammalian cells responded to progesterone by rapid activation of MAPK (Ref. 13 and Fig. 5Go) as well as by reduced cAMP production (13). A key role for XmPRß in progesterone-mediated oocyte maturation is evident from loss of function studies with two specific antibodies raised against distinct regions of the protein (Fig. 2Go). In addition, the enhancement of maturation by XmPRß expression (Fig. 3Go) supports the idea that this receptor is linked to signaling pathways that control the resumption of meiosis. We conclude that XmPRß fulfills all the criteria for a progesterone receptor involved in oocyte maturation.

However, our results do not exclude the possibility that some effects of progesterone in oocytes may be mediated by the classic iPR, because overexpression of iPR also accelerates the rate of oocyte maturation (8, 9). Because the majority of iPR was reported to be localized in the cytoplasm, it is plausible that its effects are thorough the direct activation of MAPK, evading membrane-initiated signaling. Studies in our laboratory have shown that activation of v-Src and other agents that activate MAPK and its substrate Rsk1 lead to an accelerated rate of GVBD (30, 31), and the ability of iPR to accelerate the rate of GVBD depends on the praline-rich motif of mPR that interacts with c-Src (11). In this paper we provide evidence of additional progesterone signaling through the novel mPRß homolog pathway that is membrane initiated and nongenomic. The interplay between the two receptor subtypes may contribute additively to activation of the meiotic process, because the requirement of 50–100 nM progesterone for GVBD, higher than the 1 nM required for transcriptional activation by iPR, suggests a requirement for mPR binding, the apparent Kd of which for progesterone is 200 nM (Fig. 5Go). Similarly, RU486, an antagonist of iPR, does not block progesterone-induced GVBD and instead has a weak agonist effect on oocyte maturation (32). Whether RU486 binds mPR is unknown, but Xenopus iPR, as well as chicken and hamster iPR, lack the glycine residue reported to be essential for PR binding of RU486 (33).

The mPR family of proteins consists of three different paralogs that have been cloned in fish and other vertebrate species including humans (12, 13). The archetype {alpha} ortholog was cloned from a spotted sea trout ovarian cDNA library, and the localization of this transcript is confined to reproductive and neuroendocrine tissues (ovary, testes, and pituitary) (13). Representatives of mPR have been found in other organisms including various fish, frog, mice, pigs, and humans (12). In higher eukaryotes all three mPR subtypes were identified and found to have distinct tissue distributions. We report here the involvement of the ß-ortholog in Xenopus oocyte maturation. Similar findings of mPRß expression were reported in rainbow trout oocytes (34) as well as in rat corpus lutea (35). The dual presence of both {alpha}- and ß-transcripts was demonstrated in zebrafish ovaries (36), and, in catfish ovaries, all three transcripts, {alpha}, ß, and {gamma}, are present (37). It cannot be excluded at this time that the {alpha}-paralog is also present and involved in Xenopus oocyte maturation, but extensive efforts to clone a Xenopus {alpha}-ortholog have been unsuccessful (Ref. 12 and data not shown).

Ectopic expression of XmPRß in immature oocytes results in an accelerated rate of GVBD, which is dramatic under conditions of suboptimal concentrations of progesterone (Fig. 3Go). XmPRß is present in stage IV oocytes unable to resume meiosis in response to progesterone, and even higher expression of mPRß after mRNA injection did not result in acquisition of meiotic competence, indicating that the deficiency may not be related to whether or not mPR is present. In addition, adenylyl cyclase activity stimulated by guanyl-5'-yl-imidodiphosphate is equally inhibited by progesterone in plasma membranes from both stages, and injection of PKI, the inhibitor of cAMP-dependent protein kinase, induces oocyte maturation only in stage VI, not stage IV, oocytes (23). Other studies have reported that membranes of even smaller stage I–III oocytes do not bind progesterone (38).

Another group of steroids, androgens, have also been implicated in induction of Xenopus oocyte maturation. Androgens have been detected in the serum and ovaries of ovulating frogs, and both androstenedione and testosterone are able to promote oocyte maturation, possibly through the classical androgen receptor present in oocytes (38). Furthermore, cytochrome P450-17, steroid 17{alpha}-hydroxylase, which can convert progesterone to androstenedione, is present in oocytes (38, 39, 40), suggesting that androgens stimulate a pathway promoting maturation. However, inhibition of the classical androgen receptor by the androgen receptor antagonist flutamide had no effect on progesterone-mediated maturation, arguing against androstenedione as the final mediator of progesterone action (38). Additionally, prevention of progesterone conversion to androstenedione by inhibition of cytochrome P450-17 had no deleterious effect on progesterone-mediated maturation (39, 40). In any case the results reported here demonstrate testosterone does not compete for progesterone binding (Fig. 4Go), and therefore the pathway mediated by XmPRß does not involve androgens.

Although the downstream effectors of mPR remain elusive, evidence suggests a mutual requirement for both G{alpha}s and Gß{gamma}. Activation of G{alpha}s by cholera toxin has been shown to potently inhibit progesterone-induced oocyte maturation (28, 41). The direct involvement of G{alpha}s was demonstrated in loss of function experiments that resulted in spontaneous oocyte maturation (42, 43), and overexpression of G{alpha}s resulted in inhibition of progesterone-dependent oocyte maturation (43). Moreover, G{alpha}s-dependent AC activity activated by cholera toxin is inhibited by progesterone in oocyte plasma membranes (2). Interestingly, the XG{alpha}s sequence is 92% identical to the human one, but the in vitro translated Xenopus ortholog is unable to activate AC in G{alpha}s-deficient S49 cells (44). Conversely, regulation of oocyte maturation by the ß {gamma} subunits of heterotrimeric G proteins has been reported. Overexpression of Gß{gamma} inhibits progesterone-dependent oocyte maturation (38, 45), whereas its inhibition initiated spontaneous maturation (45) or enhanced progesterone-induced oocyte maturation (38). These results suggest an antagonizing effect of progesterone on activity mediated by a constitutively active, inhibitory {gamma}. Evidence supporting a mutual requirement for both G{alpha}s and Gß{gamma} has come from studies on AC isoforms in oocytes. An ortholog of AC7 was cloned from Xenopus oocytes, which is a Gß{gamma}-activated isoform (46, 47). Similar to findings in mammals (48), Gß{gamma} stimulation of AC in oocyte membranes was dependent on G{alpha}s activation, and interference with AC/Gß{gamma} association accelerated progesterone-induced GVBD (46).

The progesterone binding of mPR, a putative GPCR, raises the possibility that some of the orphan GPCRs may have a steroidal ligand. Indeed, GPR30 has been recently shown to possess all the binding and signaling characteristics of a membranal estrogen receptor (49, 50). A membranal androgen-binding receptor that has not yet been cloned is also reported to activate G proteins (51). Only future structural analysis will verify whether these steroid receptors all belong to a superfamily of steroid-binding membrane receptors or constitute distinct families. In any case, the results presented here show that mPRß in a physiological context has the appropriate biological effects, expression, binding characteristics, and membrane localization to be implicated as a relevant progesterone receptor for Xenopus oocyte maturation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmids
The cDNA encoding Xenopus mPRß was amplified by PCR from the pCRII-TOPO clone isolated from stage VI Xenopus oocytes (12). The PCR product was cloned into the pCS2–6Myc vector, which encodes an N-terminal 6 Myc repeat tag, modified for ligation-independent cloning (pCS26MT LIC; Novagen, Madison, WI). This construct was used for production of mRNA, in vitro transcription and translation of XmPRß, and transient transfection of CHO cells. A 6-Myc XmPRß fragment was subcloned into pcDNA5/FRT/TO (Invitrogen, Carlsbad, CA), following the manufacturer’s suggested protocol, and used for generation of a stable Flp-In CHO cell line. An N-terminal fragment of XmPRß encoding the first 100 amino acids was subcloned into a pGEX-6p1 vector. This construct was used for the expression of glutathione-S-transferase (GST)-N-terminal XmPRß in bacteria. All plasmids were fully sequenced over the entire coding region to ensure no unwanted mutations had been introduced by PCR.

Generation of Recombinant Proteins and Antibodies
Recombinant protein was isolated from the bacterial strain Rosetta(DE3)pLysS (Novagen) after treatment for 4 h at 37 C with 500 µM isopropyl 1-thio-D-galactopyranoside. The GST-tagged protein was isolated from the post-28,000 x g pellet in 3 M guanidine using glutathione-agarose beads. The bead-bound protein was solubilized in sample buffer and loaded onto an SDS-PAGE, and the appropriate band was excised from an unfixed gel after visualization in 0.5 M KCl.

Antibodies against XmPRß were produced by immunization of rabbits with the peptides mPR1-CPVPEKYFPGSCDFIGHGH or mPR2-QVVPAGLAYILDISPVVHR, corresponding to two distinct regions within the molecule. Peptides were covalently bound to keyhole limpet hemocyanin (KLH) before immunization. The antibodies to N-terminal XmPRß were raised against the bacterially produced GST-tagged polypeptide encoding amino acids 1–100 of XmPRß. Affinity purification of anti-mPR1 and -2 was performed by conjugating the appropriate peptide to Affi-gel 10 (Bio-Rad Laboratories, Hercules, CA), following the manufacturer’s instructions. Antibodies were eluted with 100 mM glycine (pH 2.5), followed by base elution with triethylamine (pH 11.5). Eluted antibodies were immediately neutralized in 100 mM Tris (pH 8.0), concentrated on a Microcon 20 spin column (Millipore Corp., Bedford, MA), and stored at 4 C. Preimmune serum was used as control. In addition, IgG in the flowthrough of the affinity column after three consecutive purifications was further purified on a Protein A column, eluted in 100 mM glycine (pH 2.5), neutralized with 100 mM Tris (pH 8.0), and concentrated on a spin column. The antibodies to N-terminal XmPRß were purified by retroelution. Serum was incubated overnight at 4 C with a polyvinylidine difluoride membrane strip containing 50 µg of GST N-terminal XmPRß. After several washes with PBS, the antibodies were retroeluted with 100 mM glycine (pH 2.5), neutralized in 100 mM Tris (pH 8.0), and stored at 4 C.

Isolation of Xenopus Oocytes and Meiotic Maturation
Oocytes were isolated from ovarian fragments taken from frogs primed with 35 IU of pregnant mare serum gonadotropin (Calbiochem) 72 h before the experiment. Oocytes were collected by manual dissection or by consecutive incubation in dispase (0.5 mg/ml) for 2 h followed by digestion with collagenase type 1A (0.8 mg/ml) for 1 h or longer, until the oocytes were clearly free of blood vessels. To induce meiotic maturation, oocytes were incubated in the presence of 100 ng/ml (3 x 10–7 M) progesterone (Sigma Chemical Co., St. Louis, MO) or increasing concentrations of BSA-conjugated progesterone (Steraloids, Wilton, CT). The appearance of a white spot in the center of the animal pole, indicative of GVBD and reentry into meiosis from the G2 arrested state, was scored with a dissecting microscope. Manual dissection of plasma membranes was performed by careful puncturing of the oocytes in Merriam Buffer (10 mM HEPES, pH 7.6; 88 mM NaCl; 1 mM KCl; 0.33 mM Ca(NO3)2; 0.41 mM CaCl2; 0.82 mM MgSO4) and gentle removal of membranes with a watchman forceps in membrane dissection buffer (10 mM HEPES, pH 7.9; 10 mM NaCl) (2). Membranes were collected and frozen in membrane lysis buffer (50 mM Tris-HCl, pH 7.4; 80 mM ß-glycerophosphate; 20 mM EDTA; 3 µM microcystin LR; 1% Triton X-100) and complete EDTA-free protease inhibitor cocktail (Roche Clinical Laboratories, Indianapolis, IN). All animal experimentation was conducted in accordance with accepted standards of humane animal care.

Generation of mRNAs
XmPRß and GFP mRNAs were produced from NotI-linearized pCS2–6MTLIC XmPRß and pCS2–6MTGFP plasmids using the SP6 mMessage mMachine kit (Ambion, Inc., Austin, TX). Stage VI oocytes were injected with mRNA (30–50 ng) in 30–50 nl water, and recombinant protein was allowed to accumulate overnight at 18 C. To obtain oocytes that had undergone GVBD, 100 ng/ml progesterone was added the next morning to induce maturation. Oocytes were monitored for GVBD and collected at the desired time points, and kept at –80 C until assay.

RT-PCR Analysis
Total RNA was extracted from 10 oocytes at various stages of meiosis using the Trizol reagent (Invitrogen) according to the manufacturer’s instructions. The RNA was reverse transcribed using the SuperScript first-strand synthesis system (Invitrogen). PCR amplification was carried out with 2 µl of cDNA using Accuprime II mix (Invitrogen), and oligonucleotide primers for XmPRß (forward, GGCTCACTACTACTACACTTCC; and reverse, GCATAAACGGCAGTGAAGGTGC) and primers for Elongation factor 1{alpha} (EF1{alpha}) (forward, CCTGAACCACCCAGGCCAGATTGGTG; and reverse, GAGGGTAGTCAGAGAAGCTCTCCACG). Multiplex PCR was performed by addition of the XmPRß primers for the first 10 cycles followed by Ef1{alpha} primers for 25 additional cycles. The PCR products were run on a 2% agarose gel and visualized by ethidium bromide treatment for 10 min, followed by several washes in deionized water. The images were captured with a Fluorchem 8900 analyzer (Alpha Innotech, San Leandro, CA). PCR products were sequenced and were found to be 99% identical to reported sequences of XmPRß and 100% identical to reported Ef1a (52).

Microinjection of XmPRß Neutralizing Antibodies
To assess the effect of XmPRß antibodies on maturation, oocytes were injected with the appropriate antibody (50 nl of 0.1 to 1 mg/ml) for 2 h before progesterone addition. Control oocytes were injected with preimmune sera, XmPRß-depleted IgG at the same concentration, or affinity-purified antibodies preincubated for 2 h with an excess amount of the peptide used for immunization. Injected oocytes were monitored for GVBD, frozen at the desired time points, and kept at –80 C until assay.

Generation of a Stable XmPRß-Expressing CHO Cell Line and Radioligand Binding Assay
CHO-K1 cells were transiently transfected with either pCS2–6Myc LIC XmPRß or pCS2–6MycGFP using Lipofectamine 2000 (Invitrogen), following the manufacturer’s suggested protocol. The Flp-In CHO cell line (Invitrogen) was stably transfected with pcDNA5 FRT TOPO 6 Myc-XmPRß, using Lipofectamine 2000 (Invitrogen), following the manufacturer’s suggested protocol and placed in Hygromycin B (Invitrogen) 48 h after transfection. Positive clones were identified by immunoblotting as well as by immunofluorescence of Myc-tagged protein. Cells transiently transfected with 6 Myc-XmPRß or Myc-GFP were extracted with HAED buffer (25 mM HEPES; 10 mM NaCl; 1 mM EDTA, pH 7.6), washed once, and sonicated for 9 sec. The nuclei, mitochondria, and cellular debris were removed after centrifugation at 1000 x g at 4 C for 5 min. The supernatant was then centrifuged at 40,000 x g for 40 min at 4 C, and the clarified extract was subjected to immunoprecipitation with agarose-conjugated Myc antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) for 2 h at 4 C. After several washes with HAED buffer, equal aliquots of the bead-bound immunoprecipitates were assayed for progesterone binding. Triplicate aliquots were incubated with 30 nM progesterone [1,2,6,7-3H (N)] S.A. 102 Ci/mmol (PerkinElmer, Wellesley, MA) for 30 min at 4 C. For competition studies, binding was performed in the presence of a 100-fold excess of cold progesterone, 17ß-estradiol, or testosterone (Sigma). The binding reaction was stopped by six consecutive washes with HAEW buffer (25 mM HEPES; 1 mM NaCl; 1 mM EDTA, pH 7.6). The beads were then resuspended in 100 µl HAEW buffer and transferred to scintillation cocktail, and radioactivity was determined in a Beckman LS 6000 scintillation counter. Alternatively, membranes from Flp-In CHO cells stably expressing XmPRß were collected by centrifugation at 40,000 x g and resuspended in HAED buffer. The binding assay on 100-µg membrane samples was performed as described previously (13). Briefly, samples were incubated for 30 min at 4 C with increasing concentrations of radiolabeled progesterone [1,2,6,7-3H (N)] S.A. 102 Ci/mmol (PerkinElmer) in the absence or presence of a 100-fold excess of cold progesterone. The binding reaction was stopped by filtration onto GF/B fiberglass filters (Whatman, Clifton, NJ) using a sampling manifold filtration system (Millipore). Each filter was rinsed with 50 ml of HAEW buffer, allowed to vacuum dry, and counted in a scintillation counter. Each sample was assayed in triplicate, and specific binding in each sample was calculated by deducting nonspecific binding from total binding.

SDS-PAGE, Western Blotting, and Immunoprecipitation
Oocytes were lysed in extraction buffer (EB) (50 mM Tris-HCl pH 7.4, 80 mM ß-glycerophosphate, 20 mM EDTA, 1 mM dithiothreitol, 3 µM microcystin LR, 0.2% Triton X-100) plus protease inhibitor cocktail and centrifuged at 10,000 x g for 5 min. In general, extract supernatant corresponding to one oocyte was loaded per lane. For detection of XmPRß and Xß-integrin, oocytes were extracted in nondenaturing buffer (lacking either dithiothreitol or ß-mercaptoethanol). After SDS-PAGE, the proteins were transferred to polyvinylidine difluoride membranes using a semidry apparatus. The membrane was blocked with 2.5% BSA, 0.5% OVA, 2.5% dry skim milk, 10 mM Tris, 150 mM NaCl for 1 h at room temperature. Primary antibodies were incubated overnight at 4 C, followed by multiple washes in Tris-buffered saline-Tween 20. The appropriate horseradish peroxidase-conjugated secondary antibodies were incubated in the blocking solution for 1 h at room temperature, followed by multiple washes with Tris-buffered saline-Tween 20. Chemiluminescence was detected using a PerkinElmer enhanced chemiluminescence kit in accordance with the manufacturer’s protocol.

In vitro transcribed and translated 35S-labeled XmPRß protein was produced with a TNT quick kit (Promega). The labeled protein solution was precleared with protein A agarose beads that were precoated with 10% BSA. About 5 µg of affinity-purified XmPRß antibodies were then incubated with the precleared XmPRß solution for 2 h at 4 C and precipitated with protein A-Sepharose beads (50% slurry) in EB. Immunoprecipitates were washed twice with low-salt buffer (100 mM NaCl in EB), twice with high-salt buffer (500 mM NaCl in EB), and once with EB. The immunoprecipitates were separated on SDS-PAGE, followed by fixation and incubation with Amplify Fluorographic Reagent (Amersham Pharmacia Biotech, Arlington Heights, IL). The dried gel was exposed to Kodak BioMAX MR film (Eastman Kodak Co., Rochester, NY) for 24 h at –70 C.


    ACKNOWLEDGMENTS
 
We thank Johne Liu (Ottawa, Ontario, Canada) for his kind gift of antibodies against Xß-integrin, Dean Edwards (Department of Pathology, University of Colorado School of Medicine) for helpful discussions, and Junjun Liu for assistance with figure preparation.


    FOOTNOTES
 
This work was supported by the Howard Hughes Medical Institute and by National Institutes of Health Grant ESO12961 (to P.T.). L.J.B.-Y. is an Associate and J.L.M. an Investigator of the Howard Hughes Medical Institute.

Disclosure Statement: The authors have nothing to disclose.

First Published Online December 21, 2006

Abbreviations: AC, Adenylyl cyclase; CHO, Chinese hamster ovary; EB, extraction buffer; GFP, green fluorescent protein; GPCR, G protein-coupled receptor; GST, glutathione-S-transferase; GVBD, germinal vesicle breakdown; iPR, intracellular progestin receptor; mPR, membrane progestin receptor; XmPR, Xenopus progestin receptor.

Received for publication June 21, 2006. Accepted for publication December 1, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Maller JL 2001 The elusive progesterone receptor in Xenopus oocytes. Proc Natl Acad Sci USA 98:8–10[Free Full Text]
  2. Sadler SE, Maller JL 1981 Progesterone inhibits adenylate cyclase in Xenopus oocytes. Action on the guanine nucleotide regulatory protein. J Biol Chem 256:6368–6373[Free Full Text]
  3. Sadler SE, Maller JL 1983 Inhibition of Xenopus oocyte adenylate cyclase by progesterone and 2',5'-dideoxyadenosine is associated with slowing of guanine nucleotide exchange. J Biol Chem 258:7935–7941[Abstract/Free Full Text]
  4. Jordana X, Olate J, Allende CC, Allende JE 1984 Studies on the mechanism of inhibition of amphibian oocyte adenylate cyclase by progesterone. Arch Biochem Biophys 228:379–387[CrossRef][Medline]
  5. Finidori J, Hanoune J, Baulieu EE 1982 Adenylate cyclase in Xenopus laevis oocytes: characterization of the progesterone-sensitive, membrane-bound form. Mol Cell Endocrinol 28:211–227[CrossRef][Medline]
  6. Finidori-Lepicard J, Schorderet-Slatkine S, Hanoune J, Baulieu EE 1981 Progesterone inhibits membrane-bound adenylate cyclase in Xenopus laevis oocytes. Nature 292:255–257[CrossRef][Medline]
  7. Kostellow AB, Ziegler D, Morrill GA 1980 Regulation of Ca2+ and cyclic AMP during the first meiotic division in amphibian oocytes by progesterone. J Cyclic Nucleotide Res 6:347–358[Medline]
  8. Bayaa M, Booth RA, Sheng Y, Liu XJ 2000 The classical progesterone receptor mediates Xenopus oocyte maturation through a nongenomic mechanism. Proc Natl Acad Sci USA 97:12607–12612[Abstract/Free Full Text]
  9. Tian J, Kim S, Heilig E, Ruderman JV 2000 Identification of XPR-1, a progesterone receptor required for Xenopus oocyte activation. Proc Natl Acad Sci USA 97:14358–14363[Abstract/Free Full Text]
  10. Bagowski CP, Myers JW, Ferrell Jr JE 2001 The classical progesterone receptor associates with p42 MAPK and is involved in phosphatidylinositol 3-kinase signaling in Xenopus oocytes. J Biol Chem 276:37708–37714[Abstract/Free Full Text]
  11. Boonyaratanakornkit V, Scott MP, Ribon V, Sherman L, Anderson SM, Maller JL, Miller WT, Edwards DP 2001 Progesterone receptor contains a proline-rich motif that directly interacts with SH3 domains and activates c-Src family tyrosine kinases. Mol Cell 8:269–280[CrossRef][Medline]
  12. Zhu Y, Bond J, Thomas P 2003 Identification, classification, and partial characterization of genes in humans and other vertebrates homologous to a fish membrane progestin receptor. Proc Natl Acad Sci USA 100:2237–2242[Abstract/Free Full Text]
  13. Zhu Y, Rice CD, Pang Y, Pace M, Thomas P 2003 Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes. Proc Natl Acad Sci USA 100:2231–2236[Abstract/Free Full Text]
  14. Karteris E, Zervou S, Pang Y, Dong J, Hillhouse EW, Randeva HS, Thomas P 2006 Progesterone signaling in human myometrium through two novel membrane G protein coupled receptors: potential role in functional progesterone withdrawal at term. Mol Endocrinol 20:1519–1534[Abstract/Free Full Text]
  15. Mehlmann LM, Saeki Y, Tanaka S, Brennan TJ, Evsikov AV, Pendola FL, Knowles BB, Eppig JJ, Jaffe LA 2004 The Gs-linked receptor GPR3 maintains meiotic arrest in mammalian oocytes. Science 306:1947–1950[Abstract/Free Full Text]
  16. Ledent C, Demeestere I, Blum D, Petermans J, Hamalainen T, Smits G, Vassart G 2005 Premature ovarian aging in mice deficient for Gpr3. Proc Natl Acad Sci USA 102:8922–8926[Abstract/Free Full Text]
  17. Hinckley M, Vaccari S, Horner K, Chen R, Conti M 2005 The G-protein-coupled receptors GPR3 and GPR12 are involved in cAMP signaling and maintenance of meiotic arrest in rodent oocytes. Dev Biol 287:249–261[CrossRef][Medline]
  18. Tang YT, Hu T, Arterburn M, Boyle B, Bright JM, Emtage PC, Funk WD 2005 PAQR proteins: a novel membrane receptor family defined by an ancient 7-transmembrane pass motif. J Mol Evol 61:372–380[CrossRef][Medline]
  19. Lyons TJ, Villa NY, Regalla LM, Kupchak BR, Vagstad A, Eide DJ 2004 Metalloregulation of yeast membrane steroid receptor homologs. Proc Natl Acad Sci USA 101:5506–5511[Abstract/Free Full Text]
  20. Godeau JF, Schorderet-Slatkine S, Hubert P, Baulieu EE 1978 Induction of maturation in Xenopus laevis oocytes by a steroid linked to a polymer. Proc Natl Acad Sci USA 75:2353–2357[Abstract/Free Full Text]
  21. Ishikawa K, Hanaoka Y, Kondo Y, Imai K 1977 Primary action of steroid hormone at the surface of amphibian oocyte in the induction of germinal vesicle breakdown. Mol Cell Endocrinol 9:91–100[CrossRef][Medline]
  22. Masui Y, Markert CL 1971 Cytoplasmic control of nuclear behavior during meiotic maturation of frog oocytes. J Exp Zool 177:129–145[CrossRef][Medline]
  23. Sadler SE, Maller JL 1983 The development of competence for meiotic maturation during oogenesis in Xenopus laevis. Dev Biol 98:165–172[CrossRef][Medline]
  24. Liu XS, Ma C, Hamam A-W, Liu XJ 2005 Transcription-dependent and transcription-independent functions of the classical progesterone receptor in Xenopus ovaries. Dev Biol 283:180–190[CrossRef][Medline]
  25. Smith LD, Ecker RE 1971 The interaction of steroids with Rana pipiens oocytes in the induction of maturation. Dev Biol 25:232–247[CrossRef][Medline]
  26. Tso J, Thibier C, Mulner O, Ozon R 1982 Microinjected progesterone reinitiates meiotic maturation of Xenopus laevis oocytes. Proc Natl Acad Sci USA 79:5552–5556[Abstract/Free Full Text]
  27. Qian YW, Erikson E, Taieb FE, Maller JL 2001 The polo-like kinase Plx1 is required for activation of the phosphatase Cdc25C and cyclin B-Cdc2 in Xenopus oocytes. Mol Biol Cell 12:1791–1799[Abstract/Free Full Text]
  28. Maller JL, Butcher FR, Krebs EG 1979 Early effect of progesterone on levels of cyclic adenosine 3':5'-monophosphate in Xenopus oocytes. J Biol Chem 254:579–582[Abstract/Free Full Text]
  29. Maller JL 2003 Signal transduction. Fishing at the cell surface. Science 300:594–595[Abstract/Free Full Text]
  30. Spivack JG, Erikson RL, Maller JL 1984 Microinjection of pp60v-src into Xenopus oocytes increases phosphorylation of ribosomal protein S6 and accelerates the rate of progesterone-induced meiotic maturation. Mol Cell Biol 4:1631–1634[Abstract/Free Full Text]
  31. Gross SD, Lewellyn AL, Maller JL 2001 A constitutively active form of the protein kinase p90Rsk1 is sufficient to trigger the G2/M transition in Xenopus oocytes. J Biol Chem 276:46099–46103[Abstract/Free Full Text]
  32. Sadler SE, Bower MA, Maller JL 1985 Studies of a plasma membrane steroid receptor in Xenopus oocytes using the synthetic progestin RU 486. J Steroid Biochem 22:419–426[CrossRef][Medline]
  33. Benhamou B, Garcia T, Lerouge T, Vergezac A, Gofflo D, Bigogne C, Chambon P, Gronemeyer H 1992 A single amino acid that determines the sensitivity of progesterone receptors to RU486. Science 255:206–209[Abstract/Free Full Text]
  34. Mourot B, Nguyen T, Fostier A, Bobe J 2006 Two unrelated putative membrane-bound progestin receptors, progesterone membrane receptor component 1 (PGMRC1) and membrane progestin receptor (mPR) ß, are expressed in the rainbow trout oocyte and exhibit similar ovarian expression patterns. Reprod Biol Endocrinol 4:6[CrossRef][Medline]
  35. Cai Z, Stocco C 2005 Expression and regulation of progestin membrane receptors in the rat corpus luteum. Endocrinology 146:5522–5532[Abstract/Free Full Text]
  36. Thomas P, Pang Y, Zhu Y, Detweiler C, Doughty K 2004 Multiple rapid progestin actions and progestin membrane receptor subtypes in fish. Steroids 69:567–573[CrossRef][Medline]
  37. Kazeto Y, Goto-Kazeto R, Thomas P, Trant JM 2005 Molecular characterization of three forms of putative membrane-bound progestin receptors and their tissue-distribution in channel catfish, Ictalurus punctatus. J Mol Endocrinol 34:781–791[Abstract/Free Full Text]
  38. Lutz LB, Cole LM, Gupta MK, Kwist KW, Auchus RJ, Hammes SR 2001 Evidence that androgens are the primary steroids produced by Xenopus laevis ovaries and may signal through the classical androgen receptor to promote oocyte maturation. Proc Natl Acad Sci USA 98:13728–13733[Abstract/Free Full Text]
  39. White SN, Jamnongjit M, Gill A, Lutz LB, Hammes SR 2005 Specific modulation of nongenomic androgen signaling in the ovary. Steroids 70:352–360[CrossRef][Medline]
  40. Yang WH, Lutz LB, Hammes SR 2003 Xenopus laevis ovarian CYP17 is a highly potent enzyme expressed exclusively in oocytes. Evidence that oocytes play a critical role in Xenopus ovarian androgen production. J Biol Chem 278:9552–9559[Abstract/Free Full Text]
  41. Schorderet-Slatkine S, Schorderet M, Boquet P, Godeau F, Baulieu EE 1978 Progesterone-induced meiosis in Xenopus laevis oocytes: a role for cAMP at the "maturation-promoting factor" level. Cell 15:1269–1275[CrossRef][Medline]
  42. Gallo CJ, Hand AR, Jones TL, Jaffe LA 1995 Stimulation of Xenopus oocyte maturation by inhibition of the G-protein {alpha} S subunit, a component of the plasma membrane and yolk platelet membranes. J Cell Biol 130:275–284[Abstract/Free Full Text]
  43. Romo X, Hinrichs MV, Guzman L, Olate J 2002 G{alpha}s levels regulate Xenopus laevis oocyte maturation. Mol Reprod Dev 63:104–109[CrossRef][Medline]
  44. Antonelli M, Birnbaumer L, Allende JE, Olate J 1994 Human-Xenopus chimeras of Gs {alpha} reveal a new region important for its activation of adenylyl cyclase. FEBS Lett 340:249–254[CrossRef][Medline]
  45. Sheng Y, Tiberi M, Booth RA, Ma C, Liu XJ 2001 Regulation of Xenopus oocyte meiosis arrest by G protein ß{gamma} subunits. Curr Biol 11:405–416[CrossRef][Medline]
  46. Guzman L, Romo X, Grandy R, Soto X, Montecino M, Hinrichs M, Olate J 2005 A Gß{gamma} stimulated adenylyl cyclase is involved in Xenopus laevis oocyte maturation. J Cell Physiol 202:223–229[CrossRef][Medline]
  47. Sheng Y, Montplaisir V, Liu XJ 2005 Co-operation of Gs{alpha} and Gß{gamma} in maintaining G2 arrest in Xenopus oocytes. J Cell Physiol 202:32–40[CrossRef][Medline]
  48. Tang WJ, Iniguez-Lluhi JA, Mumby S, Gilman AG 1992 Regulation of mammalian adenylyl cyclases by G-protein {alpha} and ß {gamma} subunits. Cold Spring Harb Symp Quant Biol 57:135–144[Abstract/Free Full Text]
  49. Revankar CM, Cimino DF, Sklar LA, Arterburn JB, Prossnitz ER 2005 A transmembrane intracellular estrogen receptor mediates rapid cell signaling. Science 307:1625–1630[Abstract/Free Full Text]
  50. Thomas P, Pang Y, Filardo EJ, Dong J 2005 Identity of an estrogen membrane receptor coupled to a G protein in human breast cancer cells. Endocrinology 146:624–632[Abstract/Free Full Text]
  51. Thomas P, Dressing G, Pang Y, Berg H, Tubbs C, Benninghoff A, Doughty K 2006 Progestin, estrogen and androgen G-protein coupled receptors in fish gonads. Steroids 71:310–316[CrossRef][Medline]
  52. Coppard NJ, Poulsen K, Madsen HO, Frydenberg J, Clark BF 1991 42Sp48 in previtellogenic Xenopus oocytes is structurally homologous to EF-1 {alpha} and may be a stage-specific elongation factor. J Cell Biol 112:237–243[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Ligands:   Progesterone



This article has been cited by other articles:


Home page
Hum Reprod UpdateHome page
B. Gellersen, M.S. Fernandes, and J.J. Brosens
Non-genomic progesterone actions in female reproduction
Hum. Reprod. Update, January 1, 2009; 15(1): 119 - 138.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Deng, S. Lang, C. Wylie, and S. R. Hammes
The Xenopus laevis Isoform of G Protein-Coupled Receptor 3 (GPR3) Is a Constitutively Active Cell Surface Receptor that Participates in Maintaining Meiotic Arrest in X. laevis Oocytes
Mol. Endocrinol., August 1, 2008; 22(8): 1853 - 1865.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Pang, J. Dong, and P. Thomas
Estrogen Signaling Characteristics of Atlantic Croaker G Protein-Coupled Receptor 30 (GPR30) and Evidence It Is Involved in Maintenance of Oocyte Meiotic Arrest
Endocrinology, July 1, 2008; 149(7): 3410 - 3426.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
F. Stormshak and C. V. Bishop
BOARD-INVITED REVIEW: Estrogen and progesterone signaling: Genomic and nongenomic actions in domestic ruminants
J Anim Sci, February 1, 2008; 86(2): 299 - 315.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
S. R. Hammes and E. R. Levin
Extranuclear Steroid Receptors: Nature and Actions
Endocr. Rev., December 1, 2007; 28(7): 726 - 741.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. Schumacher, R. Guennoun, A. Ghoumari, C. Massaad, F. Robert, M. El-Etr, Y. Akwa, K. Rajkowski, and E.-E. Baulieu
Novel Perspectives for Progesterone in Hormone Replacement Therapy, with Special Reference to the Nervous System
Endocr. Rev., June 1, 2007; 28(4): 387 - 439.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Josefsberg Ben-Yehoshua, L.
Right arrow Articles by Maller, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Josefsberg Ben-Yehoshua, L.
Right arrow Articles by Maller, J. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals