help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2006-0220
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
21/3/740    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, X.-B.
Right arrow Articles by Wieland, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, X.-B.
Right arrow Articles by Wieland, T.
Molecular Endocrinology 21 (3): 740-752
Copyright © 2007 by The Endocrine Society

Oxytocin Receptors Differentially Signal via Gq and Gi Proteins in Pregnant and Nonpregnant Rat Uterine Myocytes: Implications for Myometrial Contractility

Xiao-Bo Zhou, Susanne Lutz, Frank Steffens, Michael Korth and Thomas Wieland

Institut für Pharmakologie für Pharmazeuten (X.-B.Z., F.S., M.K.), Universitätsklinikum Hamburg-Eppendorf, D-20246 Hamburg, Germany; and Institut für Experimentelle und Klinische Pharmakologie und Toxikologie (S.L., T.W.), Medizinische Fakultät Mannheim, Universität Heidelberg, D-68169 Mannheim, Germany

Address all correspondence and requests for reprints to: Michael Korth, Institut für Pharmakologie für Pharmazeuten, Universitätsklinikum Hamburg-Eppendorf, Martinistrasse 52, D-20246 Hamburg, Germany. E-mail: korth{at}uke.uni-hamburg.de.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Oxytocin (OT) receptors are important regulators of myometrial contractility. By using the activity of large conductance Ca2+-activated K+ (BKCa) channels as readout, we analyzed OT signaling in cells from nonpregnant (NPM) and pregnant (PM) rat myometrium in detail. In nystatin-perforated whole-cell patches from NPM cells, which leave the intracellular integrity intact, OT transiently increased BKCa-mediated outward currents (Iout). This OT-evoked Iout was caused by the Ca2+ transients in response to the Gq/11-mediated activation of phospholipase C and was inhibited by activation of protein kinase A (PKA). In an open-access whole-cell patch (OAP), the OT-induced transient rise in Iout was disrupted whereas the regulation of BKCa by the cAMP/PKA cascade remained intact. OT counteracted the isoprenaline, i.e. the ß-adrenoceptor/Gs-mediated effect in NPM cells measured in OAP. In contrast, OT further enhanced the ß-adrenoceptor/Gs-mediated effect on BKCa activity in PM cells. All OT effects in the OAP were mediated by pertussis toxin-sensitive Gi proteins and PKA. By quantitative real-time PCR and overexpression of the recombinant protein, we demonstrate that an up-regulation of the Gß{gamma}-stimulated adenylyl cyclase II during pregnancy is most likely responsible for this switch. By studying the OT-evoked Iout in nystatin-perforated whole-cell patches of PM cells, we further detected that the OT receptor/Giß{gamma}-mediated coactivation of adenylyl cyclase II enhanced the ß-adrenoceptor/Gs-induced suppression of the OT-evoked Ca2+ transients and thus diminishes and self-limits OT-induced contractility. The differential regulation of the PKA-mediated suppression of OT-evoked Ca2+ transients and BKCa activity likely supports uterine quiescence during pregnancy.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
OXYTOCIN (OT) IS A nonapeptide hormone released from the posterior lobe of the pituitary gland that regulates social and sexual behavior, facilitates the milk-ejection reflex, and contracts the uterine smooth muscle. It is therapeutically used to treat women suffering from dysfunctional labor. OT induces its effects via OT receptors (OTRs), which are members of the heptahelical family of G protein-coupled receptors (1). It is now well established that OT binding to its myometrial receptors leads to an increase in intracellular free calcium (2, 3, 4) via the generation of inositol trisphosphate by activation of the G{alpha}q/11/phospholipase Cß (PLC) pathway (5).

A study that analyzed G protein {alpha}-subunits associated with the OTR showed that the receptor interacts not only with G{alpha}q/11 but also with G{alpha}i3 in myometrial membranes of the laboring rat (6). Nevertheless, whether Gi proteins are activated by OTR stimulation in myometrial smooth muscle cells, and thereby influence adenylyl cyclase (AC) activity, is still unclear. Studies investigating the direct influence of OT on the uterine cAMP accumulation show controversial results. OT was shown to decrease the ß-adrenoceptor (ß-AR)/Gs-induced accumulation of cAMP by isoprenaline (7) but not by epinephrine (8) in rat myometrium. Moreover, OT did not inhibit isoprenaline-stimulated AC activity in myometrial membranes (7). The pertussis toxin (PTX) sensitivity of agonist-induced signals is generally considered as proof of the coupling of that receptor to Gi. Indeed, PTX treatment inhibits OTR-induced PLC stimulation and the subsequent Ca2+ release in the myometrium (3, 9). It was therefore believed that Gi-derived ß{gamma}-dimers, as in other tissues, directly stimulate PLC. This interpretation, however, has been revoked because PTX treatment increases cellular cAMP levels in myometrial cells without requirement of any additional stimulus. The resulting activation of protein kinase A (PKA) inhibits PLC activity. In consequence, although largely inhibited by PTX treatment, the stimulation of PLC by OTRs in myometrial cells is today completely assigned to the activation of PTX-insensitive Gq/11 proteins (9).

Large-conductance Ca2+-activated K+ (BKCa) channels that generate strong hyperpolarizing outward currents are important negative feedback regulators of smooth muscle tone. In addition to the known up-regulation in the myometrium during pregnancy (10), the activity of BKCa channels is differentially regulated by PKA in smooth muscle cells obtained from pregnant (PM) and nonpregnant myometrium (NPM). Whereas activation of PKA inhibits channel activity in the NPM, phosphorylation by PKA largely increases BKCa currents during pregnancy (11). The underlying mechanism is presently unknown but may involve differential splicing of the PKA-sensitive BKCa channel {alpha}-subunit gene (10, 12, 13). We have recently shown that the activity of BKCa channels in myometrial smooth muscle cells can be used to monitor the status of the Gq/11/PLC/Ca2+ and AC/cAMP/PKA signaling pathways with a sensitivity superior to that of biochemical methods (14, 15). When patch clamp is performed in the cell-attached mode, BKCa channel activity reflects Ca2+-dependent regulation (15). In contrast, in the open-access whole-cell patch-clamp configuration, the regulation of BKCa channel activity by Ca2+ is disrupted (14, 15) but allows the exclusive determination of the AC/cAMP/PKA-dependent channel activity. Therefore, we employed these electrophysiological strategies to clarify whether OTRs functionally couple to Gi proteins in myometrial smooth cells and, even more important, to analyze differences in OTR signaling between NPM and PM.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The OT-Induced Outward Current Monitors the Gq/11/PLC-Evoked Ca2+ Transient in the Nystatin-Perforated Whole-Cell Patch
To study the effect of OT on the outward current (Iout) in myometrial smooth muscle cells, isolated cells from rat NPM were depolarized at a frequency of 1 Hz for 300 msec from –10 to +80 mV. Currents were recorded by the nystatin-perforated patch-clamp technique, which allows the recording of whole-cell currents through small channels formed by nystatin diffusing from the electrode solution into the cell membrane. This method prevents the loss or alteration of important cytoplasmic constituents during the measurement (16).

As shown in Fig. 1AGo, superfusion of myometrial smooth muscle cells with the calcium ionophore A23187 (1 µM) induced a strong, about 40-fold increase of Iout, which was completely abolished by the specific BKCa channel blocker iberiotoxin (IbTX, 300 nM) (17). This finding demonstrates that the current activated by OT is flowing exclusively through BKCa channels under our experimental conditions, and that activation of BKCa channels by Ca2+ is preserved in the nystatin-perforated whole-cell patch. Comparable to the calcium ionophore, superfusion of cells with 1 µM OT increased the current about 40-fold. (Fig. 1BGo). This effect was completely inhibited by IbTX (Fig. 1BGo) and by the competitive OTR antagonist atosiban (10 µM; data not shown). As illustrated in Fig. 1CGo, OT-induced Iout increased quickly and reached a peak within 8–10 sec. Thereafter, Iout declined and reached, within 25–30 sec, values comparable to the control current. Because this time course of Iout is similar to Ca2+ transients, which are typically induced by OT in myometrial smooth muscle cells via the Gq/11/PLC pathway, we tested whether Iout is sensitive to U-73122, an effective inhibitor of PLC in smooth muscle. In the presence of 2.5 µM U-73122, the OT-induced current was almost completely abolished (Fig. 1Go C), whereas U-73334, an inactive analog of U-73122, was without significant effect. When, with the open-access whole-cell patch-clamp technique, Iout was elicited by depolarizing NPM cells with 0.3 µM Ca2+ in the patch-pipette from –60 to +80 mV, U-73122 induced no direct inhibitory effect on the currents (data not shown). The data therefore indicate that BKCa channel activity in the nystatin-perforated patch monitors OTR/Gq/11/PLC-evoked Ca2+ transients in myometrial smooth muscle cells.


Figure 1
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 1. OT Transiently Increases Iout in NPM Cells

Currents were recorded with the nystatin-perforated whole-cell patch-clamp technique. Cells were depolarized for 300 msec (ms) at 1 Hz from a holding potential of –10 to +80 mV. Original current traces representing the time-dependent increase of Iout induced by A23187 and OT are shown in panels A and B, respectively. IbTX (300 nM) completely prevents the increase of Iout induced by 1 µM A23187(A) or 1 µM OT (B). C, inhibition of OT-induced increase of Iout in the presence of the PLC inhibitor U-73122. Time course of Iout induced by 1 µM OT in the absence (left panel; n = 12 from five rats) and in the presence of 2.5 µM U-73122 (middle panel; n = 8 from four rats) or its inactive analog U-73334 (right panel; n = 7 from four rats). Mean values ± SEM of current densities are shown.

 
Activation of PKA Inhibits the OT-Induced Outward Current in the Nystatin-Perforated Whole-Cell Patch
It has been shown previously that activation of PKA inhibits the OT-induced phosphatidylinositide turnover in a human myometrial cell line (9). We therefore studied the influence of the specific PKA activator Sp-8-CPT-cAMPS (cAMP; 30 µM) on the OT-evoked Iout in NPM and PM cells. As illustrated in Fig. 2Go, cAMP inhibited the OT-induced Iout by 78% in NPM cells and by 95% in PM cells. This inhibition was completely reversed by 300 µM Rp-8-CPT-cAMPS (PKA-I, 300 µM), a potent competitive inhibitor of PKA. Note that the OT-induced Iout was much smaller in PM cells (~40%) than in NPM cells. In accordance with the reported increase in cAMP levels by treatment of a myometrial cell line with PTX (18), PTX (500 ng ml–1 for 5 h) treatment inhibited the OT-induced Iout by 57% and 47% in NPM and PM cells, respectively. This inhibition was also reversed in the presence of PKA-I. The data therefore indicate that BKCa channel activity in the nystatin-perforated patch monitors PLC regulation by the cAMP/PKA cascade.


Figure 2
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 2. The PKA Inhibitor Rp-8-CPT-cAMPS (PKA-I) Reverses the Inhibitory Effects of the Stable cAMP Analog Sp-8-CPT-cAMPS (cAMP) and of PTX on OT-Induced Iout in NPM (A) and PM Cells (B)

Currents were recorded with the nystatin-perforated whole-cell patch as described in the legend of Fig. 1Go. Bars represent the maximal Iout induced by 1 µM OT alone (NPM: Ctr, same data as in Fig. 1CGo; PM: Ctr, n = 10 from four rats), cAMP (30 µM for 15 min, NPM: n = 8 from three rats; PM: n = 7 from four rats), cAMP plus PKA-I (30 plus 300 µM for 15 min; NPM and PM: n = 6 from three rats, respectively), PTX treatment (500 ng ml–1 for 5 h, NPM: n = 12 from five rats; PM: n = 8 from four rats), PTX plus PKA-I (NPM: n = 8 from four rats; PM: n = 6 from three rats). Mean values ± SEM of current densities are shown. ***, P < 0.001 vs. OT alone (Ctr). Ctr, Control.

 
OTR Stimulation Counteracts the ß-AR-Induced Activation of the cAMP/PKA Cascade in NPM Cells via Gi Proteins
An open access between the cell interior and the recording electrode abolishes the transient activation of Iout by Ca2+ mobilization via the Gq/11/PLC pathway (15). In accordance, the transient activation of Iout by OT was absent in the open-access whole-cell patch-clamp configuration in NPM cells. No significant change of Iout was observed when the cells were clamped every 5 sec from a holding potential of –10 mV to potentials ranging from –60 to +80 mV and superfused with 1 µM OT (data not shown).

As outlined before, in the open-access whole-cell patch-clamp configuration, the activity of Iout can be used to exclusively monitor alterations of the AC/cAMP/PKA cascade (14, 15), the activation of which inhibits BKCa channel activity in NPM cells. Thus, the superfusion of NPM cells with isoprenaline (10 µM) reduced Iout by about 50% (Fig. 3Go, A and B). In accordance with prior data (14, 15), no further increase of the isoprenaline-induced inhibition was observed in PTX-treated cells, indicating that PTX treatment itself did not alter PKA activation in the open-access whole-cell patch. The isoprenaline-induced decrease of Iout was absent, however, in the presence of PKA-I (Fig. 3BGo). When the effect of isoprenaline was stable after 4 min, cells were additionally superfused with 1 µM OT, which caused a partial (~90%) recovery of Iout. The effect of OT was completely abolished by the OTR antagonist atosiban (Fig. 3BGo), and a complete recovery of Iout was observed in the presence of PKA-I. Similar data were obtained when isoprenaline and PKA-I were replaced by the ß2-adrenoceptor-specific agonist salbutamol and the less selective PKA inhibitor H89, respectively (data not shown). To determine whether Gi proteins mediate the partial recovery of Iout by OT, identical measurements were performed in PTX-treated cells. Whereas the inhibitory effect of 10 µM isoprenaline was preserved, the OT-induced recovery of Iout was absent in PTX-treated NPM cells (Fig. 3BGo). Because the regulation of BKCa channels by Ca2+ mobilization is disrupted, these data provide evidence for the requirement of G{alpha}i activation and adenylyl cyclase inhibition by OTRs in NPM cells. Note that IbTX completely inhibited Iout in the presence of isoprenaline plus OT, indicating that currents were flowing exclusively through BKCa channels (inset of Fig. 3AGo).


Figure 3
View larger version (31K):
[in this window]
[in a new window]

 
Fig. 3. OT Reverses the Isoprenaline-Induced Decrease of Iout in NPM Cells

A, Current-voltage relationships from nine NPM rat uterine myocytes are shown. Cells were obtained from five animals. Mean current densities are plotted against the respective test potential. Currents were evoked by applying 300-msec depolarizing pulses every 5 sec in 10-mV increments from a holding potential of –10 to +80 mV. The open-access patch-clamp technique with 0.3 µM Ca2+ in the pipette solution was used. Cells were superfused with 10 µM isoprenaline (Iso) first and then additionally with 1 µM OT. The inset shows representative Iout recordings at +80 mV. Numbers in parentheses indicate the sequence of drug applications. Note that 300 nM IbTX completely blocked the current induced by Iso plus OT. B, Abolition of the OT effect in the presence of 10 µM isoprenaline after treatment of the cells with atosiban (10 µM for 5 min; n = 6 from three rats), PTX (n = 10 from five rats) and PKA-I (n = 8 from five rats). Treatment of cells with PTX and PKA-I was performed as described in the legend of Fig. 2Go. Mean values ± SEM of current densities elicited by 300-msec pulses from a holding potential of –10 to +80 mV are shown including control currents obtained from A. **, P < 0.01 vs. control (Ctr). ns, Not significant.

 
OTR Stimulation Enhances the ß-AR-Induced Activation of the cAMP/PKA Cascade at Midpregnancy via Gi Proteins
To study the effect of the OTR-dependent Gi activation on BKCa channel activity in the PM (d 12 of gestation), PM cells were clamped in the open-access whole-cell patch-clamp configuration as described above for NPM cells. As in NPM cells, no increase of Iout was evoked by superfusion of PM cells with OT alone (data not shown). In contrast to NPM cells, isoprenaline increased the IbTX-sensitive Iout in PM cells about 2-fold (Fig. 4Go), which is due to the PKA-dependent activation of BKCa channels during pregnancy (11). Additional application of OT did not counteract, but synergistically enhanced, the isoprenaline-dependent current in PM cells (Fig. 4AGo). All effects of OT were blocked by atosiban, PKA-I, and, most important, by PTX treatment (Fig. 4BGo). As in NPM cells, the isoprenaline effect was preserved after PTX treatment but was sensitive to PKA-I. Thus, the findings clearly show that both the ß-AR- and the OTR agonist produce their effects on BKCa channels in the open-access whole-cell patch-clamp configuration in PM cells exclusively via the cAMP/PKA cascade, and therefore the PTX sensitivity strongly argues for a Gi protein-mediated, costimulatory action of OT in PM cells.


Figure 4
View larger version (30K):
[in this window]
[in a new window]

 
Fig. 4. OT Potentiates the Isoprenaline-Induced Increase of Iout in PM Cells

A, Current-voltage relationships from eight PM cells are shown. Cells were obtained from four animals. Currents were evoked by applying a 300-msec (ms) depolarizing pulse every 5 sec in 10-mV increments from a holding potential of –10 to +80 mV. The open-access patch-clamp technique with 0.3 µM Ca2+ in the pipette solution was used. Cells were superfused with 10 µM isoprenaline (Iso) first and then additionally with 1 µM OT. The inset shows representative Iout recordings at +80 mV. Numbers in parentheses indicate the sequence of drug applications. Note that 300 nM IbTX almost completely blocked the current induced by Iso plus OT. B, Abolition of the OT effect in the presence of 10 µM isoprenaline after treatment of the cells with atosiban (n = 6 from three rats), PTX (n = 7 from four rats) and PKA-I (n = 6 from three rats). Treatment of cells with PTX and PKA-I was performed as described in the legend of Fig. 2Go. Mean values ± SEM of current densities elicited by 300-msec pulses from a holding potential of –10 to +80 mV are shown including control currents obtained from panel A. **, P < 0.01 vs. control (Ctr). ns, Not significant.

 
Influence of Transducin {alpha} (TD{alpha}) on the OT-Modulated Iout
It is well established that both G{alpha}-subunits and the Gß{gamma}-dimers regulate the activity of effectors. To differentiate between the two types of subunits, experiments with TD{alpha}, the G{alpha}-subunit of a heterotrimeric G protein that mediates signal transduction in vertebrate photoreceptor cells, were conducted on NPM and PM cells. TD{alpha} has been shown to act as a scavenger of Gß{gamma} dimers dissociated from heterotrimeric Gi/o proteins (19), and it was therefore reasoned that TD{alpha} should specifically antagonize {gamma}-mediated effects of OT, whereas effects dependent on G{alpha}-subunits should be preserved. By utilizing the open-access whole-cell patch-clamp configuration, 0.3 µM TD{alpha} was dialyzed via the patch pipette into the myocytes 20 min before Iout was elicited in the absence and presence of isoprenaline and isoprenaline plus OT. Figure 5Go, A and B, shows the results obtained from a NPM and a PM cell depolarized for 300 msec from –10 mV to +80 mV. There were no changes in the response of both cells to isoprenaline, but the effects of OT were markedly altered by TD{alpha} (compare Figs. 3Go and 4Go). In NPM cells OT completely antagonized the effect of isoprenaline (before 950 pA, after isoprenaline 631 pA, plus OT 940 pA), whereas in PM cells OT decreased, rather than further enhanced, Iout in the presence of isoprenaline (before 2.0 nA, after isoprenaline 3.3 pA, plus OT 3.0 pA). Note that the inhibitory effect of OT on Iout in nine PM cells was statistically significant (P < 0.05). Mean values obtained from six NPM and nine PM cells are summarized in Fig. 5Go, C and D. Taken together, the results presented in Fig. 5Go indicate that OT acts in NPM cells predominantly via G{alpha}i whereas Gß{gamma}-subunits of Gi proteins seem to be involved in the stimulatory effect in PM cells.


Figure 5
View larger version (28K):
[in this window]
[in a new window]

 
Fig. 5. TD{alpha} Reverses the Effect of OT on Iout in Pregnant Uterine Myocytes

Currents were elicited in NPM and PM rat uterine myocytes every 5 sec by 300 msec (ms) depolarizing pulses from –10 to +80 mV. Before drug application, cells were dialyzed via the patch pipette for 20 min with 300 nM TD{alpha}. Original current recordings showing that 1 µM OT completely reversed the effect of 10 µM isoprenaline (Iso) in the TD{alpha}-loaded NPM cell (A), whereas the enhancing effect of OT was switched by TD{alpha} to an antagonistic action in the PM cell (B). Numbers in parentheses indicate the sequence of drug applications. C and D, Average results from NPM (n = 6) and PM (n = 9) cells, obtained from four and five rats, respectively. Mean values ± SEM of current densities are shown. *, P < 0.05. Ctr, Control.

 
The OT-Induced Activation of Gi Proteins Differentially Contributes to the cAMP/PKA-Mediated Suppression of OT-Evoked Ca2+ Transients in NPM and PM Cells
As outlined above, in the nystatin-perforated patch, activation of BKCa channels closely follows the OT-evoked Ca2+ transient and its regulation by the cAMP/PKA cascade in NPM and PM cells. We therefore applied this patch-clamp configuration to follow the OT-induced Ca2+ transients and their regulation by the ß-AR agonist isoprenaline (Fig. 6Go). Isoprenaline (10 µM) was more effective in PM than in NPM cells: it inhibited the OT-induced Iout by 95% and 85%, respectively. Most interestingly, additional treatment of NPM and PM cells with PTX produced divergent results. In NPM cells PTX treatment further enhanced the suppression of the OTR-induced Iout by isoprenaline. In contrast, the almost completely suppressed OT-induced Iout in the presence of isoprenaline was partially restored by PTX treatment of PM cells. The data therefore show that the switch from a counteracting to a cooperative action of OTRs and ß-ARs on PKA activation is preserved in the nystatin-perforated patch and differentially contributes to the regulation of the OTR-evoked Ca2+ transient in NPM and PM cells.


Figure 6
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 6. Activation of Gi Proteins by OTRs Contribute to the Suppression of the OTR/Ca2+ -Evoked Iout by Isoprenaline during Pregnancy

Currents were recorded with the nystatin-perforated whole-cell patch-clamp technique in NPM and PM cells. Cells were depolarized for 300 msec at 1 Hz from a holding potential of –10 to +80 mV. Maximal increases of OT-induced Iout in the presence of 10 µM isoprenaline (Iso) either alone (NPM and PM: n = 6 from three rats, respectively) or after treatment of cells with 500 ng ml–1 PTX for 5 h (NPM: n = 8 from five rats; PM: n = 6 from four rats). Mean values ± SEM are given in percent of the maximum current densities evoked by 1 µM OT alone (NPM: 129.6 ± 13.1 pA pF–1, n = 12 from five rats; PM: 50.6 ± 5.2 pA pF–1, n = 7 from four rats). **, P < 0.01.

 
Influence of Gestation on AC mRNA and Gi Protein Content in the Myometrium
Depending on the cell type and the physiological situation, Gi-coupled receptors have been shown either to inhibit G{alpha}s-activated or to synergistically stimulate AC activity by regulating the prevailing isoforms of the AC. Among the nine membrane-bound ACs, isoforms II, IV, and probably VII are activated by Gi-derived {gamma}-dimers in the presence of G{alpha}s (20). In contrast, G{alpha}s-stimulated AC V and AC VI are directly inhibited by activated G{alpha}i (21). Therefore, two possibilities are feasible to explain the observed switch in effect of OT on the cAMP/PKA cascade. The first is an up-regulation of the Gß{gamma}-stimulated AC isoforms during pregnancy. Due to the lack of reliable antibodies directed against the different AC isoforms, we quantified the mRNA content of the different AC isoforms by real time RT-PCR. As shown in Fig. 7AGo, specific cDNA fragments representing AC types II, IV, V, and VI were amplified after reverse transcription, whereas specific fragments for AC III and AC VII were not obtained. To assess changes of AC transcription during the course of pregnancy, cDNAs obtained from myometria of d 12, d 15, d 17 and d 20 were analyzed (Fig. 7BGo). All data were normalized to the amount of cDNA encoding porphobilinogen deaminase (PBGD), a housekeeping enzyme with unchanged expression during gestation, in the same sample. At d 12 of pregnancy only the amount of the AC II transcript was significantly increased compared with NPM (Fig. 7BGo). The amount of AC II transcripts further increased up to maximally 8-fold at d 17–20. The amount of cDNA encoding the Gß{gamma}-sensitive AC IV was moderately increased only on d 17. Moderate increases were also observed for transcripts encoding AC V and VI on d 15–20.


Figure 7
View larger version (38K):
[in this window]
[in a new window]

 
Fig. 7. Relative Quantification of Adenylyl Cyclase Isoform mRNA Content during Pregnancy by Real-Time PCR

mRNAs obtained from NPM and from rats on d 12 (PM12), d 15 (PM15), d 17 (PM17), d 20 (PM20) of pregnancy were reverse transcribed and the AC isoforms II, IV, V, and VI were amplified by real-time PCR. A, The PCR products of an end-point PCR are shown (myometria from nonpregnant rats). NC, Negative control. Numbers below each lane indicate the theoretical size (bp) of the specific amplificate. B, Differences in PCR efficiencies were normalized by using the house keeping gene PBGD as reference and cDNA obtained from nonpregnant rats as calibrator. All values are given as means ± SEM of n = 5–10. *, P < 0.05; **, P < 0.01; ***, P < 0.001 vs. NPM.

 
An enhanced expression of Gi could increase the availability of Gß{gamma} upon OTR activation and thus could additionally enhance the costimulation of Gß{gamma}-activated AC isoforms. Therefore, we quantified the expression of the myometrial G{alpha}i isoforms, G{alpha}i2 and G{alpha}i3, as well as of Gß by immunoblots of rat myometrial membranes derived from nonpregnant (NPR) and pregnant rats (PM; d 12 of gestation) using specific antibodies. The expression of all three G protein subunits was unchanged on d 12 of gestation when compared with myometrial membranes of nonpregnant rats (data not shown).

The Overexpression of AC II Induces a Cooperative Stimulation of the AC/cAMP/PKA Cascade by OT and Isoprenaline in Cells from NPM
The results obtained by real-time PCR imply that an enhanced expression of AC II might be the mechanism responsible for the switch from inhibitory to stimulatory effect of OT in the presence of isoprenaline. To proof this concept, the most straightforward approach would be a RNA interference-induced depletion of AC II in isolated PM cells which, however, requires culture of these cells for at least 48–72 h. PM cells rapidly loose their pregnant phenotype in culture due to the lack of the specific hormonal environment, which might perturb the outcome of such experiments. On the other hand, myometrial cells isolated from nonpregnant rats can be stably cultured for several days. We therefore overexpressed AC II and (for control) AC V, in cultured myometrial cells from nonpregnant rats using eukaryotic expression vectors additionally encoding green fluorescent protein (GFP) derivatives. The ability of these constructs to express functionally active AC was first tested in transiently transfected human embryonic kidney (HEK)293 cells in which recombinant myc-tagged AC protein was detected by immunoblotting (data not shown). The basal cAMP production in sham (GFP)-transfected cells largely increased in cells cotransfected with a constitutively active mutant of G{alpha}s (G{alpha}s*) (Fig. 8Go). HEK cells overexpressing AC II exhibited a similar cAMP production as the sham-transfected cells and cotransfection of Gß1{gamma}2 alone did not induce a significant increase in the cAMP level. Cotransfection of cells with AC II and G{alpha}s* further increased cAMP production about 9-fold compared with cells transfected with G{alpha}s* alone. As known for the AC II isoform (20, 21), coexpression of Gß1{gamma}2 significantly augmented the G{alpha}s*-induced cAMP production (Fig. 8AGo). Similar to AC II, the activity of overexpressed AC V was largely increased by coexpression with G{alpha}s*. In accordance with the known regulation pathways of AC V (21) and, in contrast to AC II, AC V was not costimulated by Gß1{gamma}2 in the presence of G{alpha}s* (Fig. 8BGo). These data indicate that recombinant AC II and AC V are functionally active und exhibit the characteristics of a Gß{gamma}-costimulated and a non-Gß{gamma}-costimulated AC, respectively.


Figure 8
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 8. Expression of Functional Active Recombinant AC II and AC V in HEK293 Cells

HEK293 cells were transfected with eukaryotic expression vectors encoding GFP, G{alpha}sQL (G{alpha}s*), Gß1{gamma}2{gamma}), and AC II plus hrGFP (AC II, panel A) or AC V plus enhanced GFP (AC V, panel B) and their indicated combinations. Determination of the cellular cAMP content was performed 48 h after transfection as described in Materials and Methods. Means ± SEM of n = 4–8 are given.*, P < 0.05 vs. AC II + G{alpha}s*.

 
We therefore transfected cultured NPM cells with the AC expressing plasmid or the respective control vectors expressing the GFP variants alone. Transfected cells were identified 36 h later by fluorescence microscopy and were studied in the open-access whole-cell patch-clamp configuration. Although the macroscopic Iout was somewhat smaller in cultured NPM cells, the basic BKCa channel characteristics, such as single channel conductance, Ca2+ sensitivity, and voltage dependence, were not altered when compared with freshly isolated cells (data not shown). Note that in NPM cells the activation of the cAMP/PKA cascade inhibits Iout in the open-access whole-cell patch (see Fig. 3AGo). Thus, an approximately 50% suppression of Iout by isoprenaline and its partial restoration by the additional application of OT were also observed in the sham (GFP)-transfected cells (Fig. 9Go, A and C). In the AC II overexpressing NPM cells, however, a further significant suppression of Iout was induced by the coapplication of OT with isoprenaline (Fig. 9BGo), which indicates a further activation of the cAMP/PKA cascade. In contrast, overexpression of AC V in cultured NPM cells did not switch the restoration of Iout by OT coapplication. The inhibitory effect of isoprenaline was almost completely reversed in the presence of OT (Fig. 9DGo). Similar data as with OT coapplication with isoprenaline were obtained when endogenous Gi-coupled {alpha}2-adrenoceptors ({alpha}2-AR) in NPM cells were stimulated with clonidine in the presence of isoprenaline (data not shown). Taken together, these results show that the overexpression of AC II in myometrial smooth muscle cells is sufficient to switch the counteracting effect of the stimulation of Gi-coupled G protein-coupled receptors, like OTR and {alpha}2-AR, on the ß-AR-activated cAMP/PKA cascade into a cooperative enhancement.


Figure 9
View larger version (19K):
[in this window]
[in a new window]

 
Fig. 9. Overexpression of AC II Switches Inhibition of Isoprenaline-Modulated Iout by OT to a Costimulatory Effect in NPM Cells

Currents were evoked by applying 300-msec depolarizing pulses every 5 sec from a holding potential of –10 to +80 mV. Currents were obtained from cultured NPM cells, which were either sham [hrGFP, panel A; enhanced GFP (EGFP), panel C] transfected, transfected with hrGFP plus AC II (panel B), or EGFP plus AC V (panel D). Myocytes were superfused with 10 µM isoprenaline (Iso) first and then additionally with 1 µM OT. Bars represent mean current densities of seven cells, respectively. *, P < 0.05; **, P < 0.01. Ctr, Control.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In the present study, the coupling of OTRs to Gq/11- and Gi-dependent signal transduction pathways was studied in isolated smooth muscle cells from the rat myometrium by using the activity of the BKCa channel as sensitive readout. Due to its high sensitivity to Ca2+ (22, 23) and its distinct regulation by protein kinases (24), monitoring the activity of BKCa channels has been shown to be a reliable method to follow both Gq/11-dependent Ca2+ mobilization and the cAMP/PKA cascade modulated by Gs and Gi in myometrial smooth muscle cells (14, 15). In addition, the use of two different electrophysiological techniques, the open-access whole-cell and nystatin-perforated patch-clamp configuration, allowed the influence of the cAMP/PKA cascade and the Ca2+ transient on BKCa channels to be studied separately.

Regulation of Myometrial BKCa Channels by the OTR Evoked Ca2+ Transient
OTRs of the myometrium are functionally coupled to PLCß via Gq/11 proteins and thereby evoke inositol triphosphate (IP3)-induced Ca2+-transients in smooth muscle cells (2, 3, 4). We have shown before that the activity of BKCa channels measured in a cell-attached mode (15) can be used to monitor Gq/11-coupled receptor-induced Ca2+ transients in myometrial smooth muscle cells. The data reported herein now provide for the first time several lines of evidence that the nystatin-perforated patch clamp technique allows these Ca2+ transients to be monitored in a whole-cell recording, which produces much larger and more stable recordings than the cell-attached mode. We could show that 1) The IbTx-sensitive, thus BKCa-mediated, Iout can be activated by the extracellular Ca2+ after application of the calcium ionophore A23187. 2) The OT-induced rise in Iout follows the same transient time course as intracellular Ca2+ mobilized by OT in fura-2-loaded myometrial cells (2, 3, 25, 26). 3) Iout is inhibited by U-73122, a potent blocker of agonist-induced PLC activation in smooth muscle (27). 4) As reported for OT-induced PLC activity (9, 28), a rise in intracellular cAMP and activation of PKA inhibits the OT-induced Iout. Therefore, we conclude that the OT-induced rise in BKCa channel activity is very likely the result of the described IP3-dependent Ca2+ mobilization and its regulation by OTRs (see Fig. 10Go).


Figure 10
View larger version (59K):
[in this window]
[in a new window]

 
Fig. 10. Scheme Illustrating the Regulation of PLC and AC by OTRs, ß2-ARs, and G Proteins in the NPM and PM

In NPM and PM smooth muscle cells, stimulation of OTRs evoke Ca2+ transients via activation of the Gq/11-PLC pathway, which subsequently stimulate BKCa channels. In NPM cells (upper panel) the opposing regulation of AC by G{alpha}i and G{alpha}s prevails. Thus stimulation of ß2-ARs by isoprenaline (Iso) reduces Iout by PKA-mediated suppression of the OTR-evoked Ca2+ transient. By activation of G{alpha}i, OTR stimulation, however, counteracts the G{alpha}s-mediated AC stimulation and thus PTX treatment enhances the isoprenaline-induced suppression of the OT-evoked Ca2+ transient (see Fig. 5Go). In PM cells (lower panel) the Giß{gamma}-mediated AC II stimulation outweighs the G{alpha}i-induced inhibition and thus costimulation of the ß2-ARs and the OTRs cooperatively increases cAMP synthesis. Therefore, the OT-evoked Ca2+ transient is almost completely suppressed in the presence of isoprenaline, and PTX treatment now restores an OT-evoked Ca2+ transient (see Fig. 5Go). Note that the AC-dependent signaling pathway can be separately studied in the open-access (light area) whole-cell patch. In the nystatin-perforated patch-clamp technique (shaded area), both the PLC-evoked Ca2+ transient and AC signaling contribute to BKCa regulation. Note that BKCa channels are inhibited by PKA in NPM cells but are activated by PKA and up-regulated during pregnancy (BK*Ca). SR, Sarco- plasmic reticulum.

 
Myometrial OTRs Productively Couple to Gi Proteins and Thereby Differentially Regulate the cAMP/PKA Cascade in NPM and PM
As mentioned before, although a physical association of myometrial OTRs with G{alpha}i3 has been detected (6), functional coupling of OTRs to Gi proteins in the myometrium is still a matter of debate. This uncertainty is largely due to the rise in basal cAMP concentration by PTX treatment of myometrial smooth muscle cells (18), which by PKA activation not only inhibits PLC (see above) but also MAPK by blocking transmission of signals from Ras to Raf-1 (29, 30, 31). In accordance, all data reporting inhibition of OT effects by PTX in myometrial cells downstream of PLC and/or MAPK activation must be regarded with caution and do not necessarily constitute proof for coupling of activated OTRs to Gi proteins (18).

We have shown previously (14, 15) that BKCa channel activity measured in the open-access whole-cell patch-clamp technique can be used to monitor Gi activation in isoprenaline-stimulated myometrial cells with a sensitivity superior to biochemical methods (see Fig. 10Go). Note that OT application did not induce the rapid transient rise of Iout typically seen with the nystatin-perforated patch whereas the regulation by isoprenaline, i.e. via the Gs/cAMP-dependent PKA activation, can be reliably monitored. Like the activation of the prototypical Gi-coupled {alpha}2-AR (14) and melatonin receptors (15), coapplication of OT counteracted the effect of isoprenaline stimulation in NPM cells in a PKA-I and PTX-sensitive manner. Because the OT effect was blocked by atosiban, these data provide clear evidence for the productive coupling of myometrial OTRs to Gi proteins. In PM cells, OT did not counteract, but cooperatively augmented, the effect of isoprenaline on BKCa channel activity. Our finding that PTX prevented the OT effect and PKA-I abolished both the isoprenaline and OT effect in PM cells indicates that Gi proteins activated by OT are responsible for the augmentation of the Gs-mediated PKA activation. This switch from inhibition to stimulation of AC during pregnancy might be a general phenomenon of myometrial Gi-coupled receptors and has been detected before for the {alpha}2-AR (14, 32) and melatonin receptors (15). Loading of PM cells with TD{alpha}, which acts as a scavenger of Gi-derived {gamma}-dimers (19), resulted in a significant inhibition rather than an augmentation of the isoprenaline-stimulated Iout (Fig. 5Go). Consequently, Giß{gamma} must have been responsible for the synergistic effect of OT and isoprenaline on Iout (Fig. 4Go). The OTR-mediated decrease of Iout reflects very likely the unopposed inhibitory effect of free G{alpha}i-subunits in the presence of TD{alpha}. The complete reversal of Iout by OT in isoprenaline-treated NPM cells loaded with TD{alpha} might also be explained by the unopposed G{alpha}i because the pool of free Gß{gamma}-dimers available for reassembling with G{alpha}i proteins was strongly reduced by TD{alpha}.

The Up-Regulation of the Gß{gamma}-Regulated AC II during Pregnancy Is Responsible for the Cooperative Activation of PKA by Gs- and Gi-Coupled Receptors
Several AC isoforms might be up-regulated in the rat PM (33). In our hands the increase in mRNA encoding AC II was the most prominent alteration in AC isoform mRNA content during the course of pregnancy (see Fig. 7Go). Because AC II is directly stimulated by Gß{gamma} in the presence of activated G{alpha}s (20), the up-regulation of AC II protein expression in the PM and activation by Giß{gamma} is therefore a plausible explanation for the augmentation of ß-AR stimulation by agonists of Gi-coupled receptors such as {alpha}2-ARs (14, 32), melatonin receptors (15), and OTRs. This conclusion is strongly supported by the finding that the switch from a counteracting to a cooperative effect of OT in the presence of isoprenaline could be induced in NPM cells by AC II but not by AC V overexpression (see Fig. 9Go). Whereas OT typically opposed the inhibitory effect of isoprenaline on Iout in the control NPM cells and also in NPM cells overexpressing the non-Gß{gamma}-costimulated AC V, there was a further significant decrease of Iout in AC II overexpressing cells. Because BKCa channel activity is inhibited by PKA in NPM cells, the additional inhibition of Iout by OT in the presence of isoprenaline reflects the costimulation of G{alpha}s-stimulated AC II by Gi-derived {gamma}-dimers (20, 21), which are released upon OTR stimulation. In accordance with this interpretation, both the negative and the positive inputs of OT to Iout were completely abolished in cells treated with PTX under conditions in which interferences with downstream signals, e.g. PLC activity, were excluded. Moreover, a similar switch as with OT coapplication was obtained by coapplication of clonidine, a specific agonist at the prototypical Gi-coupled {alpha}2-AR, with isoprenaline (32, 34).

The Coupling of Myometrial OTRs to Gq/11- and Gi-Proteins Differentially Modulates the Contraction Inducing, OT-Evoked Ca2+ Transients in NPM and PM Cells
The data presented in this study provide evidence that the functional coupling of OTRs to both Gq and Gi might have profound consequences on the contractile responses to OT stimulation in the myometrium. In the NPM and most likely in the laboring myometrium, inhibition of AC via Gi reduces cAMP production and PKA activity (see Fig. 10Go, upper panel). Because PKA activation inhibits PLC, this mechanism reinforces the Gq-mediated intracellular Ca2+ mobilization by OTR and hence contractile activity during labor. At midpregnancy, however, G{alpha}q (35) and PLCß isoforms (36) are down-regulated and, in accordance with these data, we found that Iout evoked by OT-induced Ca2+ transients is largely diminished. In the presence of isoprenaline, OT-induced Ca2+ transients seem to be almost completely suppressed (see Fig. 6Go). Because PTX treatment was able to partially restore the OT-induced Iout, the costimulation of the AC II/cAMP/PKA signaling pathway via Gß{gamma} subunits derived from OTR-activated Gi contributes to the almost complete suppression of the Ca2+ transient in PM cells. Our data indicate, therefore, that AC II costimulation by OTR-released Giß{gamma}-dimers during pregnancy counterbalances the Gq-dependent effect and thus apparently self-limits the contractile response to OT.

OT can also bind to vasopressin receptors, and it has been shown that the rat myometrium expresses the vasopressin V1a receptor subtype (37). Both OTR and V1a receptor couple to the Gq/PLC/IP3 signaling pathway, but it is unknown whether V1a receptors couple also to Gi proteins as we have shown for OTRs in the present study. To date, we cannot exclude that the OT effects may be mediated, in part, by vasopressin receptors. Nevertheless, it has been shown that a selective vasopressin V1a antagonist was ineffective in blocking the uterotonic action of OT or arginine vasopressin in isolated rat uteri (38). This finding indicates that in rat the OTR is the dominant receptor for the uterotonic action of both hormones.

In addition, BKCa channels are useful not only to monitor the OTR signaling pathways in single cells. Because they generate strong hyperpolarizing outward currents, they are important negative feedback regulators of smooth muscle tone. It is known that the up-regulation (10) and activation of BKCa channels by the AC/cAMP/PKA pathway via Gs- and Gi-coupled receptors during pregnancy are important alterations by which uterine quiescence is maintained. Therefore not only the observed alterations in OTR-induced signaling during pregnancy reported herein but also its consequences on BKCa channel activity are likely of physiological relevance.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
OT was obtained from Tocris (Köln, Germany); atosiban was a generous gift from Ferring Pharmaceuticals (Copenhagen, Denmark). U-73122, and U-73343 were purchased from Biomol (Hamburg, Germany); IbTX was from Alomone Laboratories (Jerusalem, Israel); PTX was from List Biological Laboratories (Campbell, CA); and (±)-isoprenaline and nystatin were obtained from Sigma (Taufkirchen, Germany). Rp-8-CPT-cAMPS (PKA-I) and Sp-8-CPT-cAMPS (cAMP) were obtained from Biolog (Bremen, Germany). U-73122 and U-73343 were dissolved in dimethyl sulfoxide. The maximum 0.1% final concentration of dimethyl sulfoxide in the bath solution did not affect Iout. All other drugs were dissolved in physiological saline solution (PSS) (see below); solutions with IbTX contained 0.1% bovine albumin fraction V (Sigma). Collagenase type H (lot 014K8605), hyaluronidase type I-S, papain and 1,4-dithio-D,L-threitol) was purchased from Sigma.

Purification of TD{alpha}
Bleached bovine rod outer segment membranes were prepared from bovine retinas as described previously (39). The bovine retinas were obtained from a local abattoir. TD was eluted from the membranes by hypotonic elution in the presence of 100 µM GTP, and the subunits were separated by affinity chromatography on Blue Sepharose (Bio-Rad Laboratories, Hercules, CA). The buffers in which the proteins were eluted from the columns were changed to the intracellular pipette solution (see below) by repeated extensive dialysis, and proteins were stored in aliquots at –80 C. The protein concentration was determined according to Bradford with IgG as standard.

Animals
All experimental procedures were carried out according to the animal welfare guidelines of the University Hospital Hamburg-Eppendorf. Female Wistar rats were obtained from a colony bred and maintained at the animal house of the University Hospital Hamburg-Eppendorf. To obtain myometria from pregnant animals, females were caged with males overnight, and successful mating was determined by the presence of spermatozoa in the vaginal smear (d 1 of pregnancy). Animals were killed on d 12 of gestation, which corresponds to midpregnancy. Myometria were dissected from rats killed by CO2. Usually animals were killed between 1000 and 1100 h.

Cell Preparation
After the connective tissue was removed and the endometrium was cut away, the uterine smooth muscle was cut with a sharp blade into pieces of 1–2 mm side length and incubated under gentle agitation at 37 C in Ca2+-free PSS including 0.7 mg ml–1 papain, 1 mg ml–1 1,4-dithio-D,L-threitol, and 1 mg ml–1 fat-free BSA. The tissue pieces were transferred 30 min later into PSS solution containing 50 µM Ca2+, 1 mg ml–1 collagenase, 1 mg ml–1 hyaluronidase, and 1 mg ml–1 albumin, and digested for another 10 to 15 min at 37 C. Single cells were released by gentle trituration of the digested tissue using a narrow-bore, fire-polished Pasteur pipette and stored in PSS at room temperature. After isolation, 50–60% of the cells were relaxed, and only these cells were used for the electrophysiological studies. Experiments were conducted within 6 h of cell isolation.

A small aliquot of the solution containing the isolated cells was placed in an open perfusion chamber (1 ml) mounted on the stage of an inverted microscope (Zeiss Axiovert 200). Myocytes were allowed to adhere to the bottom of the chamber for 5–10 min and were then superfused at 2–3 ml min–1 with PSS at room temperature.

Recording Techniques and Data Acquisition
Standard whole-cell patch-clamp recordings (40) or recordings with the nystatin-perforated whole-cell patch clamp configuration (16) were used to measure outward currents from isolated myocytes. Patch electrodes were fabricated from borosilicate glass capillaries (MTW 150F; World Precision Instruments, Inc., Sarasota, FL) and filled with prefiltered solutions of different composition (see below). Currents were recorded at room temperature with an EPC-7 amplifier (HEKA Elektronik, Lambrecht, Germany), connected via a 16 bit A/D interface to a pentium IBM clone computer. The signals were low-pass filtered (2 kHz) before 5 kHz digitization. Data acquisition and analysis were performed with an ISO-3 multitasking patch-clamp program (MFK M. Friedrich, Niedernhausen, Germany). Pipette resistance was 2–3 M{Omega}, and gigaseals were more than 10 G{Omega}. Series resistance was compensated after membrane rupture.

Cell Culture and Transfection of Myometrial Smooth Muscle Cells
Isolated myocytes (~400.000 cells per well) were plated on six-well plates in Waymouth’s MB 7524/1 medium (Life Technologies, Karlsruhe, Germany) containing 10% fetal calf serum, 1% (by mass) penicillin/streptomycin and 100 µM 5'-bromo-deoxy-uridine. Myocytes were cultured under standard conditions (37 C, 6% CO2) for at least 36 h. Thereafter, cells were transiently transfected with the use of Effectene transfection reagent (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. The cells were then maintained in the medium for another 24–48 h before electrophysiological analysis.

Construction of Eukaryotic Expression Vectors Encoding GFP plus AC II or AC V
The N-terminal c-myc-tagged AC II cDNA in pBluescript II SK(+) and the AC V cDNA in pcDNA3 were a kind gift from Dr. Christiane Kleuss, Berlin, Germany. To generate an eukaryotic AC II expression vector that coexpresses GFP, the AC II cDNA was first isolated from pBluescript by SpeI/XhoI double digest and ligated in SpeI/XhoI linearized pShuttle-IRES-hrGFP-1 (Stratagene, Amsterdam, The Netherlands). Then, the expression cassette containing the c-myc tagged AC II, the internal ribosome entry site sequence, and the human recombinant GFP (hrGFP) cDNA was isolated by SpeI/HpaI double digest, blunted by Klenow large fragment of DNA polymerase I, and ligated in the EcoRV-linearized, dephosphorylated vector pCMV-Script (Stratagene). The orientation of the subcloned expression cassette was verified. To obtain an eukaryotic expression vector for AC V that also coexpresses GFP, the AC V cDNA was isolated from pcDNA3 by KpnI/XbaI double digest and ligated into the KpnI/XbaI-linearized pAdTrack-CMV vector (kind gift of Dr. Bert Vogelstein, Baltimore, MD).

mRNA Isolation and Reverse Transcription
The rat myometria were homogenized in 1 ml Trizol (Invitrogen, Karlsruhe Germany) per 100 mg tissue for 30 sec with an Ultra-turrax at 20,000 rpm. Total RNA was isolated according to manufacturer’s protocol. Traces of genomic DNA were digested with RNase-free DNaseI for 30 min. For preparation of mRNA from total RNA, the Oligotex mRNA Mini kit (QIAGEN) was used. cDNA synthesis was carried out with 1 µg mRNA from each sample, random hexamer oligonucleotides, and the First strand cDNA synthesis kit for RT-PCR (Roche, Mannheim, Germany).

Real-Time Quantitative PCR
The relative quantification of AC transcripts was performed with the Light Cycler Fast Start DNA Master SYBR Green I Kit (Roche). PCR standard curves (cDNA dilutions from 1:2 to 1:1000) were generated for each AC isoform (specific oligonucleotides in 5'-3' orientation: AC II forward, AACACCATTCTACTCCACACCC; AC II reverse, CTCCTCCCGCTC-TTTTTTGAAC; AC IV forward, TCTCATCAGCATCCCATA-CTCC; AC IV reverse, GTAATACTCATTCTGCCGAGCC; AC V forward, CATTGGACACAATCCGCCTC; AC V reverse, CAAATCGGTCATCCACCTGC; AC VI forward, GCTTATGGAGCAAATGAAACAC; AC VI reverse, ATCTCCCCCTTTCCCTTCAC) and the housekeeping gene phorphobilinogen desaminase (PBGD forward, CCTGAAACTCTGTCCCGCTG; PBGD reverse, CTGGACCATCTTCTTGCTGAAC) by using cDNA from rat NPM as calibrator. To quantify the amount of AC and PBGD transcripts, 1:10 dilutions of the different cDNA samples were subjected to PCR with the following conditions: 10 min initial denaturation at 95 C and 40 cycles of PCR (denaturation: 5 sec at 95 C, annealing: 0 sec at 56 C, elongation: 15 sec at 72 C). Data analysis was performed with the Realquant software (Roche).

cAMP-Enzyme Immunoassay
HEK293 cells were cultured in DMEM containing 10% fetal calf serum, 2 mM L-glutamine, 100 units/ml penicillin, and 100 µg ml–1 streptomycin on collagen I-coated culture dishes. At the day of transfection the cells were seeded on 24-well plates and transfected 6 h later with a total of 500 ng vector DNA and Polyfect (QIAGEN) according to the manufacturer’s protocol. cDNAs encoding constitutive, active G{alpha}s* (G{alpha}sQ227L), 1, and G{gamma}2 were obtained from UMR cDNA Resource Center (Rolla, MO). 3-Isobutyl-1-methylxanthine (final concentration of 1 mM) was added 48 h after transfection for 30 min, and subsequent lysis was carried out with 250 µl ice-cold 0.1 M HCl. The competitive cAMP enzyme immunoassay (R&D Systems, Wiesbaden, Germany) was performed with 100 µl of the acetylated lysates strictly following the manufacturer’s instructions.

Membrane Preparation
Frozen myometria were ground in liquid nitrogen and collected in 2 ml of 0.6 M sucrose, pH 6. Using a Polytron homogenizer, samples were homogenized twice for 30 sec at 25,000 rpm with 30-sec intermittent cooling phase. Membranes were pelleted by centrifugation at 100,000 x g for 80 min and resuspended in 300 µl Murakami-buffer (50 mM Tris-HCl, pH 7.4; 5 mM MgCl2; 5 mM EDTA; 1 mM EGTA; 25 µg ml–1 aprotinine).

Immunoblot Analysis
Myometrial membrane protein (30–50 µg) from nonpregnant and pregnant rats was subjected to 12% SDS-PAGE, and subsequent electrotransfer onto a nitrocellulose membrane was carried out with a semidry blotting system. Thereafter the membrane was blocked overnight in 5% (wt/vol) skim milk powder in Tris-buffered saline-Tween 20 at 4 C. To detect G{alpha}i2, G{alpha}i3, Gß, and ß-tubulin the membrane was incubated with a 1:2000 (3A/140, Gramsch Laboratories Schwabhausen, Germany), 1:500 (C-10; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), 1:2000 (T-20, Santa Cruz), or 1:500 (anti-ß-tubulin, Sigma Aldrich) dilution of the primary antibody for 1 h in Tris-buffered saline-Tween 20, respectively. After three washing steps the secondary horseradish peroxidase-coupled antibody (goat antirabbit-horseradish peroxidase, Sigma Aldrich) was used according to manufacturer’s recommendations. After three final washing steps, immunoreactivity was visualized with an enhanced chemiluminescence system (ECL; Amersham Bioscience, Freiburg, Germany). For detection of overexpressed c-myc-tagged AC, 20 µg of transfected HEK293 homogenates was subjected to 8% SDS-PAGE, and the subsequent detection of AC was carried out by using a specific, monoclonal anti-c-myc antibody (clone 9E10; Roche).

Solutions
For whole-cell experiments, the intracellular (pipette) solution contained (in mM concentration): 134 KCl; 6 NaCl; 1.2 MgCl2; 5 EGTA; 11 glucose; 3 dipotassium ATP; 0.1 Na3GTP; and 10 HEPES, pH 7.4 (KOH). The free Ca2+ concentration was adjusted to 0.3 µM by adding the appropriate amount of CaCl2 as described earlier (14). Free Ca2+ was checked by fura 2 fluorescence. For nystatin perforated patch-clamp experiments, the pipette solution contained (in mM concentration): 110 potassium aspartate; 30 KCl; 10 NaCl; 1 MgCl2; 0.05 EGTA; 10 HEPES; and 250 µg ml–1 nystatin, pH 7.2 (KOH). The bath was superfused with PSS containing (in mM concentration): 127 NaCl, 5.9 KCl, 2.4 CaCl2, 1.2 MgCl2, 11 glucose, and 10 HEPES adjusted to pH 7.4 with NaOH.

Statistical Analyses
SigmaPlot for Windows (Jandel Scientific, version 8) was used for statistical analyses. Significance was determined by paired or unpaired t test or by one-way ANOVA. When a significant effect was detected with ANOVA, Student’s t test was used for pairwise comparisons. The effects were deemed significant when a P < 0.05 was obtained. Results are expressed as means ± SE where applicable.


    FOOTNOTES
 
This work was supported by Grants Ko 659/7-1 and Ko 659/7-2 (to M.K. and T.W.) from the Deutsche Forschungsgemeinschaft.

The authors listed in the manuscript (X.-B.Z., S.L., F.S., M.K., and T.W.) have nothing to declare.

First Published Online December 14, 2006

Abbreviations: AC, Adenylyl cyclase; ß-AR, ß-adrenoceptor; BKca, Ca2+-activated K+; GFP, green fluorescent protein; HEK, human embryonic kidney; hrGFP, human recombinant GFP; IbTX, iberiotoxin; Iout, outward current; IP3, inositol triphosphate; NPM, nonpregnant myometrium; OT, oxytocin; OTR, oxytocin receptor; PBGD, phorphobilinogen desaminase; PKA, protein kinase C; PLC, phospholipase C; PM, pregnant myometrium; PSS, physiological saline solution; PTX, pertussis toxin; TD{alpha}, transducin {alpha}.

Received for publication May 24, 2006. Accepted for publication December 4, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Kimura T, Tanizawa O, Mori K, Brownstein MJ, Okayama H 1992 Structure and expression of a human oxytocin receptor. Nature 356:526–529[CrossRef][Medline]
  2. Anwer K, Sanborn BM 1989 Changes in intracellular free calcium in isolated myometrial cells: role of extracellular and intracellular calcium and possible involvement of guanine nucleotide-sensitive proteins. Endocrinology 124:17–23[Abstract]
  3. Molnár M, Hertelendy F 1990 Regulation of intracellular free calcium in human myometrial cells by prostaglandin F2{alpha}: comparison with oxytocin. J Clin Endocrinol Metab 71:1243–1250[Abstract]
  4. Tasaka K, Masumoto N, Miyake A, Tanizawa O 1991 Direct measurement of intracellular free calcium in cultured human puerperal myometrial cells stimulated by oxytocin: effects of extracellular calcium and calcium channel blockers. Obstet Gynecol 77:101–106[Abstract/Free Full Text]
  5. Ku C-Y, Qian A, Wen Y, Anwer K, Sanborn BM 1995 Oxytocin stimulates myometrial guanosine triphosphatase and phospholipase-C activities via coupling to G{alpha}q/11. Endocrinology 136:1509–1515[Abstract]
  6. Strakova Z, Soloff MS 1997 Coupling of oxytocin receptor to G proteins in rat myometrium during labor: Gi receptor interaction. Am J Physiol 272:E870–E876
  7. Bhalla RC, Sanborn BM, Korenman SG 1972 Hormonal interactions in the uterus: inhibition of isoproterenol-induced accumulation of adenosine 3':5'-cyclic monophosphate by oxytocin and prostaglandins. Proc Natl Acad Sci USA 69:3761–3764[Abstract/Free Full Text]
  8. Harbon S, Clauser H 1971 Cyclic adenosine 3',5' monophosphate levels in rat myometrium under the influence of epinephrine, prostaglandins and oxytocin. Correlations with uterus motility. Biochem Biophys Res Commun 44:1496–1503[CrossRef][Medline]
  9. Dodge KL, Sanborn BM 1998 Evidence for inhibition by protein kinase A of receptor/G{alpha}q/phospholipase C (PLC) coupling by a mechanism not involving PLCß2. Endocrinology 139:2265–2271[Abstract/Free Full Text]
  10. Benkusky NA, Fergus DJ, Zucchero TM, England SK 2000 Regulation of the Ca2+-sensitive domains of the maxi-K channel in the mouse myometrium during gestation. J Biol Chem 275:27712–27719[Abstract/Free Full Text]
  11. Pérez G, Toro L 1994 Differential modulation of large-conductance KCa channels by PKA in pregnant and nonpregnant myometrium. Am J Physiol 266:C1459–C1463
  12. Tian L, Coghill LS, McClafferty H, MacDonald SH-F, Antoni FA, Ruth P, Knaus H-G, Shipston MJ 2004 Distinct stoichiometry of BKCa channel tetramer phosphorylation specifies channel activation and inhibition by cAMP-dependent protein kinase. Proc Natl Acad Sci USA 101:11897–11902[Abstract/Free Full Text]
  13. Chen L, Tian L, MacDonald SH-F, McClafferty H, Hammond MSL, Huibant J-M, Ruth P, Knaus H-G, Shipston MJ 2005 Functionally diverse complement of large conductance calcium- and voltage-activated potassium channel (BK) {alpha}-subunits generated from a single site of splicing. J Biol Chem 280:33599–33609[Abstract/Free Full Text]
  14. Zhou X-B, Wang G-X, Hüneke B, Wieland T, Korth M 2000 Pregnancy switches adrenergic signal transduction in rat and human uterine myocytes as probed by BKCa channel activity. J Physiol 524:339–352[Abstract/Free Full Text]
  15. Steffens F, Zhou X-B, Sausbier U, Sailer C, Motejlek K, Ruth P, Olcese J, Korth M, Wieland T 2003 Melatonin receptor signaling in pregnant and nonpregnant rat uterine myocytes as probed by large conductance Ca2+-activated K+ channel activity. Mol Endocrinol 17:2103–2115[Abstract/Free Full Text]
  16. Horn R, Marty A 1988 Muscarinic activation of ionic currents measured by a new whole-cell recording method. J Gen Physiol 92:145–159[Abstract/Free Full Text]
  17. Galvez A, Gimenez-Gallego G, Reuben JP, Roy-Contancin L, Feigenbaum P, Kaczorowski GJ, Garcia ML 1990 Purification and characterization of a unique, potent, peptidyl probe for the high conductance calcium-activated potassium channel from venom of the scorpion Buthus tamulus. J Biol Chem 265:11083–11090[Abstract/Free Full Text]
  18. Zhong M, Yang M, Sanborn BM 2003 Extracellular signal-regulated kinase 1/2 activation by myometrial oxytocin receptor involves G{alpha}q{gamma} and epidermal growth factor receptor tyrosine kinase activation. Endocrinology 144:2947–2956[Abstract/Free Full Text]
  19. Federmann AD, Conklin BR, Schrader KA, Reed RR, Bourne HR 1992 Hormonal stimulation of adenylyl cyclase through Gi-protein ß{gamma} subunits. Nature 356:159–161[CrossRef][Medline]
  20. Tang W-J, Gilman AG 1991 Type-specific regulation of adenylyl cyclase by G protein ß{gamma} subunits. Science 254:1500–1503[Abstract/Free Full Text]
  21. Sunahara RK, Taussig R 2002 Isoforms of mammalian adenylyl cyclase: multiplicities of signaling. Mol Interv 2:168–184[Abstract/Free Full Text]
  22. Marty A 1981 Ca2+-dependent K+ channels with large unitary conductance in chromaffin cell membranes. Nature 291:497–500[CrossRef][Medline]
  23. Palotta BS, Magleby KL, Barrett JN 1981 Single channel recordings of Ca2+-activated K+ currents in rat muscle cell culture. Nature 293:471–474[CrossRef][Medline]
  24. Schubert R, Nelson MT 2001 Protein kinases: tuners of the BKCa channel in smooth muscle. Trends Pharmacol Sci 22:505–512[CrossRef][Medline]
  25. Khac LD, Arnaudeau S, Leprêtre N, Mironneau J, Harbon S 1996 Beta adrenergic receptor activation attenuates the generation of inositol phosphates in the pregnant rat myometrium. Correlation with inhibition of Ca++ influx, a cAMP-independent mechanism. J Pharmacol Exp Ther 276:130–136[Abstract/Free Full Text]
  26. Arnaudeau S, Leprêtre N,