help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2006-0446
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kwintkiewicz, J.
Right arrow Articles by Stocco, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kwintkiewicz, J.
Right arrow Articles by Stocco, C.
Molecular Endocrinology 21 (4): 933-947
Copyright © 2007 by The Endocrine Society

Follicle-Stimulating Hormone-Induced Activation of Gata4 Contributes in the Up-Regulation of Cyp19 Expression in Rat Granulosa Cells

Jakub Kwintkiewicz, Zailong Cai and Carlos Stocco

Department of Obstetrics, Gynecology and Reproductive Science, Yale School of Medicine, New Haven, Connecticut 06520

Address all correspondence and reprint requests to: Carlos Stocco, Department of Obstetrics, Gynecology & Reproductive Science, Yale University School of Medicine, 333 Cedar Street, P.O. Box 208063, New Haven, Connecticut 06520. E-mail: carlos.stocco{at}yale.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Several studies have suggested that the transcription factor GATA4 plays an important role in ovarian function. This study evaluated the effects of GATA4 on the regulation of the Cyp19 gene in primary rat granulosa cells under basal conditions and in response to stimulation by FSH. A significant increase in GATA4 mRNA, protein, and DNA binding activity was observed in rats treated with pregnant mare serum gonadotropin, a hormone that binds to the FSH receptors, and in granulosa cells incubated with FSH. Enrichment of the Cyp19 promoter was observed in granulosa cells treated with FSH after chromatin precipitation with an anti-GATA4 antibody. Mutation of the GATA binding site on the Cyp19 promoter and inhibition of GATA4 expression with specific small interfering RNA significantly reduced FSH-enhanced Cyp19 expression, whereas overexpression of GATA4 increased Cyp19 promoter activity. A synergistic effect observed between GATA4 overexpression and FSH treatment in Cyp19 expression was abolished by mutating Ser105 in the GATA4 protein or by pretreating granulosa cells with a protein kinase A inhibitor. Inhibition of phosphatidylinositol-dependent kinase (PI3-K)/casein kinase 2 or ERK1/2 attenuated GATA4/FSH synergism, whereas the simultaneous blockade of PI3-K/casein kinase 2 and ERK1/2 activity eliminated Cyp19 stimulation. Finally, we demonstrated that FSH increases GATA4 phosphorylation and that GATA4 activation requires the activation of multiple kinases, including ERK1/2, PI3-K, and protein kinase A. These findings demonstrate that GATA4 contributes in the regulation of Cyp19 expression in the rat ovary and provide the first evidence that FSH regulates GATA4 activity.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
AROMATASE, WHICH CATALYZES the irreversible conversion of androgens to estrogens, is highly expressed in the granulosa cells of preovulatory follicles. FSH is the main stimulus for the expression of the aromatase encoding gene Cyp19. The expression of the Cyp19 gene and the consequent increase in estradiol production by granulosa cells are essential for follicular growth and coordination of the ovulatory process. Transgenic experiments revealed that approximately 300 bp of the human aromatase proximal promoter are sufficient for proper spatiotemporal and hormonal regulation in the ovary (1). Within this region, a cAMP-responsive element-like sequence (CLS) (2) and two binding sites for members of the nuclear receptors 5A (NR5A) family of transcription factors, steroidogenic factor-1 (NR5A1/SF-1/Ad4BP) (3, 4, 5) and liver receptor homolog-1 (NR5A2/LRH-1/FTF), have been found (6, 7, 8). This last region is also known as the nuclear receptor element (NRE). Transcription factors that bind to the CLS and NRE interact in an additive manner to increase Cyp19 expression in rat granulosa cells (6, 9). The proximal aromatase PII promoter contains, in addition to CLS and the NRE, two species-conserved binding elements for members of the zinc finger family of transcription factors known as GATA (10, 11). These elements are located at positions –113/–118 (GATA A) and –123/–128 (GATA B) on the rat Cyp19 promoter, where +1 is the transcription initiation site (3). Although these GATA elements are involved in regulation of Cyp19 promoter activity (12), whether they participate in regulating Cyp19 expression in granulosa cells is still unknown.

The GATA family of transcription factors is composed of six members (GATA-1, -2, -3, -4, -5, and -6). Of these factors, GATA4 and GATA6 are found in the gonads of adult mammals (13, 14). GATA4 has been localized in undifferentiated gonads in mice (15, 16) and rats (17). In adult animals, GATA4 and GATA6 messengers mRNA and/or proteins have been detected in granulosa cells of healthy follicles in mice (15, 18), pigs (19), humans (20, 21, 22), and rats (17). The steroidogenic acute regulator (StAR) was the first gene identified as a target of GATA4 in the ovary (23). The authors demonstrated that GATA4 is expressed in rat granulosa cells in culture and that site-directed mutation of a GATA binding site ablated both basal and FSH-driven StAR promoter activity. Subsequently, it was shown that GATA4 binds to the StAR promoter in living cells (mouse primary granulosa cells and MA-10 cells) (24, 25). Moreover, GATA4 binding to the StAR promoter is stimulated by cAMP (24, 25) and FSH (17). Exogenous GATA4 expression also transactivates the porcine StAR promoter in primary cultures of porcine granulosa cells (19). An elegant study by Tremblay and Viger (12) showed that GATA4 activates not only the StAR promoter but also the promoters of other ovarian genes, including Cyp19. However, this was demonstrated by overexpressing GATA4 in a kidney cell line that does not normally express GATA4 and may not be representative of primary cells. Therefore, whether GATA4 is involved in the regulation of Cyp19 and the mechanism that regulates GATA4 transcriptional activity in ovarian cells remains to be determined.

The findings that GATA4 knockout mice die in utero have precluded in vivo studies evaluating the involvement of GATA4 in ovarian function (26, 27). To gain insight into the role of GATA4 in the regulation of Cyp19 gene expression in the ovary, we examined the effect of FSH on the expression and DNA binding activity of GATA4 in rat granulosa cells. We show that GATA4 binds to the Cyp19 promoter and that this binding is stimulated in vitro and in vivo by FSH. Evidence that GATA4 plays a role in Cyp19 expression is provided by the ability of an anti-GATA4 small interfering RNA (siRNA) to inhibit the FSH-induced Cyp19 expression and by the synergy displayed between exogenous GATA4 and FSH in the expression of this gene. In addition, we show that a GATA4 mutant protein acts as a dominant-negative on FSH-enhanced Cyp19 expression. We also describe a novel role for FSH in the regulation of GATA4 activity in granulosa cells.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
FSH and Pregnant Mare Serum Gonadotropin (PMSG) Stimulate Protein Binding to the GATA Response Element in the Cyp19 Promoter
To examine whether GATA response elements present in the proximal promoter of the Cyp19 gene are involved in the regulation of Cyp19 expression in granulosa cells, gel shift analyses were performed with a probe spanning the region –136/–106, which contains both GATA sites (Fig. 1AGo). Nuclear extracts were obtained from granulosa cells derived from estradiol-primed rats that were cultured in serum-free medium in the presence or absence of FSH (50 ng/ml) or from ovaries of 26-d-old rats treated with vehicle or with PMSG, a hormone that binds FSH receptors. Both FSH and PMSG enhanced binding of nuclear proteins to the –136/–106 region (Fig. 1BGo, left panel). As illustrated in the right panel of Fig. 1BGo, nuclear protein binding to the CLS was not affected by PMSG or FSH treatment, confirming the integrity of the nuclear extracts.


Figure 1
View larger version (74K):
[in this window]
[in a new window]

 
Fig. 1. Effect of FSH on Nuclear Protein Binding to the GATA Binding Sites Found in the Proximal Promoter of the Cyp19 Gene in Rat Granulosa Cells

A, Sequence of the rat Cyp19 promoter region that contains the two GATA binding sites and mutant oligonucleotides generated within this region. B, Gel shift analyses were performed using nuclear extract obtained from: 1) 26-d-old immature rats (d26) or immature rats treated with PMSG for 48 h or 2) undifferentiated granulosa cells treated with FSH or vehicle (Ctrl) for 48 h. Nuclear proteins were incubated with labeled, double-stranded oligonucleotides corresponding to GATA binding sites (left panel) or to the CLS site (right) found in the Cyp19 proximal promoter. In vivo experiments were repeated three times with similar results, whereas in vitro experiments were repeated four times also with similar results. C, Binding observed in the presence of nuclear proteins from FSH-treated undifferentiated cells competed with an unlabeled, wild-type oligonucleotide (GATA A+B) or an oligonucleotide containing mutations in both GATA sites (mutant A and B). Supershifted analysis: Antibodies against GATA4 or GATA6 were added to the EMSA reaction 15 min before the addition of the labeled probe. S, Bandshift; SS, supershifted bands. These experiments were repeated four times with similar results. D, Gel shift reaction was performed with nuclear proteins from FSH-treated granulosa cells and the following probes: the wild-type oligonucleotide containing both GATA sites (lanes 1–4), the same probe carrying mutations on GATA site A (lanes 5–7) or in the GATA site B (lanes 8–10). Binding reactions were competed with unlabeled oligonucleotides as indicated. These experiments were repeated three times with similar results.

 
Competition and supershift analyses determined the specificity and identity of the proteins that bind to the GATA response element. Addition of an unlabeled GATA probe in excess to the binding reaction completely prevented the formation of the shifted band observed with nuclear extracts of animals treated with PMSG (Fig. 1CGo, second line), whereas 100-fold excess of an unlabeled probe containing a mutation in both GATA binding sites had no effect. Previous studies have documented GATA4 and GATA6 expression in the ovaries of rodents, humans, and pigs. Subsequent supershift analyses assessed the presence of GATA4 or GATA6 in the protein/DNA complexes found after treatment with FSH. The addition of an antibody recognizing the C-terminal region of the GATA4 protein produced a complete supershift of the complex formed with the –136/–106 probe, whereas a GATA6-specific antibody caused only a partial supershift (Fig. 1CGo). These results suggest that in granulosa cells, GATA4 binds to the Cyp19 promoter and that this binding is enhanced by FSH.

Because two GATA sites have been described in the proximal Cyp19 promoter, we examined whether GATA4 binds to one or both sites. First, we investigated whether oligonucleotides carrying a mutation on site A or site B (mutant A and mutant B, see Fig. 1AGo) compete with the wild-type probe (–136/–106) in gel shift assays using nuclear proteins obtained from ovaries of rats treated with PMSG. As expected, a prominent protein/DNA complex was formed when the wild-type –136/–106 oligonucleotide was used as the labeled probe (Fig. 1DGo, line 1). The formation of this complex was blocked by adding an intact cold –136/–106 oligonucleotide (wild-type, line 2) and a cold oligonucleotide carrying a mutation on the GATA A site (mutant A, line 3) to the binding reaction, whereas adding a cold oligonucleotide that contains a mutation on the GATA B site (mutant B, line 4) had no effect. These results suggest that only site B participates in the formation of protein/DNA complexes observed with the –136/–106 probe. To confirm this finding, we labeled the oligonucleotide carrying a mutation on the GATA site A (mutant A). Again, a prominent protein/DNA complex was observed when this probe was mixed with ovarian nuclear extracts of PMSG-treated rats (Fig. 1CGo, line 5). The formation of this complex was prevented by addition of the unlabeled mutant A oligonucleotide (line 6). The mutant B oligonucleotide failed to compete with the mutant A probe for the binding of GATA4 (line 7). Finally, no shifted bands were observed when the labeled mutant B oligonucleotide was used as a probe (Fig. 1DGo, lines 8–9).

To investigate whether GATA4 binds to the Cyp19 promoter in living cells, chromatin immunoprecipitation (ChIP) studies were attempted in granulosa cells cultured in the presence or absence of FSH. The results showed an enrichment of the Cyp19 promoter after precipitation of the chromatin with an anti-GATA4 antibody in granulosa cells treated with FSH when compared with untreated cells. Lower levels of amplification were observed when a nonspecific IgG was used (Fig. 2Go). No enrichment of exon 9, a region distal to the Cyp19 promoter, was observed.


Figure 2
View larger version (37K):
[in this window]
[in a new window]

 
Fig. 2. GATA4 Binds to the Cyp19 Promoter in Living Cells

Primary rat granulosa cells were treated with vehicle or FSH (50 ng/ml). The soluble chromatin was immunoprecipitated (IP) with an anti-GATA4 antibody or normal mouse IgG. The proximal promoter and exon 9 of the Cyp19 promoter were amplified by PCR with specific primers. An aliquot taken from the chromatin sample before immunoprecipitation was also amplified as a control (Input). Copies of Cyp19 promoter in the immunoprecipitated chromatin and input fractions were also quantified using real-time PCR. Results were expressed as percent of control cells (without FSH and immunoprecipitated with normal IgG). Three different experiments were performed; each bar represents the mean ± SEM. *, P < 0.05 vs. all other groups (ANOVA I-Tukey Test).

 
FSH and PMSG Increase GATA4 mRNA and Protein Expression in Granulosa Cells
Quantitative RT-PCR and Western blot analyses were used to determine whether the increase in GATA4 binding reflects an increase in GATA4 mRNA and protein expression. A significant increase (P < 0.05) in GATA4 mRNA was observed after treatment of 26-d-old immature rats with PMSG for 48 h (Fig. 3AGo, right panel) and after incubating undifferentiated granulosa cells with FSH for 36 h (Fig. 3AGo, left panel). As expected, PMSG and FSH also increased Cyp19 mRNA expression (data not shown). Western blot analysis showed that treatment with PMSG in vivo or FSH in vitro increases GATA4 protein expression in nuclear fractions (Fig. 3BGo). GATA4 was not detected in the cytosolic fractions of undifferentiated or preovulatory granulosa cells after treatment with PMSG or FSH (data not shown). Expression of the TATA binding protein (TBP), which was used as the loading control, was not affected by PMSG of FSH (Fig. 3BGo). These results indicate that FSH stimulates GATA4 mRNA and protein expression in vivo in ovaries of immature rats and in vitro in primary cultures of granulosa cells.


Figure 3
View larger version (60K):
[in this window]
[in a new window]

 
Fig. 3. FSH Increases GATA4 mRNA and Protein Levels

Total RNA and nuclear proteins were isolated from 26-d-old immature rats (d26), or immature rats treated with PMSG for 48 h, or from undifferentiated granulosa cells cultured in the presence or absence of FSH for 48 h. A, GATA4 mRNA levels were determined using real-time RT-PCR. B, Western blot analysis on nuclear extracts was performed using a specific anti-GATA4 antibody or an anti-TATA binding protein antibody. *, P < 0.05 vs. d26 or control, n = 6.

 
GATA4 Silencing Blunts FSH Stimulation of the Cyp19 Gene
To examine whether GATA4 participates in the stimulation of Cyp19 expression by FSH, siRNA was used to knock down GATA4 expression. Initially, a green fluorescent-labeled RNA interference (RNAi) was used to test uptake of RNAi by the granulosa cells. By comparing the congruence of perinuclear green fluorescence and 4',6-diamidino-2-phenylindole, dihydrochloride-stained nuclei (Fig. 4AGo) in approximately 50 cells from multiple plates, we found that the percentage of cells successfully transfected, i.e. fluorescence-positive relative to total nuclei, was greater than 80%. Undifferentiated granulosa cells were then transfected with three RNA duplexes targeting specific sequences in GATA4 mRNA (siGATA4) or with a similar oligonucleotide containing a scrambled sequence (SCRAM). Twenty-four hours after siRNA transfection, the cells were incubated with vehicle or with FSH for 24 h. As shown in Fig. 4BGo, siGATA4 decreased the expression of GATA4 protein by approximately 80% when compared with cells transfected with SCRAM but had no effect on TBP expression, which was used as the loading control. The relative loss of GATA4 was comparable in magnitude with the transfection efficiency of a fluorescent RNAi. The induction of Cyp19 expression by FSH was significantly (P < 0.01) decreased in the presence of siGATA4 constructs when compared with cells transfected with a SCRAM RNAi. Cotransfection with siGATA4 and a GATA4 expression vector partially prevented the inhibitory effect of siGATA4 in GATA4 and Cyp19 mRNA expression (Fig. 4BGo, last column). These results suggest that GATA4 mediates, at least in part, the stimulatory effect of FSH on Cyp19 expression in granulosa cells.


Figure 4
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 4. GATA4 Silencing Blunts FSH Stimulation of the Cyp19 Gene

A, Cells were transfected with a control fluorescently labeled siRNA as described in Materials and Methods and examined for uptake of fluorescent siRNA label (perinuclear fluorescence) and blue-stained nuclei. Shown here are representative areas of ethanol-fixed cells. B, Western blot on total proteins for GATA4 and TBP in cells transfected with control siRNA (SCRAM) or anti-GATA4 siRNA (siGATA4) C, Undifferentiated granulosa cells were transfected with control siRNA (SCRAM) or an anti-GATA4 siRNA (siGATA4). A group of cells were transfected with a GATA4 expression vector (fourth column). Twenty-four hours after transfection cells were treated with FSH or vehicle for 24 h. Cyp19 and GATA4 mRNA levels were determined using quantitative real-time PCR. This experiment was repeated three times. Bars represent the mean ± SEM; columns with different letters differ significantly; a–b, a–c, and b–c, P < 0.01; c–d, P < 0.05 (ANOVA I-Tukey test).

 
GATA4 Binding to the Cyp19 Gene Is Decreased during Luteinization
Because LH down-regulates Cyp19 expression during luteinization (2, 28), we determined whether this down-regulation is accompanied by changes in GATA4 binding. Gel shift assays were performed by incubating labeled oligonucleotides containing the GATA binding sites present in the Cyp19 promoter with ovarian nuclear extracts from immature rats treated with PMSG for 48 h and then injected with an ovulatory dose of human chorionic gonadotropin (hCG) in vivo for 8 and 24 h. As shown in Fig. 1Go, a prominent GATA4/DNA complex was formed with the nuclear extract of the rats treated with PMSG. Formation of this complex was diminished after 8 and 24 h of treatment with hCG in vivo (Fig. 5AGo). In good agreement with a previous report (6), we did not observe major changes in the binding of nuclear proteins to the CLS element after hCG treatment (Fig. 5AGo, bottom panel). Only shifted bands are shown for CLS. Administration of hCG decreased GATA4 mRNA expression when compared with animals treated with PMSG (Fig. 5BGo). As expected, hCG rapidly inhibited Cyp19 mRNA expression (data not shown).


Figure 5
View larger version (52K):
[in this window]
[in a new window]

 
Fig. 5. GATA4 Binding to the Cyp19 Promoter Is Down-Regulated during Luteinization

A, Binding of ovarian nuclear protein to the GATA (top) and CLS (bottom) of the Cyp19 promoter. B, GATA4 mRNA levels in ovaries of immature rats (d26); immature rats treated with PMSG or PMSG + hCG. These experiments were repeated three times with similar results. Bars represent the mean ± SEM; columns with different letters differ significantly, P < 0.01 (ANOVA I-Tukey test).

 
GATA4 Synergizes with FSH in the Up-Regulation of Cyp19 Promoter Activity
To examine the effect of GATA4 on the activity of the rat Cyp19 promoter, the region from –245 to +63 of the rat Cyp19 gene was cloned and inserted into a luciferase reporter vector. This construct will be referred as 245Cyp19pr-LUC. Primary granulosa cells obtained from estrogen-primed rats were transfected with the 245Cyp19pr-LUC construct. Thirty-six hours after transfection, the cells were treated with FSH for 6 h. FSH significantly (P < 0.01) elevated the activity of the 245Cyp19pr-LUC construct (Fig. 6AGo). Mutation of the two GATA binding sites lowered basal and FSH-induced 245Cyp19pr-LUC reporter activity (Fig. 6AGo). As shown in Fig. 1Go, GATA4 binds only to the distal GATA site located at the –123/–128 position (GATA B). To investigate whether this site participates in the induction of Cyp19 promoter activity by FSH, we mutated the GATA A or the GATA B site in the 245Cyp19pr-LUC construct. In good agreement with the gel shift results presented in Fig. 1Go, mutation of GATA site A did not affect the induction of 245Cyp19pr-LUC reporter activity by FSH. In contrast, mutation of GATA site B significantly (P < 0.05) decreased basal Cyp19 promoter activity suggesting that this construct responds to GATA4 in the absence of FSH (Fig. 6AGo). GATA site B mutation also decreased the total activity of the promoter in the presence of FSH (Fig. 6AGo). Despite that mutation of GATA site B did not affect fold stimulation by FSH, this results suggest that this response element is necessary for maximal activity of the Cyp19 promoter in the presence of FSH.


Figure 6
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 6. GATA4 Synergizes with FSH in the Up-Regulation of Cyp19 Promoter Activity

A, Undifferentiated granulosa cells were transfected with a reporter construct containing the proximal 245 bp of the Cyp19 promoter region (245Cyp19pr-LUC) or the same promoter carrying mutations on both GATA sites (mut GATA A and B) or single mutations (mut GATA A or mut GATA B). Thirty-six hours later, the cells were treated with FSH or vehicle for 6 h. Transient expression of the reporter gene was quantified by a standard luciferase bioluminescence assay and normalized against ß-galactosidase. The ratio between luciferase and ß-galactosidase is reported (relative luciferase units or RLU). B, Undifferentiated granulosa cells were transfected with 245Cyp19pr-LUC (columns 1–4) of with the same promoter carrying a mutation in GATA site B (columns 5–8). Cells were cotransfected with pcDNA (columns 1, 2, 5, and 6) or a GATA4 expression vector (columns 3, 4, 7, and 8). For cotransfections, 0.2 µg of Cyp19 reporter plasmid were transfected with 0.2 µg of expression vector. Thirty-six hours later, the cells were treated with FSH or vehicle for 6 h as indicated. C, Undifferentiated granulosa cells were transfected with 245Cyp19pr-LUC plus increasing amounts of a GATA4 expression vector. The total amount of DNA was kept constant in all samples (0.25 µg/well) by adding empty plasmid (pcDNA). Bars represent the mean ± SEM replicates. The experiments were repeated five times.

 
Overexpression of GATA4 in a kidney cell line increases human Cyp19 promoter activity (12). Therefore, we examined whether overexpression of GATA4 in primary granulosa cells enhances basal 245Cyp19pr-LUC reporter activity or affects stimulation of this construct by FSH. As shown in Fig. 6BGo, both FSH treatment and GATA4 transfection activated the Cyp19 promoter. More significantly, GATA4 transfection together with FSH stimulation synergistically activated (P < 0.001) Cyp19 promoter activity (Fig. 6BGo, column 4). The stimulatory effect of GATA4 and the synergism between GATA4 and FSH greatly depended on GATA site B because mutation of this region significantly (P < 0.05) decreased these effects (Fig. 6BGo, compare column 3 with column 7 and column 4 with column 8). Similarly to the results presented in Fig. 6AGo, mutation of the GATA B site significantly (P < 0.05) decreased the ability of FSH to activate the aromatase promoter (Fig. 6BGo, lane 6). Transfection with increasing concentrations of a GATA4 expression vector elicited a concentration-dependent synergistic effect on Cyp19 promoter activity (Fig. 6CGo). Taken together, these results indicate that GATA4 can increase Cyp19 promoter activity in primary rat granulosa cells. In addition, the synergistic effect observed between GATA4 overexpression and FSH treatment suggests that FSH up-regulates GATA4 transcriptional activity.

Serine 105 in GATA4 Is Essential for the Induction of Cyp19 Expression by FSH
Next, we assessed whether FSH directly increases GATA4 transcriptional activity. Two distinct phosphor-acceptor sites, Ser105 and Ser261, are involved in GATA4 transcriptional activation (29). Ser105 is targeted by the ERK kinase pathway in the heart (30), whereas protein kinase A (PKA) phosphorylates Ser261 in a gonadal cell line (31). Because these two signaling pathways are activated by FSH in granulosa cells (32, 33), we examined whether Ser105 and Ser261 are involved in the synergistic effect elicited by FSH and GATA4 overexpression. We created mutations on the GATA4 expression vector that direct the expression of GATA4 mutant proteins containing asparagine on position 105 or 261 (S105N or S261N). In the presence of FSH, Cyp19 promoter activity was significantly (P < 0.05) higher in cells transfected with wild-type GATA4 compared with cells transfected with an empty vector. Mutation of Ser261 to asparagine did not affect the synergy between FSH treatment and GATA4 overexpression (Fig. 7AGo). In contrast, expression of the GATA4S105N protein blocked the synergy between GATA4 and FSH and significantly (P < 0.05) reduced the stimulatory effect of FSH. The lower panel in Fig. 7AGo is a Western blot analysis for GATA4 protein performed on the same sample where the luciferase assay was determined; the results indicate that FSH increased GATA4 protein expression in cells transfected with pcDNA, whereas in cells transfected with expression vectors for GATA4, GATA4S261N, or GATA4S105N, the mutants and wild-type proteins are expressed at comparable levels.


Figure 7
View larger version (26K):
[in this window]
[in a new window]

 
Fig. 7. Ser105 of the GATA4 Protein Is Essential for Cyp19 Induction by FSH

A, Undifferentiated granulosa cells cultured in 24-well plates were transfected with 245Cyp19pr-LUC plus an empty plasmid pcDNA, a wild-type GATA4 expression vector, a S261N mutant GATA4 expression vector, or a S105N mutant GATA4 expression vector. Thirty-six hours later, the cells were treated with FSH or vehicle (control). The lower panel is a Western blot analysis for GATA4 protein performed on the same sample were luciferase assay was determined. B, Granulosa cells cultured in 12-well plates were transfected with an empty plasmid (pcDNA), a wild-type GATA4 expression vector (GATA4), or a S105N mutant GATA4 expression vector (GATA4S105N). After transfection, the cells were treated with FSH or vehicle (ctrl) for 36 h. Cyp19 expression levels were determined by RT-PCR. These experiments were performed in duplicate and were repeated three times with identical results. *, P < 0.05 vs. pcDNA + FSH; and **, P < 0.01 vs. pcDNA + FSH (ANOVA I-Tukey test).

 
To determine whether overexpression of the wild-type GATA4 or GATA4S105N mutant protein affects basal or FSH stimulated Cyp19 mRNA levels, granulosa cells were transfected with pcDNA, GATA4, or GATA4S105N expression vectors and then incubated with vehicle or FSH for 36 h before the determination Cyp19 and L19 mRNA by RT-PCR. The expected increase in Cyp19 mRNA by FSH was potentiated by overexpression of a wild-type GATA4 protein but blocked by the overexpression of a mutant GATA4S105N protein (Fig. 7BGo). Cells transfected with pcDNA, GATA4, GATA4S261N, or GATA4S105N look healthy under the microscope, with no indication of cell death. These results emphasize the important role played by GATA4 in FSH-induced Cyp19 expression. They also suggest that FSH increases the transcriptional activity of GATA4 by a mechanism that is likely mediated by phosphorylation of Ser105 because mutation of this residue completely prevents FSH-enhanced Cyp19 expression.

Mechanism of FSH-Induced GATA4 Activation
To evaluate the intracellular mechanisms that may mediate the FSH-induced increase in GATA4 transcriptional activity in rat granulosa cells, we focused initially on the cAMP/PKA pathway, the classical mediator of the intracellular actions of FSH in the gonads (34). To assess the influence of PKA activity on the increase in GATA4 transcriptional activity, we examined the effects derived from incubating granulosa cells with the PKA inhibitor H89 or with a myristoylated PKA inhibitor peptide (mPKAi). These inhibitors have been previously used to study PKA signaling in rat granulosa cells (32, 33, 35). In granulosa cells, FSH also promotes the activation of p42/p44 ERK (32) and phosphatidylinositol-dependent kinase (PI3-K) (33). To examine the participation of these kinases, additional experimental groups were included. Undifferentiated granulosa cells were transfected with the 245Cyp19pr-Luc reporter construct and a GATA4 expression vector. Thirty-six hours after transfection, the cells were treated with H89 (10 µM) or mPKAi (20 µM), or with the PI3-K/casein kinase 2 (CK2) inhibitor LY294002 (5 µM), or with the ERK1/2 inhibitor UO126 (5 µM) for 1 h before treatment with FSH (50 ng/ml) for 6 h. LY294002 and UO126 have been previously used to study the function of ERK1/2 and PI3-K in granulosa cells (33, 36). Controls were transfected with pcDNA or GATA4 and treated with vehicle (dimethylsulfoxide). As expected, GATA4 overexpression induced Cyp19 promoter activity (Fig. 8Go, columns 3). This stimulatory effect of GATA4 on Cyp19 promoter activity was amplified almost 7-fold in the presence of FSH (column 4). Pretreatment with the PKA inhibitors (H89 or mPKAi) completely blocked the synergistic effect observed between FSH treatment and GATA4 overexpression and decreased Cyp19 promoter activity below the levels induced by FSH alone (Fig. 8Go, columns 5 and 6); whereas LY294002 or UO126 decreased Cyp19 promoter activity to the levels induced by FSH alone (Fig. 8Go, columns 7 and 8). Cotreatment with LY294002 and UO126 decreased the FSH-induced Cyp19 promoter activity to levels found in the presence of H89 or mPKAi. No effect on Cyp19 promoter activity was observed after pretreatment with the PKC inhibitor GF109203X, which has been previously used to inhibit PKC activity in granulosa cells (33, 35, 37). Taken together, this evidence suggests that PKA activity is necessary for full activation of the Cyp19 promoter even in the presence of exogenously expressed GATA4. In cells overexpressing GATA4, LY294002 or UO126 decrease Cyp19 promoter activity to the levels found with FSH alone, suggesting that ERK1/2, and PI3-K may be involved in GATA4 activation by FSH. It should be mentioned that recent reports (38, 39) indicate that LY294002 inhibits CK2. Although it is not known whether FSH affects CK2 activity, its participation cannot be ruled out.


Figure 8
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 8. Mechanism of FSH-Induced GATA4 Activation

Undifferentiated granulosa cells were transfected with 245Cyp19pr-LUC. Thirty-six hours later, the cells were treated with PKA inhibitors (H89 or mPKAi), with the PI3-K and CK2 inhibitor LY294002 (LY), with the ERK1/2 inhibitor UO126 (UO) or with the PKC inhibitor GF109203X (GF). FSH was added to the medium 1 h later. Luciferase activity was determined 6 h after FSH addition. This experiment was repeated four times. Bars represent the mean ± SEM; columns with different letters differ significantly, P < 0.01 (ANOVA I-Tukey test).

 
FSH Increases GATA4 Phosphorylation at Ser105
To determine whether FSH can increase GATA4 phosphorylation on Ser105, granulosa cells were harvested from the ovaries of estradiol-primed immature rats and transfected with a GATA4 expression vector or with a GATA4S105N mutant expression vector. Thirty-six hours after transfection, FSH (50 ng/ml) was added for selected time intervals. At each interval, cell extracts were prepared for Western blotting and probed with an antibody that specifically recognizes GATA4[pS105]. The GATA4[pS105] signal was normalized to total GATA4 and the results expressed as fold change to the untreated control. The relative increase in GATA4[pS105] of four different experiments is reported as average ± SEM. The presence of immunoreactive GATA4[pS105] in GATA4 transfected cells was observed in the absence of FSH treatment. A significant (P < 0.05) increase in Ser105 phosphorylation was observed in response to FSH within 30 min of treatment. GATA4 phosphorylation remained higher than in the control cells 1 h after FSH was added. In cells transfected with the S105N mutant, a very low signal for GATA4[pS105] was detected in the absence of FSH. However, in the presence of FSH, a significant (P < 0.01) increase in GATA4 phosphorylation was observed, likely reflecting phosphorylation of endogenous GATA4. The amount of total GATA4 remained the same regardless of treatment as shown by striping and reprobing the membranes with an antibody that recognized the nonphosphorylated form of GATA4. In nontransfected undifferentiated granulosa cells cultured in serum-free medium for 36 h, the addition of FSH increased GATA4 phosphorylation in a time-dependent manner (Fig. 9BGo). Total GATA4 was present in granulosa cells at 0 h and remained essentially constant during FSH treatment.


Figure 9
View larger version (46K):
[in this window]
[in a new window]

 
Fig. 9. FSH Increases GATA4 Phosphorylation at Ser105

A, Primary granulosa cells transiently transfected with a wild-type GATA4 or a mutant GATA4S105N expression vector were stimulated with FSH for 30 or 60 min. Cell extracts were resolved by SDS-PAGE and immunoblotted with phospho-GATA4 S105 or pan GATA4 antibodies. GATA4[p105] levels were normalized to total GATA4 signal and expressed as fold change to the untreated control. AVG, Average. B, Primary granulosa cells were cultured for 48 h before the addition of FSH (50 ng/ml) to the culture medium. Cell extracts were prepared at the designated intervals and used for Western blot analysis using antibodies specific for GATA4 or phosphorylated GATA4. C, Gel shift analyses were performed as detailed in Fig. 1Go. Normal serum or antibodies against GATA4 or anti-GATA4[pS105] were added to the EMSA reaction 60 min before the addition of labeled probe. SS, Supershifted bands. These experiments were repeated three times with similar results.

 
To determine whether the phosphorylated form of GATA4 is present in the gel shift bands observed in PMSG- or FSH-treated samples, the anti-GATA4[pS105] antibody was included in the gel shift reaction. As expected, adding an anti-GATA4 antibody supershifted the GATA4-specific band observed after treatment with PMSG (Fig. 9CGo). The anti-GATA4[pS105] antibody also caused a prominent supershift of the GATA4-specific band. In primary granulosa cells treated with FSH, a supershift was also observed when the anti-GATA4[pS105] antibody was added to the gel shift reaction.

Intracellular Signaling Mediating the FSH-Induced Increase on GATA4 Phosphorylation
To evaluate the intracellular mechanisms that mediate FSH-enhanced GATA4 phosphorylation on Ser105, granulosa cells were transfected with a GATA4 expression vector. Thirty-six hours after transfection, cells were treated with the PKA inhibitor H89 (10 µM), or the PI3-K/CK2 inhibitor LY294002 (5 µM), or the ERK1/2 inhibitor UO126 (5 µM) for 1 h before treatment with FSH (50 ng/ml) for 4 h. Phosphorylated and total GATA4 were detected by Western blot analysis. As shown in Fig. 10AGo, FSH increased GATA4 phosphorylation. Pretreatment with H89 or LY294002 prevented the stimulatory effect of FSH on GATA4 phosphorylation, whereas pretreatment with UO126 not only blocked the stimulatory effect of FSH on GATA4 phosphorylation but also decreased phosphorylation of GATA4 to levels below the controls. In the same blots, total GATA4 levels were the same regardless of the inhibitor used.


Figure 10
View larger version (79K):
[in this window]
[in a new window]

 
Fig. 10. Intracellular Signaling Mediating the FSH-Induced Increase on GATA4 Phosphorylation

A, Granulosa cells were transfected with a GATA4 expression vector. Thirty-six hours after transfection, cells were treated with H89, LY, or UO for 1 h before treatment with FSH (50 ng/ml) for 4 h. Phosphorylated and total GATA4 were detected by Western blot analysis. B, Undifferentiated granulosa cells were pretreated with H89, mPKAi, LY, UO, or GF. FSH was added to the medium 1 h later. Gel shift analysis was performed 48 h after treatment with FSH. These experiments were repeated three times with identical results.

 
We also examined the intracellular mechanism by which FSH increases GATA4 DNA binding. To assess the influence of PKA, ERK1/2, PI3-K activity, we examined the effects derived from incubating granulosa cells with H89, mPKAi, LY294002, or UO126 for 1 h before adding FSH to the culture medium. As shown before, FSH stimulated GATA4 binding in primary granulosa cells (Fig. 10BGo). Pretreatment with H89 or LY294002 not only completely blocked the increase in GATA4 binding induced by FSH but also reduced GATA4 binding to levels below the controls. Similar results were obtained with the PKA-selective mPKAi. Pretreatment with UO126 decreased DNA GATA4 binding to the levels found in the controls. GATA4 DNA binding was not altered by the protein kinase C inhibitor GF109203X. Taken together, these results suggest that the effect of FSH on GATA4 phosphorylation and DNA binding is mediated by multiple kinases.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The expression of Cyp19 is dynamically regulated during the ovarian cycle. FSH enhances the expression of this gene in preovulatory follicles, whereas after the ovulatory LH surge, Cyp19 is rapidly turned off. In this study, we provided evidence that GATA4 participates in dynamic regulation of the Cyp19 gene in primary rat granulosa cells. Moreover, we demonstrated that luteinization-related down-regulation of Cyp19 expression is accompanied by a decrease in GATA4 binding and mRNA levels, lending further support to the participation of GATA4 in the regulation of Cyp19 expression in the ovary.

In immature mice, in situ hybridization studies demonstrated that administration of PMSG enhances follicular expression of GATA4 and GATA6 transcripts (18). In pigs, GATA4 and GATA6 mRNA expression is low in small follicles and reaches the highest level of expression after the follicles have developed to the preovulatory state (19). Our present results obtained in immature rats treated with PMSG confirmed these findings and further demonstrated an increase in GATA4 protein expression. Previous reports found that in MSC-1 Sertoli cells and NT-1 granulosa cells FSH increases GATA4 and GATA6 mRNA expression (18). We showed that primary rat granulosa cells also respond to FSH with an increase in GATA4 mRNA and protein expression. These experimental results, taken together with the observation that women carrying an inactivating mutation of the FSH receptor show low or negligible GATA4 expression in the ovary (40), provide a compelling argument that FSH plays an important role in regulating the expression of GATA4 in the ovary.

In agreement with previous studies performed on cancer and kidney cell lines (12, 41), the current investigation shows that overexpression of GATA4 in primary rat granulosa cells increased the activity of the Cyp19 promoter. Moreover, the well-known stimulatory effect of FSH on Cyp19 mRNA expression and promoter activity was potentiated by the overexpression of exogenous GATA4 and reduced by an anti-GATA4 siRNA, suggesting that GATA4 mediates, at least in part, the effect of FSH on Cyp19 expression. The synergistic enhancement of Cyp19 promoter activity and Cyp19 mRNA resulting from FSH stimulation and GATA4 overexpression indicates that FSH not only stimulates GATA4 expression but also increases the transcriptional activity of this transcription factor.

The observation that GATA4S105N protein dramatically inhibits the FSH-induced increase in Cyp19 promoter activity and mRNA accumulation suggests that phosphorylation of Ser105 is a key step for the activation of Cyp19 expression. GATA4S105N may act as a dominant-negative protein that inactivates complexes formed between GATA4 and other transcription factors and coactivators involved in Cyp19 expression. However, mutation of Ser105 to asparagine may not alter the capacity of GATA4 to bind these proteins. Even though interactions of GATA4 with other proteins have not been explored in granulosa cells, in other cell types this transcription factor synergizes with LRH-1 and SF-1 to activate gene expression (42, 43). Although phosphorylation of GATA4 at Ser261 has been shown to enhance its transcriptional activity (31), our observation that both wild-type GATA4 and GATA4S261N synergize with FSH to induce Cyp19 promoter activity suggests that Ser261 is not involved in the induction of Cyp19 expression by FSH in primary granulosa cells.

ERK1 and 2 play a major role in the activation of GATA4 in cardiac myocytes via phosphorylation of Ser105 (30). The current results indicate that in the rat ovary GATA4 is phosphorylated on Ser105 with FSH increasing this phosphorylation, probably in an ERK1/2-dependent manner. Unexpectedly, pretreatment with LY294002, a PI3-K and CK2 inhibitor partially prevented the effect of FSH on GATA4 phosphorylation. The opposite relationship was observed when we studied the GATA4 DNA binding; thus, whereas LY290042 completely blocked GATA4 DNA binding, inhibition of ERK1/2 had only a partial effect. These results suggest that ERK1/2 and PI3-K or CK2 may act in concert to regulate GATA4 activity and DNA binding capacity and that ERK1/2 plays a role in GATA4 phosphorylation, whereas PI3-K/CK2 activity is important for the stimulation of GATA4 DNA binding. Further studies are needed to evaluate this hypothesis. FSH activates ERKs (32, 44) and PI3-K (33) kinases via PKA (45) in rat granulosa cells. However, inhibition of PKA activity only partially prevented the effect of FSH on GATA4 phosphorylation, suggesting that alternative mechanisms may also contribute to the increase in ERK1/2 activity by FSH.

Another potential mechanism by which GATA4 may increase Cyp19 transcription involves protein-protein interactions with coactivators. It is known that p300 (46) and cAMP response element binding protein-binding protein (31) bind GATA4. Interestingly, p300 not only acts as a coactivator but also increases GATA4 DNA binding capacity via acetylation (47). Protein kinase B (PKB), the downstream target of PI3-K, promotes the transcriptional potential and enhances the stability of p300 (48, 49). In rat granulosa cells, FSH increases PKB phosphorylation (33, 44, 50). A critical role of the PI3-K pathway in Cyp19 expression is evidenced by the ability of a dominant-negative PKB to inhibit Cyp19 expression (51). Taking these observations together, it is possible to postulate that in granulosa cells the activation of the PI3-K pathway may lead to an increase in p300 activity, which in turn could increase GATA4 DNA binding affinity through acetylation. Further studies are needed to determine whether FSH increases GATA4 acetylation and whether this modification affects GATA4 DNA binding.

In conclusion, the current study provides in vivo and in vitro evidence that GATA4 contributes to the dynamic regulation of Cyp19 expression in the rat ovary. Thus, this study demonstrates that FSH induces GATA4 expression and binding to the Cyp19 promoter, whereas abolishing GATA4 expression by using siRNA blunts FSH augmentation of aromatase expression. We also provide evidence showing that Ser261, which has been proposed to participate in GATA4 activation in gonad cells lines, is not important for the induction of Cyp19 expression by FSH in primary granulosa cells. Overall, our results describe a novel role for FSH in the regulation of GATA4 activity in granulosa cells. In addition, we have shown that the GATA4S105N mutant acts as a dominant-negative protein on the stimulation of Cyp19 expression by FSH.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Reagents
Media and cell culture reagents were purchased from Invitrogen (Carlsbad, CA). Ovine FSH (oFSH-16) was a gift of the National Hormone and Pituitary Program (Rockville, MD). PMSG, estradiol, and all buffer components were purchased from Sigma (St. Louis, MO), and H89, GF109203X, UO126, and LY294002 were purchased from EMD Biosciences-Calbiochem (San Diego, CA). The antibodies GATA4 (sc1237x) and GATA6 (sc7244x) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA); anti-pS105-GATA4 was purchased from Abcam (Cambridge, UK).

Experimental Animals
Sprague Dawley rats purchased from Harlan (Indianapolis, IN) were housed at 20 C with a 14-h light, 10-h dark cycle (lights on 0500–1900 h) and allowed free access to food and water. Animal care and handling conformed to the National Institutes of Health guidelines for animal research. The experimental protocol was approved by the Yale University Animal Resources Center.

Granulosa Cell Culture
Rats were injected sc at 25 d of age with 1.5 mg/ml of estrogen once daily for 3 d before the undifferentiated granulosa cells were isolated. The ovaries were isolated, and the granulosa cells were obtained by puncturing the follicles. The cells were then cultured in DMEM-Ham’s F-12 (DMEM/F-12, 1:1) plus Nutridoma NS (Roche, Indianapolis, IN) and 0.1% of BSA in laminin (Roche)-coated wells. The granulosa cells were seeded onto 12-well dishes then incubated with FSH (50 ng/ml) for 48 h. To harvest cells after experimental treatments, cells were washed twice with ice-cold PBS and stored at –70 C.

EMSA
Ovaries or granulosa cells were homogenized in solution A [10 mM HEPES-KOH (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EGTA, 0.5 mM phenylmethanesulfonyl fluoride, and 0.5 mM dithiothreitol]. Nuclei were obtained by 30-sec centrifugation at 4 C in an Eppendorf centrifuge and resuspended in solution B, which consists of solution A supplemented with 420 mM NaCl, 5% (vol/vol) glycerol, and no KCl. Nuclei were rocked for 30 min at 4 C and then centrifuged at 14,000 x g at 4 C for 20 min. The supernatant was then divided into portions and stored at –80 C. Double-stranded DNA probes were end-labeled with 32P and incubated with 5 µg of nuclear proteins for 30 min at 25 C in the presence of 0.05 µg/µl of salmon sperm DNA. The samples were then loaded in a 6% polyacrylamide nondenaturing gel; electrophoresis was carried out in 0.5x Tris-borate-EDTA buffer at 4 C for 90 min. Free and bound probes were identified by autoradiography of the dried gels. For the supershift assay, nuclear extracts were preincubated with GATA4, GATA6, or anti-pS105-GATA4 antibodies for 15–60 min before the labeled probe was added.

RNA Isolation and Quantitative Real-Time PCR Analysis
Total RNA from frozen granulosa cells or rat ovary was isolated using Tri-Reagent following the manufacturer’s instructions. For mRNA analysis by RT-PCR, 1 µg of the total RNA was reverse-transcribed at 42 C using Advantage RT-for-PCR kit (Promega, Madison, WI) and later diluted to a final volume of 100 µl.

To generate standard curves for rat Cyp19, GATA4, or L19, the cDNA of these genes was cloned into pCR 2.1 vector (Invitrogen), sequenced, and excised by restriction enzyme. Purified cDNA was diluted to concentrations ranging from 103 to 6 x 106 copies/µl. Five-microliter aliquots of standard cDNA or sample cDNA were combined with SYBR Green I (Bio-Rad, Hercules, CA), specific primers for rat Cyp19, GATA4, or L19, and water to 20 µl final volume. The introns spanning primers were used to amplify Cyp19: ctgctgatcatgggcctcct and ctccacaggctcgggttgtt, GATA4: gggcgagcctgtttgcaatg and tgcttggagctggcctgtga, and L19: ctgaaggtcaaagggaatgtg and ggacagagtcttgatgatctc.

Real-time quantification of the PCR product in each cycle was carried out in an iQcycler Real-Time PCR machine (Bio-Rad) with the following cycling conditions: preincubation at 95 C for 2 min, followed by 40 cycles of denaturation at 95 C for 5 sec, annealing at 60 C for 10 sec, and extension at 72 C for 10 sec. The melting peak of each sample was routinely determined by melting curve analysis to ascertain that only the expected products had been generated. The minimal number of cycles sufficient to produce detectable levels of fluorescence (cycle threshold) was calculated using the MyiQ software. The number of Cyp19, L19, or GATA4 mRNA molecules present in each sample was calculated using a standard curve and expressed as copies per nanogram of total RNA. The results are expressed as the ratio between the copies number per nanograms of total RNA of GATA4 and ribosomal L19 protein.

Western Blot Analysis
Ovaries or cells were homogenized in an ice-cold lysis buffer [10 mM Tris-Cl, pH 8.0; 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 40 µM phenylmethanesulfonyl fluoride, 0.3 µM aprotinin, and 1 µM leupeptin]. This was followed by 30-min incubation on ice and centrifugation at 10,000 x g for 20 min at 4 C. The supernatant was transferred to new tubes, aliquoted, and stored at –70 C until electrophoresis. An aliquot of the supernatant was kept for protein measurement using BSA as a standard. The samples were denatured by adding sample buffer [62.5 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 5% ß-mercaptoethanol, 0.01% bromophenol blue], followed by boiling for 10 min. Thirty micrograms of protein were separated on 10% SDS-PAGE gels in Tris-glicine and 0.1% SDS buffer, and transferred to polyvinylidene difluoride membranes in 25 mM Tris, 192 mM glycine, and 20% methanol buffer by 250 mA for 1.5 h. The blots were incubated for 2 h at room temperature in 5% nonfat dry milk to block unspecific binding. The blots were then washed and incubated overnight at 4 C with anti-GATA4 antibody (Santa Cruz Biotechnology) and were washed and incubated with a secondary antibody conjugated to horseradish peroxidase (1/6000 dilution) for 2 h at room temperature. After stripping blots were probed with an anti-TATA binding protein antibody (Abcam). Protein-antibody complexes were visualized using Western blotting Luminol Reagent following the manufacturer’s protocol (Santa Cruz Biotechnology).

Plasmid and Reporter Constructs
The region between –245 to +63 of the aromatase gene, where +1 is the transcription initiation site (3) Cyp19 gene was cloned from rat genomic DNA. PCR products were cloned into the pGL3 Basic luciferase report vector (Promega) by using XhoI and HindIII restriction sites and confirmed by sequencing. The GATA binding sites A and B found in the Cyp19 promoter were mutated as shown in Fig. 1Go. Both mutations were performed using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). The GATA4-expressing vector was obtained from Dr. David Wilson. Mutation of Ser105 and Ser261 to asparagine was also performed using the QuikChange site-directed mutagenesis kit.

Reporter Gene Assays
For promoter studies, undifferentiated granulosa cells were plated on 12-well plates. Cells were transfected with luciferase reporter plasmids (200 ng/well) using FuGene 6 transfection reagent (Roche). Thirty hours after transfection, cells were treated with either FSH (50 ng/ml) or vehicle for 6 h. Transcription efficiency was normalized by cotransfection of the pCMV-ß-galactosidase expression vector (20 ng/well) (Promega). Lysates were prepared using 100 µl of passive lysis buffer (Promega). Luciferase activity was determined in 50 µl of the lysate/sample using the Luciferase Reporter Assay (Promega) and a TD 20/20 luminometer (Turner Designs). ß-Galactosidase activity was determined in 5 µl of the lysate/sample using the ß-galactosidase Assay System (Promega) according to the manufacturer’s protocol. Results are expressed as relative luciferase units normalized to ß-galactosidase activity.

RNAi
RNAi consisted of a pooled mixture of three RNA duplexes targeting specific sequences in GATA4 mRNA (accession no. NM_144730): 5'-gggcgagccuguuugcaaugccugc-3', 5'-gggacaggacacuaccuaugcaacg-3', 5'-gcccaagaaucugaauaaaucuaag-3'). RNAi constructs were obtained from IDT (Coralville, IA). For transfection with X-tremeGENE siRNA Transfection Reagent (Roche), 1 µl of a 10-µM solution of each specific siRNA duplex or a control SCRAM were diluted in 50 µl of serum-free Optimen (Invitrogen). In parallel, 5 µl X-tremeGENE were added to 50 µl of serum-free Optimen, and the resulting mixture was combined immediately with the diluted siRNAs. After 20 min incubation at room temperature the solution was added dropwise to the cells. Without any further medium change the cells were assessed for vitality by microscopic inspection 24 and 48 h after transfection and subsequently lysed for protein analysis by immunoblot or gene expression by RT-PCR.

To test uptake of RNAi by granulosa cells, they were transfected with a control fluorescently labeled RNAi (siCY3) from IDT followed by examination of ethanol-fixed cells for fluorescent RNAi, which accumulates in a distinct perinuclear distribution and 4',6-diamidino-2-phenylindole, dihydrochloride-stained nuclei. By comparing the congruence of perinuclear yellow fluorescence and blue-stained nuclei in approximately 50 cells in representative fields from multiple plates, we found that the percentage of cells successfully transfected, i.e. fluorescence-positive relative to total nuclei, was higher than 80% (see Fig. 4Go for a representative microscope field). This estimate of transfection efficiency for RNAi was comparable in magnitude with the relative losses of GATA4 mRNA.

ChIP Assay
Cells were cultured for 48 h with FSH or vehicle in 100-mm plates. After this interval, formaldehyde was added, reaching a concentration of 1%. After 10 min, glycine to a final concentration of 0.125 M was added for the next 5 min. The cells were washed in ice-cold PBS and resuspended in the cell lysis buffer [10 mM HEPES-KOH (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.5% Nonidet P-40] + protein inhibitor cocktail (Sigma; catalog no. P-8340). Nuclei were obtained by a 5-min centrifugation at 4 C by 2000 x g, resuspended in the nuclei lysis buffer [1% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8.1)], and sonicated to shear chromatin. Next, the DNA content was evaluated by 260 nM absorbance, and even amounts of DNA were diluted 1:10 in the ChIP dilution buffer [0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl (pH 8.1), 167 mM NaCl]. To reduce background, lysates were precleared by rocking for at least 2 h at 4 C with 80 µl of protein A/G PLUS agarose (Santa Cruz; catalog no. sc-20030) and 2 µg of salmon sperm DNA. After short spin supernatants were collected and 4–8 µg of anti-GATA4 antibody (Santa Cruz; catalog no. sc-1237x) were added. After overnight incubation at 4 C, 50 µl of protein A/G PLUS agarose were added, and the suspensions were rocked for another 2 h. Agarose beads were successively washed with low-salt buffer [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM Tris-HCl (pH 8.1)], high-salt buffer [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl (pH 8.1), 500 mM NaCl], ChIP wash buffer (Santa Cruz; catalog no. sc-45002), and a TE buffer [10 mM Tris (pH 8)/1 mM EDTA (pH 8)]. DNA/protein/antibody complexes were eluted from agarose beads using elution buffer (1% SDS, 0.1 M NaHCO3) by rocking for 30 min at room temperature. NaCl was added to reach a final concentration of 300 mM followed by an incubation of 4 h at 65 C. This step was followed by 1-h digestion with proteinase K, and finally, phenol/chloroform extraction of DNA was carried out. The precipitated DNA was resuspended in water. Five microliters of DNA were used to amplify the promoter region of the cyp19 gene (primers: gcacgtcactctacccactcaagg and gcaaagcagtagtttggctgtgg) or part of exon 9 (primers: aacgagagcctgcggtatcagc and ttgggcttggggaaatactcg). Results were expressed as percent of control cells (without FSH and immunoprecipitated with normal IgG).

Statistics
The statistical analysis of data was performed using Prism software (GraphPad Software, Inc., San Diego, CA). The statistical test used in each particular experiment is depicted in the figure legend. Values were considered statistically significant at P < 0.05.


    ACKNOWLEDGMENTS
 
We thank Dr. David Wilson (University of Washington, Seattle, WA) for the GATA4 expression vector and Dr. Frederick Schatz (Yale University School of Medicine) for the critical reading of the manuscript.


    FOOTNOTES
 
This work was supported by National Institutes of Health Grant HD047427 (to C.S.).

Disclosure Statement: The authors have nothing to disclose.

First Published Online January 16, 2007

Abbreviations: ChIP, Chromatin immunoprecipitation; CK2, casein kinase 2; CLS, cAMP-responsive element-like sequence; hCG, human chorionic gonadotropin; mPKAi, myristoylated PKA inhibitor peptide; NR5A, nuclear receptor 5A family; NRE, nuclear receptor element; PI3-K, phosphatidylinositol-dependent kinase; PKA, protein kinase A; PKB, protein kinase B; PMSG, pregnant mare serum gonadotropin; RNAi, RNA interference; SCRAM, scrambled sequence; SDS, sodium dodecyl sulfate; siRNA, small interfering RNA; StAR, steroidogenic acute regulator; TBP, TATA binding protein.

Received for publication October 26, 2006. Accepted for publication January 11, 2007.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Hinshelwood MM, Smith ME, Murry BA, Mendelson CR 2000 A 278 bp region just upstream of the human CYP19 (aromatase) gene mediates ovary-specific expression in transgenic mice. Endocrinology 141:2050–2053[Abstract/Free Full Text]
  2. Hickey GJ, Krasnow JS, Beattie WG, Richards JS 1990 Aromatase cytochrome P450 in rat ovarian granulosa cells before and after luteinization: adenosine 3',5'-monophosphate-dependent and independent regulation. Cloning and sequencing of rat aromatase cDNA and 5' genomic DNA. Mol Endocrinol 4:3–12[Abstract/Free Full Text]
  3. Fitzpatrick SL, Richards JS 1993 cis-Acting elements of the rat aromatase promoter required for cyclic adenosine 3',5'-monophosphate induction in ovarian granulosa cells and constitutive expression in R2C Leydig cells. Mol Endocrinol 7:341–354[Abstract/Free Full Text]
  4. Fitzpatrick SL, Richards JS 1993 Regulation of the rat aromatase gene in ovarian granulosa cells and R2C Leydig cells. J Steroid Biochem Mol Biol 44:429–433[CrossRef][Medline]
  5. Lynch JP, Lala DS, Peluso JJ, Luo W, Parker KL, White BA 1993 Steroidogenic factor 1, an orphan nuclear receptor, regulates the expression of the rat aromatase gene in gonadal tissues. Mol Endocrinol 7:776–786[Abstract/Free Full Text]
  6. Carlone DL, Richards JS 1997 Functional interactions, phosphorylation, and levels of 3',5'-cyclic adenosine monophosphate-regulatory element binding protein and steroidogenic factor-1 mediate hormone-regulated and constitutive expression of aromatase in gonadal cells. Mol Endocrinol 11:292–304[Abstract/Free Full Text]
  7. Michael MD, Michael LF, Simpson ER 1997 A CRE-like sequence that binds CREB and contributes to cAMP-dependent regulation of the proximal promoter of the human aromatase P450 (CYP19) gene. Mol Cell Endocrinol 134:147–156[CrossRef][Medline]
  8. Hinshelwood MM, Repa JJ, Shelton JM, Richardson JA, Mangelsdorf DJ, Mendelson CR 2003 Expression of LRH-1 and SF-1 in the mouse ovary: localization in different cell types correlates with differing function. Mol Cell Endocrinol 207:39–45[CrossRef][Medline]
  9. Carlone DL, Richards JS 1997 Evidence that functional interactions of CREB and SF-1 mediate hormone regulated expression of the aromatase gene in granulosa cells and constitutive expression in R2C cells. J Steroid Biochem Mol Biol 61:223–231[CrossRef][Medline]
  10. Stocco C 2004 In vivo and in vitro inhibition of cyp19 gene expression by prostaglandin F2a in murine luteal cells: implication of GATA-4. Endocrinology 145:4957–4966[Abstract/Free Full Text]
  11. Jin T, Zhang X, Li H, Goss PE 2000 Characterization of a novel silencer element in the human aromatase gene PII promoter. Breast Cancer Res Treat 62:151–159[CrossRef][Medline]
  12. Tremblay JJ, Viger RS 2001 GATA factors differentially activate multiple gonadal promoters through conserved GATA regulatory elements. Endocrinology 142:977–986[Abstract/Free Full Text]
  13. Arceci RJ, King AA, Simon MC, Orkin SH, Wilson DB 1993 Mouse GATA-4: a retinoic acid-inducible GATA-binding transcription factor expressed in endodermally derived tissues and heart. Mol Cell Biol 13:2235–2246[Abstract/Free Full Text]
  14. Suzuki E, Evans T, Lowry J, Truong L, Bell DW, Testa JR, Walsh K 1996 The human GATA-6 gene: structure, chromosomal location, and regulation of expression by tissue-specific and mitogen-responsive signals. Genomics 38:283–290[CrossRef][Medline]
  15. Anttonen M, Ketola I, Parviainen H, Pusa AK, Heikinheimo M 2003 FOG-2 and GATA-4 are coexpressed in the mouse ovary and can modulate Mullerian-inhibiting substance expression. Biol Reprod 68:1333–1340[Abstract/Free Full Text]
  16. Viger RS, Mertineit C, Trasler JM, Nemer M 1998 Transcription factor GATA-4 is expressed in a sexually dimorphic pattern during mouse gonadal development and is a potent activator of the Mullerian inhibiting substance promoter. Development 125:2665–2675[Abstract]
  17. Lavoie HA, McCoy GL, Blake CA 2004 Expression of the GATA-4 and GATA-6 transcription factors in the fetal rat gonad and in the ovary during postnatal development and pregnancy. Mol Cell Endocrinol 227:31–40[CrossRef][Medline]
  18. Heikinheimo M, Ermolaeva M, Bielinska M, Rahman NA, Narita N, Huhtaniemi IT, Tapanainen JS, Wilson DB 1997 Expression and hormonal regulation of transcription factors GATA-4 and GATA-6 in the mouse ovary. Endocrinology 138:3505–3514[Abstract/Free Full Text]
  19. Gillio-Meina C, Hui YY, LaVoie HA 2003 GATA-4 and GATA-6 transcription factors: expression, immunohistochemical localization, and possible function in the porcine ovary. Biol Reprod 68:412–422[Abstract/Free Full Text]
  20. Vaskivuo TE, Anttonen M, Herva R, Billig H, Dorland M, te Velde ER, Stenback F, Heikinheimo M, Tapanainen JS 2001 Survival of human ovarian follicles from fetal to adult life: apoptosis, apoptosis-related proteins, and transcription factor GATA-4. J Clin Endocrinol Metab 86:3421–3429[Abstract/Free Full Text]
  21. Laitinen MP, Anttonen M, Ketola I, Wilson DB, Ritvos O, Butzow R, Heikinheimo M 2000 Transcription factors GATA-4 and GATA-6 and a GATA family cofactor, FOG-2, are expressed in human ovary and sex cord-derived ovarian tumors. J Clin Endocrinol Metab 85:3476–3483[Abstract/Free Full Text]
  22. Anttonen M, Parviainen H, Kyronlahti A, Bielinska M, Wilson DB, Ritvos O, Heikinheimo M 2006 GATA-4 is a granulosa cell factor employed in inhibin-{alpha} activation by the TGF-ß pathway. J Mol Endocrinol 36:557–568[Abstract/Free Full Text]
  23. Silverman E, Eimerl S, Orly J 1999 CCAAT enhancer-binding protein ß and GATA-4 binding regions within the promoter of the steroidogenic acute regulatory protein (StAR) gene are required for transcription in rat ovarian cells. J Biol Chem 274:17987–17996[Abstract/Free Full Text]
  24. Hiroi H, Christenson LK, Strauss 3rd JF 2004 Regulation of transcription of the steroidogenic acute regulatory protein (StAR) gene: temporal and spatial changes in transcription factor binding and histone modification. Mol Cell Endocrinol 215:119–126[CrossRef][Medline]
  25. Hiroi H, Christenson LK, Chang L, Sammel MD, Berger SL, Strauss 3rd JF 2004 Temporal and spatial changes in transcription factor binding and histone modifications at the steroidogenic acute regulatory protein (stAR) locus associated with stAR transcription. Mol Endocrinol 18:791–806[Abstract/Free Full Text]
  26. Kuo CT, Morrisey EE, Anandappa R, Sigrist K, Lu MM, Parmacek MS, Soudais C, Leiden JM 1997 GATA4 transcription factor is required for ventral morphogenesis and heart tube formation. Genes Dev 11:1048–1060[Abstract/Free Full Text]
  27. Molkentin JD, Lin Q, Duncan SA, Olson EN 1997 Requirement of the transcription factor GATA4 for heart tube formation and ventral morphogenesis. Genes Dev 11:1061–1072[Abstract/Free Full Text]
  28. Fitzpatrick SL, Carlone DL, Robker RL, Richards JS 1997 Expression of aromatase in the ovary: down-regulation of mRNA by the ovulatory luteinizing hormone surge. Steroids 62:197–206[CrossRef][Medline]
  29. LaVoie HA 2003 The role of GATA in mammalian reproduction. Exp Biol Med (Maywood) 228:1282–1290[Abstract/Free Full Text]
  30. Liang Q, Wiese RJ, Bueno OF, Dai YS, Markham BE, Molkentin JD 2001 The transcription factor GATA4 is activated by extracellular signal-regulated kinase 1- and 2-mediated phosphorylation of serine 105 in cardiomyocytes. Mol Cell Biol 21:7460–7469[Abstract/Free Full Text]
  31. Tremblay JJ, Viger RS 2003 Transcription factor GATA-4 is activated by phosphorylation of serine 261 via the cAMP/protein kinase a signaling pathway in gonadal cells. J Biol Chem 278:22128–22135[Abstract/Free Full Text]
  32. Salvador LM, Park Y, Cottom J, Maizels ET, Jones JC, Schillace RV, Carr DW, Cheung P, Allis CD, Jameson JL, Hunzicker-Dunn M 2001 Follicle-stimulating hormone stimulates protein kinase A-mediated histone H3 phosphorylation and acetylation leading to select gene activation in ovarian granulosa cells. J Biol Chem 276:40146–40155[Abstract/Free Full Text]
  33. Gonzalez-Robayna IJ, Falender AE, Ochsner S, Firestone GL, Richards JS 2000 Follicle-Stimulating hormone (FSH) stimulates phosphorylation and activation of protein kinase B (PKB/Akt) and serum and glucocorticoid-lnduced kinase (Sgk): evidence for A kinase-independent signaling by FSH in granulosa cells. Mol Endocrinol 14:1283–1300[Abstract/Free Full Text]
  34. Leung PC, Steele GL 1992 Intracellular signaling in the gonads. Endocr Rev 13:476–498[Abstract/Free Full Text]
  35. Salvador LM, Maizels E, Hales DB, Miyamoto E, Yamamoto H, Hunzicker-Dunn M 2002 Acute signaling by the LH receptor is independent of protein kinase C activation. Endocrinology 143:2986–2994[Abstract/Free Full Text]
  36. Stocco CO, Lau LF, Gibori G 2002 A calcium/calmodulin-dependent activation of ERK1/2 mediates JunD phosphorylation and induction of nur77 and 20a-hsd genes by prostaglandin F2a in ovarian cells. J Biol Chem 277:3293–3302[Abstract/Free Full Text]
  37. Peters CA, Cutler RE, Maizels ET, Robertson MC, Shiu RP, Fields P, Hunzicker-Dunn M 2000 Regulation of PKC {delta} expression by estrogen and rat placental lactogen-1 in luteinized rat ovarian granulosa cells. Mol Cell Endocrinol 162:181–191[CrossRef][Medline]
  38. Tolloczko B, Turkewitsch P, Al-Chalabi M, Martin JG 2004 LY-294002 [2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one] affects calcium signaling in airway smooth muscle cells independently of phosphoinositide 3-kinase inhibition. J Pharmacol Exp Ther 311:787–793[Abstract/Free Full Text]
  39. Davies SP, Reddy H, Caivano M, Cohen P 2000 Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J 351:95–105[CrossRef][Medline]
  40. Vaskivuo TE, Aittomaki K, Anttonen M, Ruokonen A, Herva R, Osawa Y, Heikinheimo M, Huhtaniemi I, Tapanainen JS 2002 Effects of follicle-stimulating hormone (FSH) and human chorionic gonadotropin in individuals with an inactivating mutation of the FSH receptor. Fertil Steril 78:108–113[CrossRef][Medline]
  41. Bouchard MF, Taniguchi H, Viger RS 2005 Protein kinase A-dependent synergism between GATA factors and the nuclear receptor, liver receptor homolog-1, regulates human aromatase (CYP19) PII promoter activity in breast cancer cells. Endocrinology 146:4905–4916[Abstract/Free Full Text]
  42. Martin LJ, Taniguchi H, Robert NM, Simard J, Tremblay JJ, Viger RS 2005 GATA factors and the nuclear receptors, steroidogenic factor 1/liver receptor homolog 1, are key mutual partners in the regulation of the human 3ß-hydroxysteroid dehydrogenase type 2 promoter. Mol Endocrinol 19:2358–2370[Abstract/Free Full Text]
  43. Tremblay JJ, Viger RS 1999 Transcription factor GATA-4 enhances Mullerian inhibiting substance gene transcription through a direct interaction with the nuclear receptor SF-1. Mol Endocrinol 13:1388–1401[Abstract/Free Full Text]
  44. Cottom J, Salvador LM, Maizels ET, Reierstad S, Park Y, Carr DW, Davare MA, Hell JW, Palmer SS, Dent P, Kawakatsu H, Ogata M, Hunzicker-Dunn M 2003 Follicle-stimulating hormone activates extracellular signal-regulated kinase but not extracellular signal-regulated kinase kinase through a 100-kDa phosphotyrosine phosphatase. J Biol Chem 278:7167–7179[Abstract/Free Full Text]
  45. Hunzicker-Dunn M, Maizels ET 2006 FSH signaling pathways in immature granulosa cells that regulate target gene expression: branching out from protein kinase A. Cell Signal 18:1351–1359[CrossRef][Medline]
  46. Dai YS, Markham BE 2001 p300 Functions as a coactivator of transcription factor GATA-4. J Biol Chem 276:37178–37185[Abstract/Free Full Text]
  47. Yanazume T, Hasegawa K, Morimoto T, Kawamura T, Wada H, Matsumori A, Kawase Y, Hirai M, Kita T 2003 Cardiac p300 is involved in myocyte growth with decompensated heart failure. Mol Cell Biol 23:3593–3606[Abstract/Free Full Text]
  48. Huang WC, Chen CC 2005 Akt phosphorylation of p300 at Ser-1834 is essential for its histone acetyltransferase and transcriptional activity. Mol Cell Biol 25:6592–6602[Abstract/Free Full Text]
  49. Chen J, Halappanavar SS, St-Germain JR, Tsang BK, Li Q 2004 Role of Akt/protein kinase B in the activity of transcriptional coactivator p300. Cell Mol Life Sci 61:1675–1683[Medline]
  50. Alam H, Maizels ET, Park Y, Ghaey S, Feiger ZJ, Chandel NS, Hunzicker-Dunn M 2004 Follicle-stimulating hormone activation of hypoxia-inducible factor-1 by the phosphatidylinositol 3-kinase/AKT/Ras homolog enriched in brain (Rheb)/mammalian target of rapamycin (mTOR) pathway is necessary for induction of select protein markers of follicular differentiation. J Biol Chem 279:19431–19440[Abstract/Free Full Text]
  51. Zeleznik AJ, Saxena D, Little-Ihrig L 2003 Protein kinase B is obligatory for follicle-stimulating hormone-induced granulosa cell differentiation. Endocrinology 144:3985–3994[CrossRef][Medline]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
J. A. Hernandez Gifford, M. E. Hunzicker-Dunn, and J. H. Nilson
Conditional Deletion of Beta-Catenin Mediated by Amhr2cre in Mice Causes Female Infertility
Biol Reprod, June 1, 2009; 80(6): 1282 - 1292.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Kyronlahti, M. Ramo, M. Tamminen, L. Unkila-Kallio, R. Butzow, A. Leminen, M. Nemer, N. Rahman, I. Huhtaniemi, M. Heikinheimo, et al.
GATA-4 Regulates Bcl-2 Expression in Ovarian Granulosa Cell Tumors
Endocrinology, November 1, 2008; 149(11): 5635 - 5642.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. S. Viger, S. M. Guittot, M. Anttonen, D. B. Wilson, and M. Heikinheimo
Role of the GATA Family of Transcription Factors in Endocrine Development, Function, and Disease
Mol. Endocrinol., April 1, 2008; 22(4): 781 - 798.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
C. Stocco, J. Kwintkiewicz, and Z. Cai
Identification of regulatory elements in the Cyp19 proximal promoter in rat luteal cells
J. Mol. Endocrinol., October 1, 2007; 39(4): 211 - 221.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kwintkiewicz, J.
Right arrow Articles by Stocco, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kwintkiewicz, J.
Right arrow Articles by Stocco, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals