help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2006-0518
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xian, W.
Right arrow Articles by Rosen, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xian, W.
Right arrow Articles by Rosen, J. M.
Molecular Endocrinology 21 (4): 987-1000
Copyright © 2007 by The Endocrine Society

Distinct Roles of Fibroblast Growth Factor Receptor 1 and 2 in Regulating Cell Survival and Epithelial-Mesenchymal Transition

Wa Xian, Kathryn L. Schwertfeger and Jeffrey M. Rosen

Department of Molecular and Cellular Biology (W.X., J.M.R.), Baylor College of Medicine, Houston, Texas 77030; and Department of Laboratory Medicine and Pathology (K.L.S.), University of Minnesota Cancer Center, Minneapolis, Minnesota 55455

Address all correspondence and requests for reprints to: J. M. Rosen, Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030. E-mail: jrosen{at}faculty.bcm.tmc.edu.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Two related receptor tyrosine kinases (RTKs), fibroblast growth factor receptor 1 and 2 (FGFR1 and FGFR2), exert distinct effects during carcinogenesis. To examine FGFR1 and FGFR2 signaling in polarized epithelia, we have developed an in vitro three-dimensional HC11 mouse mammary epithelial cell culture model combined with a chemically inducible FGFR (iFGFR) dimerization system. Although activation of both RTKs led to reinitiation of cell proliferation and loss of cell polarity, only iFGFR1 activation induced cell survival and epithelial to mesenchymal transition. In contrast, iFGFR2 activation induced cell apoptosis even in the cells in direct contact with the extracellular matrix. Activation of iFGFR2, but not iFGFR1, led to rapid receptor down-regulation and transient activation of downstream signaling, which were partially rescued by Cbl small interfering RNA knockdown or the proteasome inhibitor lactacystin. Importantly, inhibition of proteasome activity in iFGFR2-activated structures led to epithelial to mesenchymal transition and invasive phenotypes resembling those observed after iFGFR1 activation. These studies demonstrate, for the first time, that the duration of downstream signaling determines the distinct phenotypes mediated by very homologous RTKs in three-dimensional cultures.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
FIBROBLAST GROWTH FACTORS (FGFs) and their receptors (FGFRs) have been implicated in playing pleiotropic roles in multiple biological activities, including cell proliferation, survival, apoptosis, differentiation, and migration. In vivo, FGFs and FGFRs are crucial for development and angiogenesis, and inappropriate expression of FGFs has been linked to murine mammary tumorigenesis. Altered expression of FGFRs by genomic amplification has been found in subsets of human breast cancer, but their causative role in breast disease remains obscure and controversial (1).

The FGF family is composed of a large number of ligands that signal through a class of cell-surface receptor tyrosine kinases (RTKs) (1). In mammals, there are 22 FGF family members and four FGF receptor genes, FGFR1–FGFR4. The structure and ligand binding properties of FGFRs are modulated by alternative splicing (2, 3). Binding of FGF ligand to FGFRs induces receptor activation by dimerization, thus generating a complex array of combinatorial signals (3). Negative feedback mechanisms for receptor signaling include down-regulation through internalization and induction of proteins such as Sprouty and Sef that inhibit the receptor signaling pathways (4, 5, 6, 7). The ubiquitin ligase Cbl plays an important role in down-regulation of FGFRs. Cbl negatively regulates these molecules by mediating ubiquitination, which results in proteasome-mediated degradation after ligand binding (8, 9, 10).

Despite the activation of a similar spectrum of downstream pathways, the consequences of activation of different FGFRs are often quite distinct. For example, studies of prostate cancer have demonstrated that FGFR1 and FGFR2 play distinct roles in cell growth and differentiation as well as in development and support of malignant phenotypes. Evidence to date strongly supports the hypothesis that FGFR1 can promote prostate cancer progression, whereas FGFR2 either inhibits or does not promote prostate cancer initiation and progression (11, 12, 13). Although inappropriate FGF signaling has been linked to breast cancer development, it is not clear whether FGFR1 and FGFR2 also play different roles during breast cancer formation and progression. Studying the underlying differences in signal transduction between FGFR1 and FGFR2 may help elucidate the biological activities of these two related receptors in breast cancer.

The diversity and complexity of FGF ligand and receptor interactions complicate the analysis of the specific contributions of each receptor to oncogenic transformation (14). We have previously described a ligand-independent and drug-inducible system that allows the specific activation of FGFR1 and FGFR2 (iFGFR1 and iFGFR2) to study downstream signaling (15, 16). Three-dimensional (3D) culture systems, which allow epithelial cells to organize into structures that resemble their in vivo architecture, represent a unique model in which to examine the consequences of activation of different RTKs in a biologically relevant context (17). Thus, we combined the well-defined inducible ligand-independent dimerization strategy and our previously described HC11 3D culture model to compare and contrast FGFR1 and FGFR2 signaling in a context that mimics mammary epithelium in vivo.

We have shown previously that dimerization of iFGFR1 exerts pleiotropic effects on cell proliferation, survival, and migration in HC11 3D cultures (16). Here, we demonstrate that activation of both iFGFR1 and iFGFR2 resulted in the disruption of cell polarity and promoted cell proliferation. However, these receptors exhibited marked differences in their regulation of apoptosis and epithelial to mesenchymal transition (EMT). Although iFGFR1 activation promoted cell survival and EMT, iFGFR2 activation induced cell apoptosis and failed to promote EMT. Furthermore, activation of iFGFR2, but not iFGFR1, resulted in rapid down-regulation of the receptor, which was blocked by the addition of the 26S proteasome inhibitor lactacystin. Importantly, inhibition of this negative feedback mechanism led to EMT and invasive phenotypes in iFGFR2-activated structures. Compared with iFGFR2 activation, iFGFR1 activation resulted in more sustained ERK activation, and the duration of ERK activity in iFGFR2-activated cells was prolonged when Cbl expression was decreased by small interfering RNA (siRNA) knockdown. These studies demonstrate, for the first time, that signal transduction by two related RTKs, FGFR1 and FGFR2, is differentially attenuated by a negative signaling pathway involving proteasome-mediated degradation. The differential down-regulation of iFGFR1 and iFGFR2 subsequently may selectively regulate downstream signaling, at least in part, by controlling the duration of ERK activation. Taken together, our results suggest that FGFR1 and FGFR2 markedly differ in their ability to induce phenotypic changes characteristic of the early stages of mammary carcinogenesis in HC11 3D cultures. These are the first studies to directly compare the effects of FGFR1 and FGFR2 signaling in a 3D epithelial cell model.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
iFGFR1 and iFGFR2 Activation Leads to Distinct Phenotypes in Primary 3D Cultures
Transgenic mice expressing iFGFR1 and iFGFR2 under the control of the mouse mammary tumor virus (MMTV) long-terminal repeat have been generated and characterized previously in our laboratory (15). Although this transgenic mouse model has been important for elucidating certain aspects of early breast cancer progression, particularly those involving the microenvironment (18), the complexity of the in vivo environment makes it difficult to delineate the molecular mechanisms involved in the early stages of oncogenesis. Thus, we analyzed the molecular mechanisms of iFGFR1 and iFGFR2 signaling in 3D cultures of primary mammary epithelial cells (MECs) isolated from 8-wk-old iFGFR1 and iFGFR2 transgenic mice. We generated 3D acinar-like structures by plating single primary MECs on growth factor-reduced Matrigel as described previously (19). The cells were then allowed to grow for 10 d, during which time they established growth-arrested structures consisting of a single layer of polarized epithelial cells surrounding a hollow lumen (data not shown and Ref. 20). When grown on this laminin-rich matrix in the absence of AP20187, primary MECs isolated from iFGFR1 and iFGFR2 transgenic mice displayed the same growth and morphogenesis properties as primary MECs from wild-type FVB mice (data not shown). The growth-arrested acinar-like structures were then treated with AP20187 for 10 d to induce activation of either iFGFR1 or iFGFR2 and the morphologies of the resulting structures were analyzed. As shown in Fig. 1AGo, compared with untreated structures, activation of iFGFR1 resulted in significantly larger structures, whereas activation of iFGFR2 only slightly increased the size of the structures.


Figure 1
View larger version (70K):
[in this window]
[in a new window]

  		Fig. 1. iFGFR1 and iFGFR2 Activation Results in Different Phenotypes in Primary 3D Cultures

Primary MECs from iFGFR1 and iFGFR2 transgenic mice were plated on Matrigel for 10 d and then treated with AP20187 (R1-T, R2-T) or without AP20187 for 10 d. iFGFR1 and iFGFR2 structures displayed similar phenotypes without AP20187 treatment, so only untreated iFGFR1 structures (UT) are shown. A, Bright-field images are shown. Approximately 80 structures of each group from three independent experiments were examined and approximately 75% of them displayed similar phenotypes. Bars, 50 µm. B–D, Representative confocal images of the structures immunostained with antiserum to p-histone H3 (green) (B) cleaved caspase-3 (green) (C) and p-Akt (Ser 473) (green) (D) are shown. TOPRO-3 (blue) labeled the nuclei. Bars, 25 µm. For each antibody staining, approximately 60 structures from three independent experiments were examined and approximately 80% of them displayed similar phenotypes.

 
To further analyze the changes in morphology induced by iFGFR1 and iFGFR2, d 10 iFGFR1 and iFGFR2 structures were stimulated with AP20187 for 10 d and effects on cell proliferation and survival were investigated using confocal analysis after immunostaining with anti-p-histone H3 and cleaved caspase-3, respectively. In the absence of AP20187, both iFGFR1 and iFGFR2 structures rarely displayed positive p-histone H3 staining. In the presence of AP20187, proliferation was reinitiated in both treated iFGFR1 and iFGFR2 structures, as indicated by increased staining of p-histone H3 (Fig. 1BGo). Although only approximately 1 ± 0.1% of cells in the untreated structures were p-histone H3 positive, 5.5 ± 0.4% of cells in 10 d-treated iFGFR1 or iFGFR2 structures were undergoing mitosis. Although activation of iFGFR1 and iFGFR2 both induced an increase in proliferation, the effects of iFGFR1 and iFGFR2 activation on cell survival were strikingly different. In the untreated structures, apoptosis was restricted to the luminal cells that lack contact with the basement membrane in the developing acini (data not shown), resulting in the formation of a hollow lumen at d 10 (Fig. 1CGo). In the presence of AP20187, cleaved caspase-3 staining was rarely detected in the iFGFR1 structures despite the presence of cells within the lumen (Fig. 1CGo), suggesting that iFGFR1 activation can prevent these cells from undergoing apoptosis. Interestingly, in the treated iFGFR2 structures, apoptosis was detected in both luminal and peripheral cells that were in direct contact with matrix. In addition, the polarity marker staining (data not shown) demonstrated that both iFGFR1 and iFGFR2 activation disrupted cell polarity.

To further analyze the ability of iFGFR1 and iFGFR2 to induce downstream signaling pathways, phosphorylation of Akt was assessed after iFGFR1 and iFGFR2 activation by immunostaining with a phospho-specific Akt antibody that recognizes an activation-specific phosphorylation site (anti-p-Akt Ser 473; Fig. 1DGo). Although the treated iFGFR1 structures displayed significantly increased levels of phosphorylated Akt in both the luminal and the outer layer cells, the untreated structures and the treated iFGFR2 structures exhibited very low levels of Akt activation. Collectively, these data suggest that iFGFR1 and iFGFR2 activation differentially regulates the induction of downstream signaling molecules such as Akt.

Previous studies have demonstrated that the iFGFR1 and iFGFR2 transgenes are expressed in a mosaic pattern in the luminal epithelium (data not shown and Ref. 15), which is typical of transgenes driven by the MMTV promoter. Because of this variable penetrance, further mechanistic analyses of the downstream signaling pathways activated by iFGFR1 and iFGFR2 were performed using a well-characterized HC11 3D culture model.

iFGFR1 and iFGFR2 Activation Differentially Affects HC11 Acinar Morphology
To compare FGFR1 and FGFR2 signaling in HC11 3D cultures, HC11 stable cell lines were generated to express similar levels of iFGFR2 as the previously established iFGFR1 cells (Fig. 2AGo and Ref. 16). Immunoprecipitation with an anti-p-Y antibody followed by immunoblotting with an anti-HA antibody revealed that AP20187 induced similar levels of iFGFR1 and iFGFR2 activation (Fig. 2BGo). To evaluate the effects of iFGFR2 activation in HC11 acinar-like structures, single cells were seeded on the matrix and allowed to grow for 10 d to form acinar-like structures. After 10 d, AP20187 was added to the medium for 5 d and the morphological changes in the resulting structures were analyzed. Activation of iFGFR2 resulted in a relatively small increase in size, as compared with treated iFGFR1 structures. Additionally, in the presence or absence of AP20187, iFGFR2 structures did not display any invasive phenotype as has been previously described for iFGFR1 activation (Fig. 2CGo and Ref. 16).


Figure 2
View larger version (37K):
[in this window]
[in a new window]

  		Fig. 2. iFGFR2 Activation Disrupts Cell Polarity and Induces Both Proliferation and Apoptosis in HC11 3D Cultures

A, Two stable clones of HC11 cells expressing comparable levels of iFGFR1 and iFGFR2 (R1 and R2) were examined by immunoblotting with anti-HA epitope antibody. B, Equal activation of iFGFR1 and iFGFR2 was observed after immunoprecipitation with anti-p-Y antibody followed by Western blotting with an anti-HA antibody. C, Ten-day-old iFGFR1 and iFGFR2 structures were treated with or without AP20187 (R1-T and R2-T) for 5 d. Approximately 60 structures from three independent experiments were examined and approximately 80% of them displayed similar phenotypes. Bars, 50 µm. D, Day 10 iFGFR2 structures were treated with (R2-T) or without (UT) AP20187 for 5 d. Representative confocal images of structures immunostained with antibodies against p-ERM (G, green), {alpha}6-integrin (R, red), and p-histone H3 (green), or cleaved caspase 3 (green) are shown. TOPRO-3 stained the nuclei (blue). Bars, 25 µm. For each antibody staining, approximately 70 structures from three independent experiments were examined and approximately 85% of them displayed the similar phenotypes. E, Quantitation of cleaved caspase-3 staining of untreated (UT) and 5-d-treated (R2-T) structures. The total number of structures and the number of structures staining positive for cleaved caspase-3 in the outer layer cells was counted in 74 untreated structures and 76 5-d-treated structures. Using these numbers, the percentage of the structures with or without cleaved caspase-3 positive at the outer layer cells was calculated. The mean and SEM from three independent experiments are shown.

 
To further characterize the effects of iFGFR2 activation, iFGFR2 structures were immunostained with markers for cell polarity, proliferation, and apoptosis. To determine whether iFGFR2 activation was able to disrupt cell polarity, immunostaining was performed on iFGFR2 structures with antibodies directed against the polarity markers {alpha}6-integrin and p-ERM. Disruption of basolateral localization of {alpha}6-integrin and apical localization of p-ERM suggested that iFGFR2 activation resulted in loss of cell polarity, similar to what had been observed previously for iFGFR1 activation (Fig. 2DGo).

To examine whether iFGFR2 activation could affect cell proliferation and cell survival in HC11 3D cultures, iFGFR2 structures were immunostained with anti-p-histone H3 antibody to detect mitotic cells and anti-cleaved caspase 3 antibody to detect apoptosis (Fig. 2DGo). In comparison with the untreated structures, after 5 d of treatment, an approximately 3- to 4-fold increase in proliferation compared with untreated structures was observed (data not shown), similar to iFGFR1 activation for 5 d. These data suggest that both iFGFR1 and iFGFR2 are able to promote cell proliferation in HC11 3D cultures. Interestingly, in contrast to iFGFR1 activation, iFGFR2 activation failed to prevent luminal cells from undergoing apoptosis and instead induced apoptosis in the outer layer cells that were in direct contact with matrix similar to what was observed in primary MECS (Fig. 1CGo). Although cell apoptosis was rarely observed in both luminal and outer layer of cells of treated iFGFR1 structures, approximately 90 ± 3% of total treated iFGFR2 structures, in comparison with less than 20 ± 2% of untreated iFGFR2 structures, contained cells in the outer layer that were undergoing apoptosis (Fig. 2EGo). In addition, immunostaining with an anti-p-Akt antibody revealed that, although the treated iFGFR1 structures displayed significantly increased levels of phosphorylated Akt in both the luminal and the outer cell layer, both the untreated structures and the treated iFGFR2 structures exhibited very low levels of Akt activation similar to the phenotypes observed in primary MECS (supplemental Fig. 1A, published on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org, and Fig. 1DGo).

iFGFR1 activation in HC11 3D cultures has previously been shown to result in EMT (16). In contrast, iFGFR2 activation did not promote EMT, as characterized by the loss of E-cadherin at cell-cell junctions and expression of mesenchymal markers such as smooth muscle actin (SMA) (see Fig. 5Go, D and E). Taken together, these observations indicate that activation of iFGFR1 and iFGFR2 differentially regulates cell survival in HC11 3D cultures, which is consistent with what was observed previously in primary 3D cultures. In addition, these two RTKs also play different roles in regulating EMT in HC11 3D cultures.


Figure 5
View larger version (80K):
[in this window]
[in a new window]

  		Fig. 5. iFGFR2-Induced Phenotypes Are Dependent upon Proteasome Activity

Ten-day-old iFGFR1 and iFGFR2 structures were either not treated or treated with AP20187 in the absence of lactacystin (R1-T, R2-T) or in the presence of lactacystin (R2-T-LA), for 5 d. Bars, 25 µm. For each group, approximately 65 structures from three independent experiments were examined and approximately 75% of them displayed similar phenotypes. B–E, Representative confocal images of the structures stained with an anti-HA antibody (red) (B), an anti-p-FAK antibody (green) (C), an anti-E-cadherin antibody (red) (D), and an anti-SMA antibody (red) (E). TOPRO-3 (blue) marked the nuclei. Bars, 25 µm. For each antibody, approximately 60 structures from three independent experiments were examined and approximately 70% of them displayed similar phenotypes.

 
iFGFR1 and iFGFR2 Differ in Duration of Activation of ERK
The stimulation of iFGFR1 has been shown previously to result in sustained activation of ERK (16). It has been suggested that the duration and magnitude of ERK activity is a critical factor specifying cellular responses such as proliferation, differentiation, or apoptosis (21, 22). To examine whether dimerization of iFGFR1 and iFGFR2 differentially regulates ERK activation, iFGFR1 and iFGFR2 cells in two-dimensional (2D) cultures were stimulated with AP20187 for various periods of time and ERK1/2 phosphorylation was assessed by immunoblot analysis. As shown in Fig. 3Go, immunoblotting for phosphorylated ERK1/2 revealed that both iFGFR1 and iFGFR2 activation resulted in a rapid increase in phosphorylation of ERK after 5 min of AP20187 treatment. Analysis of longer-term treatment revealed that iFGFR1 activation induced sustained phosphorylation of ERK over the 24-h period; however, ERK phosphorylation decreased after 5 min of iFGFR2 activation and became undetectable after 2 h of iFGFR2 activation (Fig. 3Go). The time required for the rapid recovery of cells from 3D cultures precluded their use for the immunoblotting experiments in which we examined the rapid changes of ERK phosphorylation after FGFR activation. We, therefore, performed these early time-course experiments in 2D cultures. However, immunostaining performed with a p-ERK antibody in 3D cultures supported the observation made in 2D cultures that iFGFR1, but not iFGFR2, activation leads to sustained ERK phosphorylation over a 24-h period (supplemental Fig. 1B).


Figure 3
View larger version (48K):
[in this window]
[in a new window]

  		Fig. 3. iFGFR1 and iFGFR2 Activation Results in Differential Duration of ERK Activity

Both short-term (A) and long-term (B) time courses of ERK activation after iFGFR1 and iFGFR2 induction are depicted. Immunoblotting with an anti-p-ERK antibody or with total ERK used as a control for equal protein loading is shown. The Western blot shown here is the representative image of three independent experiments.

 
These results demonstrate that iFGFR1 and iFGFR2 can induce differences in the duration of ERK signaling, which may be involved in mediating distinct signaling effects and phenotypes.

Activation of iFGFR2, But Not iFGFR1, Results in Rapid Internalization of the Receptor
One mechanism commonly employed to attenuate signaling after RTK activation is receptor down-regulation mediated by internalization and subsequent degradation (23). Therefore, the transient induction of ERK activity upon iFGFR2 activation may have been caused by rapid receptor internalization after dimerization. To test this possibility, iFGFR1 and iFGFR2 cells in 2D cultures were stimulated with AP20187, and the cells were then immunostained with an antibody to the hemagglutinin (HA) epitope tag over a time course of activation. In untreated cells, cell surface staining of HA-tagged iFGFR1 and iFGFR2 receptors was detected (Fig. 4Go, A and B). Although iFGFR1 activation resulted in increased HA staining at the cell surface, beginning at 2 h (Fig. 4Go, A and B), soon after iFGFR2 dimerization, punctate intracellular HA staining was observed (Fig. 4Go, A and B). Moreover, intracellular iFGFR2 receptor was colocalized with an early endosomal marker, EEA1, in iFGFR2-activated cells (Fig. 4CGo). Thus, activation of iFGFR2, but not iFGFR1, induced rapid endocytosis of surface receptors in HC11 cells. Additionally, we performed immunoblot analysis with anti-HA antibody to examine the stability of iFGFR1 and iFGFR2 after dimerizer treatment. As shown in Fig. 4DGo, rapid receptor down-regulation was detected after iFGFR2 activation, but not after iFGFR1 activation. Collectively, these results suggest that the difference in the duration of ERK activation mediated by iFGFR1 and iFGFR2 activation might be due to differential receptor down-regulation.


Figure 4
View larger version (49K):
[in this window]
[in a new window]

  		Fig. 4. iFGFR2 Activation, But Not iFGFR1 Activation, Results in Rapid Endocytosis and Down-Regulation of HA-Tagged Receptor

HC11 cells expressing iFGFR1 or iFGFR2 were cultured in 2D cultures and treated with AP20187 (R1-T, R2-T) or without AP20187 (UT) for 2 h. iFGFR1- and iFGFR2-expressing cells displayed the same immunostaining pattern of HA antibody without AP20187 treatment, so only representative images of untreated iFGFR2-expressing cells were shown here. A, Representative confocal images of cells immunostained with an anti-HA antibody (red). B, Representative deconvolution images of the cells stained with an anti-HA antibody (red). The arrow denotes the punctate HA staining in treated iFGFR2 cells. C, Representative deconvolution images of cells stained with anti-HA (red) and anti-EEA1 (green) antibodies. The arrow denotes examples of the HA-tagged receptor and EEA1 colocalized in early endosomes. TOPRO-3 (blue) marked the nuclei. Bars, 2 µm. D, Lysates from iFGFR1 and iFGFR2 cells treated with AP20187 at various times were immunoblotted with an anti-HA antibody. The membrane was reprobed with an anti-ß-actin antibody as a control for equal protein loading. The Western blot shown here is the representative image of two independent experiments.

 
Proteasome Activity Is Required for iFGFR2-Induced Phenotypes in HC11 3D Cultures
Activated RTKs can be negatively regulated by proteasome-mediated degradation (24, 25). Based on the observations of rapid endocytosis and down-regulation of iFGFR2 receptor after dimerization (Fig. 4Go), it is possible that iFGFR2 receptor was rapidly degraded in proteasomes after activation. To examine this possibility, studies were performed using lactacystin, a ubiquitin-dependent proteasome inhibitor, to assess whether proteasome-mediated degradation was required for the observed iFGFR2-mediated phenotypes in HC11 3D cultures. After allowing the structures to form for 10 d in culture, iFGFR2 structures were treated with AP20187 in the presence or absence of lactacystin for 4 d. The structures were then analyzed for changes in their invasiveness and size compared with iFGFR1 structures treated with AP20187. In the AP20187-treated iFGFR2 structures, invasion of cells into the matrix and significantly increased size were observed when they were treated in the presence of lactacystin (Fig. 5AGo). Immunostaining revealed that the HA-tagged FGFRs were maintained at the cell membrane in the AP20187/lactaystin-treated iFGFR2 structures and AP20187-treated iFGFR1 structures, but not in AP20187-treated iFGFR2 structures (Fig. 5BGo).

Because iFGFR1 and iFGFR2 differentially regulated cell survival and invasion, we reasoned that they may differentially regulate the activity of focal adhesion kinase (FAK), which is a major downstream signaling molecule of integrin receptors that plays a key role in mediating cell migration and matrix survival signals (26, 27, 28). Although no significant difference in the level of total FAK protein was detected in the untreated and treated iFGFR1 and iFGFR2 cells (supplemental Fig. 2D), a dramatic difference in FAK phosphorylation was observed both in 2D and 3D cultures (supplemental Fig. 2, B and C, and Fig. 5CGo). The untreated HC11 3D cultures exhibited a low level of p-FAK staining that was localized in the basal-lateral region of the outer layer of cells. As expected, iFGFR1 activation resulted in a significant increase of FAK tyrosine phosphorylation at residue 861. In addition, the basal-lateral localization of p-FAK was also disrupted in the treated iFGFR1 structures and p-FAK was detected around the entire periphery of the cells in both the luminal and outer layer of cells. In contrast, as compared with untreated structures, FAK phosphorylation was dramatically reduced after iFGFR2 activation even in the cells that were in direct contact with matrix. Importantly, in the presence of AP20187 and lactacystin, iFGFR2 structures displayed significantly increased FAK phosphorylation at Y861 approximating the levels observed in AP20187-treated iFGFR1 structures (Fig. 5CGo).

To determine whether AP20187/lacatacystin-treated iFGFR2 structures displayed the EMT phenotype that was previously observed in AP20187-treated iFGFR1 3D cultures, but not in AP20187-treated iFGFR2 3D cultures, immunostaining was performed using antibodies to both E-cadherin and SMA. E-Cadherin was maintained at the cell-cell junctions in the AP20187-treated iFGFR2 cultures, but not in the AP20187/lactacystin-treated cultures (Fig. 5DGo). Furthermore, inhibition of proteasome activity induced SMA expression in treated iFGFR2 structures (Fig. 5EGo). Collectively, these data suggest that the different phenotypes mediated by iFGFR1 and iFGFR2 signaling in HC11 3D cultures are predominantly controlled by proteasome-mediated degradation of activated receptors.

Cbl Is Essential for Desensitization of iFGFR2 Signaling
The docking protein FRS2 (FGF receptor substrate 2) recruits a multicomponent protein complex, including both positive and negative regulators, and plays a critical role in mediating FGF signal transduction. FGFR activation has been shown to result in tyrosine phosphorylation of FRS2, which then recruits c-Cbl to mediate ubiquitination and degradation of FGFR (29).

To test whether iFGFR1 and iFGFR2 activation differentially regulated recruitment of c-Cbl to FRS2, iFGFR1 and iFGFR2 cells in 2D cultures were stimulated with AP20187 for various periods of time and the lysates were subjected to immunoprecipitation with an anti-FRS2 antibody followed by immunoblotting with an anti-c-Cbl antibody. As shown in Fig. 6AGo and supplemental Fig. 3A, there was a rapid increase in c-Cbl association with FRS2 after iFGFR2 activation, but not after iFGFR1 activation. Next, the phosphorylation of FRS2 was examined after iFGFR1 and iFGFR2 dimerization. Immunoblot analysis of total cell lysates using an antibody that detected FRS2 only when phosphorylated at Y436 revealed a different pattern of FRS2 phosphorylation after iFGFR1 and iFGFR2 activation (Fig. 6BGo), which indicated that FRS2 protein might be differentially phosphorylated at other sites. This may contribute to the differential recruitment of c-Cbl.


Figure 6
View larger version (63K):
[in this window]
[in a new window]

  		Fig. 6. Suppression of Cbl Expression Results in Sustained ERK Phosphorylation after iFGFR2 Activation

A, Lysates from iFGFR1 and iFGFR2 cells treated with AP20187 at various time points were immunoprecipitated with an anti-FRS2 antibody and immunoblot analysis was performed with an anti-c-Cbl antibody. The membrane was reprobed with anti-FRS2 antibody as a control to show equivalent amounts of FRS2 were immunoprecipitated (data not shown). B, Lysates from iFGFR1 and iFGFR2 cells treated with AP20187 at various time points were immunoblotted with an anti-p-FRS2 antibody. The membrane was reprobed with an anti-FRS2 antibody as a control for equal protein loading (data not shown). C, Lysates from iFGFR2 cells and iFGFR2 cells transfected with Cbl siRNA were immunoblotted with both anti-c-Cbl and anti-Cbl-b antibodies. ERK is shown as a control for equal protein loading. D, A time course of ERK activation after iFGFR2 induction in the absence (R2) or in the presence of Cbl siRNA (R2-Cbl) examined by immunoblotting with anti-p-ERK antibody. Total ERK is shown as a control for equal protein loading. Each immunoblot shown here is the representative Western blot of two or three independent experiments. E, Quantitation of HA-tagged receptor punctate staining of untreated iFGFR2 cells (UT), AP20187-treated iFGFR1 cells (R1-T), AP20187-treated iFGFR2 cells (R2-T), and AP20187-treated Cbl siRNA-transfected iFGFR2 cells (R2-Cbl-T).

 
To further characterize the role of Cbl in mediating receptor down-regulation and the attenuation of signaling upon iFGFR2 activation, experiments were performed to determine whether inhibition of Cbl expression affected receptor internalization and the duration of ERK activation after iFGFR2 activation. The Cbl family of proteins consists of three homologs known as c-Cbl, Cbl-b, and Cbl-3. Because both c-Cbl and Cbl-b have been implicated in mediating RTK down-regulation (30), predesigned Cbl siRNA pools of three siRNA duplexes were used to target both c-Cbl and Cbl-b. After siRNA transfection, a significant reduction in both c-Cbl and Cbl-b was detected by immunoblotting with anti-c-Cbl and anti-Cbl-b antibodies (Fig. 6CGo). A dramatic decrease in the percentage of cells showing punctate staining of HA-tagged receptors was observed in AP20187-treated Cbl siRNA transfected iFGFR2 cells as compared with AP20187-treated iFGFR2 cells (Fig. 6EGo). Interestingly, the punctate HA staining observed after 2 h of treatment was prevented by lactacystin addition in 2D culture (data not shown). This most likely indicates that lactacystin inhibits iFGFR2-induced receptor degradation mediated by the proteasome, but not internalization and localization to the early endosome. Furthermore, as shown in Fig. 6DGo, immunoblotting for phosphorylated ERK1/2 revealed that ERK activation was prolonged in AP20187-treated Cbl siRNA-transfected, but not RNA-induced silencing complex-free siRNA (siGLO; Dharmacon, Lafayette, CO)-transfected iFGFR2 cells. However, further analysis suggested that ERK activity was not sustained to 24 h after AP20187 treatment (supplemental Fig. 3B), in contrast to iFGFR1 activation, which was shown previously to result in sustained ERK activity until at least 72 h after AP20187 stimulation (16). Interestingly, ERK activity was also partially restored in AP20187-treated iFGFR2 cells in the presence of lactacystin in both 2D and 3D cultures (supplemental Fig. 3, B and C). Thus, the partial restoration of the duration of ERK activation suggests that additional mechanisms, in addition to Cbl-induced ubiquitination, may play a role in the control of attenuation of iFGFR2-induced signaling.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
Despite the high homology in amino acid sequences of FGFR1 and FGFR2, especially in the kinase domains, studies in prostate as well as other carcinogenesis models have suggested that FGFR1 and FGFR2 may play distinct roles in development and propagation of the malignant phenotype (31). However, the underlying differences in signal transduction between FGFR1 and FGFR2 still remain unknown. The lack of specific FGF ligand to FGFR1 and differential expression level of FGFR1 and FGFR2 in the cells make it difficult to compare the downstream signaling of these two RTKs. Thus, we employed the ligand-independent, drug-inducible system, which allowed us to examine FGFR1 and FGFR2 signaling when they were expressed and activated at the same level, and analyzed the differential effects of activating iFGFR1 and iFGFR2 receptors in 3D cultures of HC11 mouse mammary epithelial cells to mimic the conditions under which they are activated in vivo. Our studies provide evidence that although iFGFR1 and iFGFR2 activation exhibits some similarities, they also elicit different cellular responses and result in dramatically distinct phenotypes in cell survival and EMT in HC11 mammary epithelial 3D cultures.

The role of FGF signaling in regulating apoptosis remains controversial and appears to depend on the cell type. For example, even though FGF2 has been considered as a transforming factor, mitogen, and survival factor in fibroblasts, endothelial cells and various other types of cells (32, 33), it can indeed inhibit growth and induce differentiation and apoptosis in some cell lines, including some human breast cancer cell lines (34, 35, 36, 37). These distinct responses are probably mediated by specific FGFR isoforms that are expressed in these cells. Indeed, our data suggest that FGFR1 and FGFR2 differentially regulate cell apoptosis. Thus, although iFGFR1 activation induced cell survival, iFGFR2 activation promoted cell apoptosis even in the outer layer of cells that directly contacted the basement membrane in both primary MEC and HC11 3D cultures. These cells are normally protected from apoptosis due to survival signaling from the extracellular matrix mediated by integrin receptors, such as ß1-integrin (38). Interestingly, we observed a significant down-regulation of ß1-integrin expression after iFGFR2 activation (supplemental Fig. 2A), which correlated with the increased apoptosis and lack of cell invasion. In contrast, iFGFR1 activation resulted in a dramatic increase of ß1-integrin expression (supplemental Fig. 2A). Thus, these observations suggest that FGFR signaling may coordinate with ß1-integrin to regulate cell survival by modulating its expression. This observation supports other reports, which have suggested that growth factor receptors can crosstalk with integrin receptors by regulating their expression (39). Moreover, differences in ß1-integrin expression correlated with distinct FAK activity after iFGFR1 and iFGFR2 activation. Further studies have demonstrated that the presence of UO126, which selectively inhibited the activity of ERK, a major downstream signaling molecule of FGFR, abolished iFGFR1-induced morphological changes in HC11 3D cultures (supplemental Fig. 4, A and B). Interestingly, iFGFR1-induced FAK phosphorylation was also diminished when ERK activity was inhibited (supplemental Fig. 4C). Thus, ERK activity is required for iFGFR1-induced phenotypic changes in HC11 3D cultures. In this study we have explored the signaling differences between FGFR1 and FGFR2 that underlie these phenotypic differences in HC11 3D cultures. At the qualitative level, activation of iFGFR1 and iFGFR2 induces a number of similar signal transduction pathways. However, comparison of the kinetics of activation of these pathways by iFGFR1 and iFGFR2 identifies notable quantitative differences. For instance, iFGFR1 activation results in sustained ERK activation, whereas iFGFR2 produces only a short-lived increase in ERK activation.

In several different systems, the difference between sustained and transient ERK activation has been shown to mediate differential signaling effects (40). For example, classic experiments in PC12 cells suggested that activation of the ERK cascade by different RTKs, such as epidermal growth factor (EGF) and nerve growth factor, can lead to contrasting physiological responses, such as proliferation or differentiation, which is determined by the duration of the signal (22). There are potentially many different ways for receptors to regulate transient vs. sustained ERK activation, including the rate of receptor internalization. For example, the EGF receptor, which induces transient ERK activation, is down-regulated more rapidly than the nerve growth factor receptor, which stimulates sustained ERK activation, through internalization and subsequent degradation (41). Interestingly, our results demonstrate that iFGFR2 is also more rapidly internalized and down-regulated than iFGFR1 after activation. In addition, inhibition of proteasome activity in iFGFR2-expressed HC11 cells inhibits receptor down-regulation, prolongs ERK activation, and induces EMT similar to that observed by iFGFR1. Therefore, differential down-regulation of receptors, involving dimerization-induced endocytosis of the RTKs and subsequent proteasome-mediated degradation, provides one mechanism that controls different signaling upon iFGFR1 and iFGFR2 activation.

Members of the Cbl family of proteins are involved in providing an initial line of defense to ensure that signaling responses proceed at the desired intensity and duration when RTKs are first activated (30). Different tyrosine phosphorylation sites and secondary structures of the kinase domains of FGFR1 and FGFR2 may result in differential phosphorylation of downstream signaling molecules, such as FRS2. This may contribute to the differential ability of iFGFR1 and iFGFR2 to recruit Cbl after activation, which may in part be responsible for the phenotypic differences observed in these studies. In support of this hypothesis, the introduction of Cbl siRNA into iFGFR2-expressing cells inhibited receptor internalization and prolonged ERK activation. These results demonstrate an important role for Cbl in regulating iFGFR2-mediated signaling.

Taken together, our results suggest that an important determinant of the specificity of iFGFR1 and iFGFR2 action is the duration of downstream signaling. Increased RTK signaling in cancer can be caused by gene amplification, mutations that promote ligand-independent autophosphorylation, or the failure of RTKs to be appropriately deactivated (42). Impaired deactivation of these RTKs has been linked with increased oncogenic activity (23). Thus, iFGFR1-induced neoplastic growth in HC11 3D cultures may be caused by both increased activation of signaling pathways and defective receptor down-regulation. On the contrary, activation of iFGFR2 can result in similar levels of activation of downstream signaling as iFGFR1 activation over a short time, then the rapid recruitment of Cbl leads to receptor internalization and shuts down downstream signaling, such as ERK. Studies in PC12 cells suggest that sustained ERK activation is associated with translocation of ERKs to the nucleus, whereas transient activation does not lead to nuclear translocation (22, 42, 43, 44). Therefore, we hypothesize that transient activation by iFGFR2 activation will have very different consequences for gene expression compared with sustained activation by iFGFR1 activation because nuclear accumulation of active ERK may result in phosphorylation of transcription factors. In this way, quantitative differences in ERK activation are translated into qualitative differences in transcription factor activation. Thus, although multiple RTKs can transmit signals to the same individual kinases, the cell must have ways to strictly regulate the specificity of kinase signaling. Our studies further support the concept that RTK signaling can be both negatively and positively regulated and that the final output is the net effect of these perturbations. In HC11 cells expressing iFGFR1 and iFGFR2, this appears to be an important mechanism to determine the response of cells to FGFR signaling.

Accumulating reports have suggested that FGFR1 and FGFR2 genes are amplified in some human breast cancers (45, 46), but their roles in breast cancer formation and progression remain obscure. Although FGFR1 has been linked to prostate cancer progression (47), there is no direct genetic evidence that FGFR1 is a driving oncogene in breast cancer. The finding that FGFR2 belongs to three genes that are down-regulated in an 11-gene signature associated with poor prognosis of cancer patients with multiple types of cancer including breast cancer (48) suggests that FGFR2 may function as tumor suppressor. Studies of FGFR2 in prostate cancer and urothelial cancer support a role of FGFR2 in suppression of malignancy (49, 50). However, the results presented here using the HC11 3D culture model suggest that iFGFR2 activation can promote both proliferation and apoptosis.

Thus, further investigations are necessary to establish the role of FGFR1 and FGFR2 in breast cancer. It is possible that human breast cancer may be heterogeneous in its response to FGFR1 and FGFR2 activation depending on the presence of other genetic or epigenetic alterations. Therefore, although both FGFR1 and FGFR2 are amplified in human breast cancer, our studies suggest that they may play distinct roles in the etiology and progression of breast cancer. Elucidating the mechanistic differences between these receptors will allow the development of effective therapeutic strategies targeting FGF-mediated signal transduction.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Culture of Primary Mouse MECs ex Vivo
Transgenic mice expressing iFGFR1 and iFGFR2 under the control of the MMTV long-terminal repeat have been generated and characterized previously (15). Animal care and procedures were approved by the Institutional Animal Care and Use Committee of Baylor College of Medicine (Houston, TX) and were in accordance with the procedures detailed in the Guide for Care and Use of Laboratory Animals (National Institutes of Health Publication 85-23). Primary MECs were isolated from the no. 4 mammary gland from 8-wk-old virgin mice. The mammary glands were mechanically disaggregated and then subjected to collagenase digestion (2 mg/ml) at 37 C with gentle shaking (100 rpm) for 3 h. The digested material was then washed with DMEM/F12/1% fetal calf serum (FCS) (Invitrogen, Carlsbad, CA) five times. The pellet was resuspended in plating medium containing DMEM/F12 (Invitrogen) supplemented with 5 ng/ml EGF (Life Technologies), 5 µg/ml insulin (Sigma-Aldrich, St. Louis, MO), 1 ng/ml hydrocortisone (Sigma-Aldrich), and 50 µg/ml gentamicin (Sigma-Aldrich) and plated on 6-cm culture dishes that had been coated with DMEM/F12 supplemented with 20% FCS and 2 mg/ml Fetuin (Sigma-Aldrich). After 2 d in culture, the MECs were trypsinized, washed with Hanks’ balanced salt solution/10% horse serum, counted, and resuspended in growth medium containing DMEM/F12 supplemented with insulin 5 ng/ml EGF, 5 µg/ml insulin, 1 ng/ml hydrocortisone, 50 µg/ml gentamicin, and 10% FCS at 100,000 cells/ml. The suspension was then diluted 1:1 with growth medium containing 4% Matrigel (BD Biosciences, Franklin Lakes, NJ) and plated in eight-chambered RS glass slides (Nalgene, Rochester, NY) that were coated with 40 µl Matrigel at 10,000 cells per chamber. The medium was replaced every 3–4 d.

Plasmids and Cell Culture
iFGFR1 or iFGFR2 was cloned into the EcoRI sites of the pBabe-puro using an MfeI fragment of pMMP-iFGFR1 or pMMP-iFGFR2 including the FGFR1 or FGFR2 intracellular kinase domain, two tandem FKBPv domains, the NH2-terminal myristylation, and HA epitope sequences (15). HC11 cells were grown in growth media containing RPMI 1640 medium (JRH) supplemented with 10% fetal bovine serum (JRH), 2 mM L-glutamine (JRH), 10 ng/ml EGF (Life Technologies), 5 µg/ml insulin (Sigma-Aldrich), and 50 µg/ml gentamicin (Sigma-Aldrich). The 293T cell growth media contained DMEM (GIBCO), 10% fetal bovine serum, and 50 µg/ml gentamicin.

Generation of HC11 Cells Expressing iFGFR1
Retroviral transduction of HC11 cells with iFGFR1 and iFGFR2 was performed as described (15). Stable populations were obtained by selection with 2 µg/ml puromycin (Sigma-Aldrich). iFGFR1 and iFGFR2 expression was confirmed by immunoblotting. Selected clonal cell lines expressing iFGFR1 and iFGFR2 were routinely grown in the medium with 2 µg/ml to maintain selection pressure. Serum starvation media for HC11 cells contained only RPMI 1640 supplemented with either 30 nM AP20187 (Ariad Pharmaceuticals, Cambridge, MA) in ethanol or an equal volume of ethanol-diluent alone as control.

Morphogenesis Assay
The 3D culture of HC11 cells was performed as previously described (16). For stimulation with AP20187, the assay medium was replaced with the assay medium containing 100 µM AP20187 at d 10. For stimulation with AP20187 and Lactacystin (Calbiochem, San Diego, CA), the assay medium was replaced with the assay medium containing 100 µM AP20187 and 5 µM lactacystin at d 10. For stimulation with AP20187 and UO126 (Cell Signaling Technology, Beverly, MA), the assay medium was replaced with the assay medium containing 100 µM AP20187 and 5 µM UO126 at d 10.

Immunoblot Analysis
The following antibodies were used for immunoblot analysis: phospho-ERK and ERK (Cell Signaling Technology), HA-epitope (Covance, Princeton, NJ), phospho-FRS2 and FRS2 (Cell Signaling Technology), c-Cbl and Cbl-b (Santa Cruz Biotechnology, Santa Cruz, CA), and FAK (Cell Signaling Technology). Immunoblot analysis was carried out as previously described (16). Immunoprecipitation analysis was carried out using Catch and Release reversible immunoprecipitation system following the manufacturer’s protocol (Upstate Biotechnology, Lake Placid, NY).

Indirect Immunofluorescence and Image Acquisition
The following primary antibodies were used for indirect immunofluorescent detection of specific antigens: anti-phospho-histone H3 (Ser10) (Upstate Biotechnology), anti-cleaved caspase-3 (Asp175) (Cell Signaling Technology), anti-phospho-ezrin (Thr567)-radixin (Thr564)/moesin (Thr558) (Cell Signaling Technology), anti-CD49f (Cell Signaling Technology), anti-E-cadherin (Transduction Laboratories, Lexington, KY), anti-phospho-Akt (Ser473) (Cell Signaling Technology), anti-phospho-FAK (Tyr 861) (Cell Signaling Technology), anti-phospho-ERK (Cell Signaling Technology), anti-c-Cbl (Santa Cruz Biotechnology), anti-EEA1 (BD Biosciences), and anti-SMA (Sigma). All primary antibodies were used at a dilution of 1:200. Secondary antibodies were as follows: antimouse or antirabbit conjugated to Texas red, antimouse or antirabbit coupled with Alexa Fluor dyes, and anti-rat conjugated to Texas red (Molecular Probes, Eugene, OR). All secondary antibodies were used at a dilution of 1:500. Nuclei were stained with TOPRO-3 (Molecular Probes). Immunostaining was performed as previously described (51). Confocal analyses were performed using a Zeiss (Thornwood, NY) 510 laser scanning confocal microscope. The acquisition software is the Zeiss LSM image browser. Deconvolution images were taken using Applied Precision (Issaquah, WA) softWoRx image restoration microscope. The acquisition software is the softWoRx Explorer. Phase contrast images were captured using an Olympus inverted microscope (CK40-SLP) and a Sony video camera (CCD-IRIS/RGB). The acquisition software is Adobe Photoshop 5.0. All of the confocal images presented in this study were taken from the center of the structures for comparisons. All of the comparisons were statistically analyzed. The data were presented as mean ± SEM. P values were calculated using Student’s t test. P < 0.05 in all of the comparisons.

siRNA
A pool of three target-specific siRNAs designed to knock down Cbl (Santa Cruz Biotechnology) was introduced into subconfluent (75–80%) HC11 cells using Santa Cruz Biotechnology’s siRNA transfection reagent according to the manufacturer’s instructions. After 48 h, the medium was changed to RPMI 1640 and the cells were starved overnight. The medium was replaced with RPMI 1640supplemented with either 30 nM AP20187 in ethanol or an equal volume of ethanol-diluent the following day. After induction for various time points, the cells were collected for immunoblot analysis and immunostaining. The sequence of siRNAs are as follows: pair A, GACATACGATGAAGTGAAATT; pair B, GTGAGCACCCAAAGATCAATT; pair C, CGACAGCTGTACCTATGAATT.


   ACKNOWLEDGMENTS
 
We thank Drs. Tracy Vargo-Gogola, Fariba Behbod, Heather LaMarca, Mei Zhang, David Spencer, and Wallace McKeehan for critical review and helpful discussions of the manuscript. We thank Shirley Small for technical support.


   FOOTNOTES
 
This work was supported by a postdoctoral fellowship DAMD 17-02-1-0285 from the Department of Defense Breast Cancer Research Program (to W.X.), by Ruth L. Kirschstein National Research Service Award Fellowship CA 97676-01 (to K.L.S.), and by National Institutes of Health Grant CA16303.

Disclosure Statement: The authors have nothing to disclose.

First Published Online February 6, 2007

Abbreviations: 2D, Two-dimensional; 3D, three-dimensional; EGF, epidermal growth factor; EMT, epithelial to mesenchymal transition; FAK, focal adhesion kinase; FCS, fetal calf serum; FGF, fibroblast growth factor; FGFR, FGF receptor; FRS2, FGF receptor substrate 2; HA, hemagglutinin; iFGFR, inducible FGFR; MECs, mammary epithelial cells; MMTV, mouse mammary tumor virus; RTK, receptor tyrosine kinase; siRNA, small interfering RNA; SMA, smooth muscle actin.

Received for publication December 4, 2006. Accepted for publication January 31, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Dickson C, Spencer-Dene B, Dillon C, Fantl V 2000 Tyrosine kinase signalling in breast cancer: fibroblast growth factors and their receptors. Breast Cancer Res 2:191–196[CrossRef][Medline]
  2. Ornitz DM, Itoh N 2001 Fibroblast growth factors. Genome Biol 2:REVIEWS3005
  3. Klint P, Claesson-Welsh L 1999 Signal transduction by fibroblast growth factor receptors. Front Biosci 4:D165–D177
  4. Casci T, Vinos J, Freeman M 1999 Sprouty, an intracellular inhibitor of Ras signaling. Cell 96:655–665[CrossRef][Medline]
  5. Hacohen N, Kramer S, Sutherland D, Hiromi Y, Krasnow MA 1998 sprouty encodes a novel antagonist of FGF signaling that patterns apical branching of the Drosophila airways. Cell 92:253–263[CrossRef][Medline]
  6. Furthauer M, Lin W, Ang SL, Thisse B, Thisse C 2002 Sef is a feedback-induced antagonist of Ras/MAPK-mediated FGF signalling. Nat Cell Biol 4:170–174[CrossRef][Medline]
  7. Tsang M, Friesel R, Kudoh T, Dawid IB 2002 Identification of Sef, a novel modulator of FGF signalling. Nat Cell Biol 4:165–169[CrossRef][Medline]
  8. Joazeiro CA, Wing SS, Huang H, Leverson JD, Hunter T, Liu YC 1999 The tyrosine kinase negative regulator c-Cbl as a RING-type, E2-dependent ubiquitin-protein ligase. Science 286:309–312[Abstract/Free Full Text]
  9. Levkowitz G, Waterman H, Ettenberg SA, Katz M, Tsygankov AY, Alroy I, Lavi S, Iwai K, Reiss Y, Ciechanover A, Lipkowitz S, Yarden Y 1999 Ubiquitin ligase activity and tyrosine phosphorylation underlie suppression of growth factor signaling by c-Cbl/Sli-1. Mol Cell 4:1029–1040[CrossRef][Medline]
  10. Yokouchi M, Kondo T, Houghton A, Bartkiewicz M, Horne WC, Zhang H, Yoshimura A, Baron R 1999 Ligand-induced ubiquitination of the epidermal growth factor receptor involves the interaction of the c-Cbl RING finger and UbcH7. J Biol Chem 274:31707–31712[Abstract/Free Full Text]
  11. Feng S, Wang F, Matsubara A, Kan M, McKeehan WL 1997 Fibroblast growth factor receptor 2 limits and receptor 1 accelerates tumorigenicity of prostate epithelial cells. Cancer Res 57:5369–5378[Abstract/Free Full Text]
  12. Matsubara A, Kan M, Feng S, McKeehan WL 1998 Inhibition of growth of malignant rat prostate tumor cells by restoration of fibroblast growth factor receptor 2. Cancer Res 58:1509–1514[Abstract/Free Full Text]
  13. Freeman KW, Gangula RD, Welm BE, Ozen M, Foster BA, Rosen JM, Ittmann M, Greenberg NM, Spencer DM 2003 Conditional activation of fibroblast growth factor receptor (FGFR) 1, but not FGFR2, in prostate cancer cells leads to increased osteopontin induction, extracellular signal-regulated kinase activation, and in vivo proliferation. Cancer Res 63:6237–6243[Abstract/Free Full Text]
  14. Ornitz DM, Xu J, Colvin JS, McEwen DG, MacArthur CA, Coulier F, Gao G, Goldfarb M 1996 Receptor specificity of the fibroblast growth factor family. J Biol Chem 271:15292–15297[Abstract/Free Full Text]
  15. Welm BE, Freeman KW, Chen M, Contreras A, Spencer DM, Rosen JM 2002 Inducible dimerization of FGFR1: development of a mouse model to analyze progressive transformation of the mammary gland. J Cell Biol 157:703–714[Abstract/Free Full Text]
  16. Xian W, Schwertfeger KL, Vargo-Gogola T, Rosen JM 2005 Pleiotropic effects of FGFR1 on cell proliferation, survival, and migration in a 3D mammary epithelial cell model. J Cell Biol 171:663–673[Abstract/Free Full Text]
  17. Debnath J, Brugge JS 2005 Modelling glandular epithelial cancers in three-dimensional cultures. Nat Rev Cancer 5:675–688[CrossRef][Medline]
  18. Schwertfeger KL, Xian W, Kaplan AM, Burnett SH, Cohen DA, Rosen JM 2006 A critical role for the inflammatory response in a mouse model of preneoplastic progression. Cancer Res 66:5676–5685[Abstract/Free Full Text]
  19. Wulf G, Garg P, Liou YC, Iglehart D, Lu KP 2004 Modeling breast cancer in vivo and ex vivo reveals an essential role of Pin1 in tumorigenesis. EMBO J 23:3397–3407[CrossRef][Medline]
  20. Blatchford DR, Quarrie LH, Tonner E, McCarthy C, Flint DJ, Wilde CJ 1999 Influence of microenvironment on mammary epithelial cell survival in primary culture. J Cell Physiol 181:304–311[CrossRef][Medline]
  21. Roovers K, Assoian RK 2000 Integrating the MAP kinase signal into the G1 phase cell cycle machinery. Bioessays 22:818–826[CrossRef][Medline]
  22. Marshall CJ 1995 Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation. Cell 80:179–185[CrossRef][Medline]
  23. Bache KG, Slagsvold T, Stenmark H 2004 Defective downregulation of receptor tyrosine kinases in cancer. EMBO J 23:2707–2712[CrossRef][Medline]
  24. Galcheva-Gargova Z, Theroux SJ, Davis RJ 1995 The epidermal growth factor receptor is covalently linked to ubiquitin. Oncogene 11:2649–2655[Medline]
  25. Levkowitz G, Oved S, Klapper LN, Harari D, Lavi S, Sela M, Yarden Y 2000 c-Cbl is a suppressor of the neu oncogene. J Biol Chem 275:35532–35539[Abstract/Free Full Text]
  26. Ilic D, Furuta Y, Kanazawa S, Takeda N, Sobue K, Nakatsuji N, Nomura S, Fujimoto J, Okada M, Yamamoto T 1995 Reduced cell motility and enhanced focal adhesion contact formation in cells from FAK-deficient mice. Nature 377:539–544[CrossRef][Medline]
  27. Frisch SM, Vuori K, Ruoslahti E, Chan-Hui PY 1996 Control of adhesion-dependent cell survival by focal adhesion kinase. J Cell Biol 134:793–799[Abstract/Free Full Text]
  28. Schaller MD 2001 Biochemical signals and biological responses elicited by the focal adhesion kinase. Biochim Biophys Acta 1540:1–21[Medline]
  29. Wong A, Lamothe B, Lee A, Schlessinger J, Lax I 2002 FRS2{alpha} attenuates FGF receptor signaling by Grb2-mediated recruitment of the ubiquitin ligase Cbl. Proc Natl Acad Sci USA 99:6684–6689[Abstract/Free Full Text]
  30. Thien CB, Langdon WY 2005 c-Cbl and Cbl-b ubiquitin ligases: substrate diversity and the negative regulation of signalling responses. Biochem J 391:153–166[CrossRef][Medline]
  31. Grose R, Dickson C 2005 Fibroblast growth factor signaling in tumorigenesis. Cytokine Growth Factor Rev 16:179–186[CrossRef][Medline]
  32. Konig A, Menzel T, Lynen S, Wrazel L, Rosen A, Al-Katib A, Raveche E, Gabrilove JL 1997 Basic fibroblast growth factor (bFGF) upregulates the expression of bcl-2 in B cell chronic lymphocytic leukemia cell lines resulting in delaying apoptosis. Leukemia 11:258–265[CrossRef][Medline]
  33. Raguenez G, Desire L, Lantrua V, Courtois Y 1999 BCL-2 is upregulated in human SH-SY5Y neuroblastoma cells differentiated by overexpression of fibroblast growth factor 1. Biochem Biophys Res Commun 258:745–751[CrossRef][Medline]
  34. Wang Q, Maloof P, Wang H, Fenig E, Stein D, Nichols G, Denny TN, Yahalom J, Wieder R 1998 Basic fibroblast growth factor downregulates Bcl-2 and promotes apoptosis in MCF-7 human breast cancer cells. Exp Cell Res 238:177–187[CrossRef][Medline]
  35. Korah RM, Sysounthone V, Golowa Y, Wieder R 2000 Basic fibroblast growth factor confers a less malignant phenotype in MDA-MB-231 human breast cancer cells. Cancer Res 60:733–740[Abstract/Free Full Text]
  36. Maloof P, Wang Q, Wang H, Stein D, Denny TN, Yahalom J, Fenig E, Wieder R 1999 Overexpression of basic fibroblast growth factor (FGF-2) downregulates Bcl-2 and promotes apoptosis in MCF-7 human breast cancer cells. Breast Cancer Res Treat 56:153–167[CrossRef][Medline]
  37. Korah RM, Sysounthone V, Scheff E, Wieder R 2000 Intracellular FGF-2 promotes differentiation in T-47D breast cancer cells. Biochem Biophys Res Commun 277:255–260[CrossRef][Medline]
  38. Miranti CK, Brugge JS 2002 Sensing the environment: a historical perspective on integrin signal transduction. Nat Cell Biol 4:E83–E90
  39. Zambruno G, Marchisio PC, Marconi A, Vaschieri C, Melchiori A, Giannetti A, De Luca M 1995 Transforming growth factor-ß1 modulates ß1 and ß5 integrin receptors and induces the de novo expression of the {alpha}vß6 heterodimer in normal human keratinocytes: implications for wound healing. J Cell Biol 129:853–865[Abstract/Free Full Text]
  40. Tombes RM, Auer KL, Mikkelsen R, Valerie K, Wymann MP, Marshall CJ, McMahon M, Dent P 1998 The mitogen-activated protein (MAP) kinase cascade can either stimulate or inhibit DNA synthesis in primary cultures of rat hepatocytes depending upon whether its activation is acute/phasic or chronic. Biochem J 330(Pt 3):1451–1460
  41. Countaway JL, Nairn AC, Davis RJ 1992 Mechanism of desensitization of the epidermal growth factor receptor protein-tyrosine kinase. J Biol Chem 267:1129–1140[Abstract/Free Full Text]
  42. Dikic I, Giordano S 2003 Negative receptor signalling. Curr Opin Cell Biol 15:128–135[CrossRef][Medline]
  43. Traverse S, Gomez N, Paterson H, Marshall C, Cohen P 1992 Sustained activation of the mitogen-activated protein (MAP) kinase cascade may be required for differentiation of PC12 cells. Comparison of the effects of nerve growth factor and epidermal growth factor. Biochem J 288(Pt 2):351–355
  44. Nguyen TT, Scimeca JC, Filloux C, Peraldi P, Carpentier JL, Van Obberghen E 1993 Co-regulation of the mitogen-activated protein kinase, extracellular signal-regulated kinase 1, and the 90-kDa ribosomal S6 kinase in PC12 cells. Distinct effects of the neurotrophic factor, nerve growth factor, and the mitogenic factor, epidermal growth factor. J Biol Chem 268:9803–9810[Abstract/Free Full Text]
  45. Adnane J, Gaudray P, Dionne CA, Crumley G, Jaye M, Schlessinger J, Jeanteur P, Birnbaum D, Theillet C 1991 BEK and FLG, two receptors to members of the FGF family, are amplified in subsets of human breast cancers. Oncogene 6:659–663[Medline]
  46. Penault-Llorca F, Bertucci F, Adelaide J, Parc P, Coulier F, Jacquemier J, Birnbaum D, deLapeyriere O 1995 Expression of FGF and FGF receptor genes in human breast cancer. Int J Cancer 61:170–176[Medline]
  47. Kwabi-Addo B, Ozen M, Ittmann M 2004 The role of fibroblast growth factors and their receptors in prostate cancer. Endocr Relat Cancer 11:709–724[Abstract/Free Full Text]
  48. Glinsky GV, Berezovska O, Glinskii AB 2005 Microarray analysis identifies a death-from-cancer signature predicting therapy failure in patients with multiple types of cancer. J Clin Invest 115:1503–1521[CrossRef][Medline]
  49. Ricol D, Cappellen D, El Marjou A, Gil-Diez-de-Medina S, Girault JM, Yoshida T, Ferry G, Tucker G, Poupon MF, Chopin D, Thiery JP, Radvanyi F 1999 Tumour suppressive properties of fibroblast growth factor receptor 2-IIIb in human bladder cancer. Oncogene 18:7234–7243[CrossRef][Medline]
  50. Yasumoto H, Matsubara A, Mutaguchi K, Usui T, McKeehan WL 2004 Restoration of fibroblast growth factor receptor2 suppresses growth and tumorigenicity of malignant human prostate carcinoma PC-3 cells. Prostate 61:236–242[CrossRef][Medline]
  51. Debnath J, Muthuswamy SK, Brugge JS 2003 Morphogenesis and oncogenesis of MCF-10A mammary epithelial acini grown in three-dimensional basement membrane cultures. Methods 30:256–268[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Endocr. Rev.Home page
D. L. Kleinberg, T. L. Wood, P. A. Furth, and A. V. Lee
Growth Hormone and Insulin-Like Growth Factor-I in the Transition from Normal Mammary Development to Preneoplastic Mammary Lesions
Endocr. Rev., February 1, 2009; 30(1): 51 - 74.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
C. K. Augustine, Y. Yoshimoto, M. Gupta, P. A. Zipfel, M. A. Selim, P. Febbo, A. M. Pendergast, W. P. Peters, and D. S. Tyler
Targeting N-Cadherin Enhances Antitumor Activity of Cytotoxic Therapies in Melanoma Treatment
Cancer Res., May 15, 2008; 68(10): 3777 - 3784.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
Y. Zhang, K. McKeehan, Y. Lin, J. Zhang, and F. Wang
Fibroblast Growth Factor Receptor 1 (FGFR1) Tyrosine Phosphorylation Regulates Binding of FGFR Substrate 2{alpha} (FRS2{alpha}) But Not FRS2 to the Receptor
Mol. Endocrinol., January 1, 2008; 22(1): 167 - 175.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xian, W.
Right arrow Articles by Rosen, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xian, W.
Right arrow Articles by Rosen, J. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals