help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2006-0468
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
21/5/1039    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moehren, U.
Right arrow Articles by Baniahmad, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moehren, U.
Right arrow Articles by Baniahmad, A.
Molecular Endocrinology 21 (5): 1039-1048
Copyright © 2007 by The Endocrine Society

Alien Interacts with the Human Androgen Receptor and Inhibits Prostate Cancer Cell Growth

Udo Moehren, Maria Papaioannou, Christina A. Reeb, Wei Hong and Aria Baniahmad

Department of Medicine, Institute of Human Genetics and Anthropology, 07743 Jena, Germany

Address all correspondence and requests for reprints to: Aria Baniahmad, Department of Medicine, Institute of Human Genetics and Anthropology, Kollegiengasse 10, 07743 Jena, Germany. E-mail: aban{at}mti.uni-jena.de.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Prostate cancer cell growth is initially androgen dependent. Androgen antagonists are used in prostate cancer therapy to inactivate the transcriptional activity of the human androgen receptor (hAR) and to inhibit the proliferation of prostate cancer. Here, we have characterized Alien with characteristics of a corepressor as a novel interacting factor for the antagonist bound hAR. Alien is recruited to hAR in the presence of the AR antagonist cyproterone acetate (CPA). The interaction of Alien with hAR is verified in vivo and in vitro by a modified mammalian two-hybrid system, coimmunoprecipitation, chromatin immunoprecipitation, and in vitro binding assays. In contrast to other nuclear receptors, Alien binds to the amino-terminus of hAR with the receptor SUMOylation (small ubiquitin modifier) sites being involved. Furthermore, cellular localization of Alien is changed towards a predominant nuclear localization upon treatment of prostate cancer cells with CPA. Notably, stable expression of Alien in LNCaP cells inhibits both endogenous prostate-specific antigen expression and proliferation of these cells in the presence of CPA but not in the presence of an AR agonist. These findings underline the importance of corepressors for inhibition of prostate cancer cell growth by androgen antagonists.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PROSTATE CANCER is one of the most commonly diagnosed malignancies and one of the leading causes of cancer mortality of men in Western countries (1, 2). Androgens, such as testosterone and dihydrotestosterone (DHT), have a leading role by promoting the development of benign prostate hyperplasia and prostate cancer (3, 4). The androgens exert their tumor-promoting effects in the prostate through the human androgen receptor (hAR) protein (5).

hAR is a member of the nuclear hormone receptor superfamily, a large group of ligand-dependent transcription factors. hAR consists of an amino (N)-terminal domain harboring a potent transactivation function, followed by a DNA-binding domain and a carboxy (C)-terminal ligand binding domain (LBD) (6). Binding of androgens induces a conformational change of the hAR that induces its translocation into the nucleus and the binding to androgen response elements (AREs) on the promoter region and other regulatory regions of its target genes. Furthermore, the binding of agonists to AR promotes an interaction between its N and C termini (7, 8), leading to full transcriptional activation (9, 10).

Antiandrogens (androgen antagonists) reduce partially or block completely the hAR-mediated transactivation (6, 11). Therefore, the current treatments for prostate cancer involve down-regulation of hAR-mediated transactivation to reduce cancer cell proliferation.

One molecular mechanism for androgen antagonism was shown to involve corepressors (12). The homologous silencing mediator for retinoic acid and thyroid hormone receptors (SMRT) and nuclear receptor corepressor (NCoR) were shown to bind to AR in the presence of both AR agonist and antagonists (13, 14, 15, 16, 17, 18, 19). Nevertheless, it is believed that corepressor binding to hAR is an important step for antihormone treatment. Therefore, it is important to analyze interaction of corepressors with hAR (20) and their role in inhibition of prostate cancer cell proliferation by hAR antagonist.

Alien/thyroid hormone receptor-interacting protein (TRIP15)/subunit 2 of the signalosome complex (CSN2) has been identified in a yeast two-hybrid screen as a ligand-sensitive interacting factor with the thyroid hormone receptor (21), which acts as a ligand-sensitive interacting corepressor (22, 23, 24). Furthermore, Alien has been shown to effectively enhance vitamin D3 receptor-mediated silencing in a response element-dependent manner (24, 25). There is evidence that multiple transcripts and isoforms of Alien exist (23, 26), including CSN2, and that CSN2 plays an important role in cell cycle regulation (27, 28, 29).

Here, we have characterized the interaction of the corepressor Alien with hAR. Alien interacts with hAR in the presence of cyproterone acetate (CPA) but not in the presence of AR agonist. Alien is recruited in vivo to the prostate-specific antigen (PSA) promoter and interacts with the N-terminal region of hAR. Furthermore, we show that Alien inhibits both endogenous PSA expression and the growth of LNCaP cells in the presence of the AR antagonist CPA but not AR agonist. The results presented here reveal new important insights into the molecular mechanisms of antiandrogen action and emphasize the role of corepressors as important molecular targets in drug design.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Alien Is Recruited to the hAR in the Presence of CPA
Because Alien was shown to interact with the nonsteroid class II receptors such as thyroid hormone receptor and vitamin D3 receptor in the absence of ligand (22, 24, 25), we were interested to analyze whether Alien interacts with the hAR, a member of the class I steroid receptor family.

To analyze the recruitment of Alien to the hAR, modified mammalian two-hybrid assays were employed. The expression vectors for the unfused, wild-type hAR as the natural DNA binder, the transactivator fusion VP16-Alien, a fusion with the potent transactivation domain of VP16 (viral protein 16), with mouse mammary tumor virus-luciferase as the reporter and as control the transactivation domain VP16 alone was used. Thus, an interaction between these factors will lead to enhanced transactivation. CV1 cells were chosen because they lack endogenous functional hAR, glucocorticoid and progesterone receptors known to bind to a similar set of response elements. Cells were either untreated, treated with the AR antagonists casodex (Cas, bicalutamide), hydroxyflutamide (OH-F), mifepristone (RU486), CPA, or with the AR-specific agonist methyltrienolone (R1881) (Fig. 1Go). Interestingly, in the presence of CPA, a strongly enhanced reporter activity was measured indicating that Alien is recruited to CPA-bound AR, whereas, in the presence of RU486 or R1881, only a slight interaction was observed (Fig. 1Go).


Figure 1
View larger version (9K):
[in this window]
[in a new window]

  		Fig. 1. Antagonist-Dependent Interaction of Alien with hAR

The AR antagonists CPA, Cas, OH-F, RU486, or the AR-specific agonist R1881 were used for mammalian interaction studies with the unfused wild-type hAR and VP16-Alien as the activator or VP16 as control in the modified mammalian two-hybrid system. CV1 cells were transfected with the appropriate expression vectors and treated with the indicated hAR androgen antagonists (10–7 M) or R1881 (10–8 M). Please note that for better comparison the values obtained with VP16 as control were set arbitrarily as one and indicated as fold interaction. Normalized luciferase units are shown.

 
Thus, the data suggest an interaction of Alien with AR in the presence of CPA. Therefore, we focused on the CPA-liganded hAR for further analysis of the Alien-AR interaction.

The hAR N Terminus Regulates the Binding to Alien
To determine the corepressor-binding region of hAR, receptor deletions were generated and tested with the modified mammalian two-hybrid system in the absence or presence of CPA. Deletion of the hAR LBD (AR-{Delta}LBD) retained interaction with VP16-Alien, whereas the deletion of the hAR N terminus (AR-{Delta}N) abrogated the interaction with Alien in the presence of CPA (Fig. 2AGo). Further delineation of the hAR N terminus using the deletions AR-{Delta}39–171, which retained the very N-terminal sequence for N- and C-terminal interaction of hAR, or AR-{Delta}1–171 suggests that the first 171 amino acid (aa) of hAR are dispensable for interaction with Alien (Fig. 2BGo). However, using the deletions of the aa 39–328 or the first 328 aa of the hAR N terminus (AR-{Delta}1–328), no significant interaction could be observed. This suggests that at least the N-terminal aa 171–328 are necessary for interaction with Alien (Fig. 2BGo).


Figure 2
View larger version (12K):
[in this window]
[in a new window]

  		Fig. 2. The hAR N Terminus Interacts with Alien

Various deletions and mutants of the hAR were employed to analyze the interaction with Alien using the modified mammalian two-hybrid system in the absence or presence of CPA as described in Fig. 1Go. hAR-{Delta}LBD represents an AR mutant with the deleted LBD; similarly, hAR{Delta}N is the amino-(N) terminal deletion of AR. Numbers indicate the deleted aa of the AR mutants. Please note, because the major transactivation domain of AR is localized in the N terminus, the scaling is different. RLU, relative light unit; –, absence; +, presence.

 
To test for a direct interaction of Alien with hAR, in vitro glutathione S-transferase (GST)-pull-down experiments were performed with bacterially expressed GST or GST-Alien and in vitro-translated and 35S-methionine-labeled hAR in the presences of CPA. Specific binding of hAR to Alien was observed (Fig. 3Go). In this in vitro assay we did not observe a ligand-dependent interaction. To verify whether the N-terminal part of hAR is sufficient to bind to Alien, the aa 1–505 of hAR were used. Indeed, specific interaction with Alien was observed with a similar strength as full-length hAR. Interestingly, the AR deletion encompassing aa 1–328 exhibited only slight interaction with hAR, suggesting that the aa 1–328 alone interact with hAR but further aa of the N terminus of hAR contribute to the interaction with Alien. Using only the aa 1–171, no interaction with Alien was observed, which is in line with the data from the modified two-hybrid system. The in vitro-translated and 35S-labeled luciferase is shown as negative control (Fig. 3Go).


Figure 3
View larger version (27K):
[in this window]
[in a new window]

  		Fig. 3. Alien Binds to hAR in Vitro

GST-pull-down experiments were performed using bacterially expressed GST or GST-Alien and in vitro-translated and 35S-labeled hAR with CPA. Deletion mutants of AR are indicated (see schematic view). Radioactive bands retained after stringent washes were visualized by x-ray films. The Coomassie staining of the SDS-PAGE indicates the amount of proteins used. In vitro-translated and 35S-labeled luciferase is included as negative control. Arrows indicate the migration of the specific bands. DBD, DNA binding domain.

 
Thus, Alien interacts with the N terminus of AR.

The Cellular Localization of Alien Is Regulated by CPA Treatment
To confirm the interaction of Alien with wild-type hAR, a known behavior is the change in the cellular distribution of some factors that interact with androgen or glucocorticoid receptors. Our previous results suggest that in HeLa cells Alien is predominantly localized in nuclei, in nucleoli, and is also present in the cytosol (22). However, when analyzing the expression and localization of Alien in prostate cancer cells that were cultured in hormone-depleted medium, interestingly, a change in the cellular localization of Alien was observed when cells were treated with CPA (Fig. 4Go). Indirect immunofluoresence experiments were employed using an Alien-specific antibody or preimmune serum as negative control. PC3-ARwt cells (30) expressing endogenous Alien and wild-type hAR were treated with CPA for 1 hr. Overlay of the immunofluorescence data suggests that a colocalization of Alien with AR in the presence of CPA occurs in the nucleus and not in the nucleolus (Fig. 4Go). Comparing the treatment with solvent or CPA, a transition toward a more nuclear staining was observed in the presence of CPA (Fig. 4Go). This observation was confirmed, quantifying the localization of Alien in the absence or presence of CPA. In the absence of ligand, only 18% of cells showed a predominant nuclear localization of Alien, 58% a nuclear and cytoplasmatic, and 24% a predominant cytoplasmatic localization of Alien. In contrast, by treatment with CPA, 70% of cells showed a nuclear localization of Alien, 30% an equal distribution between cytoplasm and nucleus, and none of the cells analyzed had a cytoplasmatic localization of Alien. This suggests that the cellular localization of Alien is regulated by the CPA-bound hAR.


Figure 4
View larger version (36K):
[in this window]
[in a new window]

  		Fig. 4. Alien Shifts toward a More Nuclear Localization by CPA Treatment

To test for cellular localization of Alien, indirect immunofluorescence was performed using PC3-AR prostate cancer cells expressing the wild-type hAR with an anti-Alien antibody (detection in green) or as control with preimmune serum in the absence (–) or presence of CPA. The anti-AR detection is shown in red and colocalization of Alien and AR by overlay in yellow. With CPA treatment, Alien shifts toward a more nuclear localization (also see text).

 
Thus, the cellular localization of Alien is regulated by CPA, leading to a shift toward a more nuclear localization, which is a further indication of an Alien-hAR interaction in cells.

AR Is Complexed with Alien in Vivo
LNCaP cells are the model system for androgen-dependent human prostate cancer cell growth and express the AR endogenously. Therefore, we intended to further analyze the Alien-AR interaction in these cells. Notably, these cells express the mutant hAR T877A, which is known to be frequently mutated in prostate cancer (31). Thus, we first tested in CV1 cells whether Alien is able to interact with this mutant AR using a similar setup as shown in Fig. 1Go (Fig. 5AGo). Compared with the controls that include no addition of CPA or the empty VP16 vector, the obtained data suggest that Alien interacts with the mutant AR T877A in the presence of CPA.


Figure 5
View larger version (19K):
[in this window]
[in a new window]

  		Fig. 5. The hAR Interacts with Alien in Vivo

A, As described in Fig. 1Go, the modified mammalian two-hybrid system was used to detect interaction of Alien with the hAR mutant T877A, a hot-spot mutation in prostate cancer, which is expressed in LNCaP cells. For better comparison, the values obtained with the VP16 control vector were arbitrarily set as one. –, Absence; +, presence. B, CoIP experiments using LNCaP cells treated with CPA. Endogenously expressed Alien was immunoprecipitated from cells treated with (+) or without (–) CPA. Western blotting was performed with an anti-AR antibody to detect the presence of hAR. C, ChIP experiments were performed with LNCaP cells in the absence (–) or presence (+) of CPA (2-h treatment) to detect the recruitment of the hAR or Alien to both the PSA promoter and enhancer. Both contain AREs indicated in the schematic view. Inp, Input; Ab, antibody.

 
To confirm whether Alien is complexed with hAR in vivo, coimmunoprecipitation (CoIP) experiments were performed using LNCaP cells expressing both endogenous hAR and Alien. Immunoprecipitation of endogenous Alien in the presence of CPA and detection of hAR by Western blotting indicates that Alien is specifically complexed with hAR (Fig. 5BGo). Analyses of whether CPA influences the interaction of AR with Alien CoIP experiments were performed with LNCaP cells untreated or treated with CPA. An interaction of Alien with AR was detected in the presence but not significantly in the absence of CPA (Fig. 5BGo). This suggests that Alien is complexed with AR in the presence of CPA.

In addition, chromatin immunoprecipitation (ChIP) experiments were employed with LNCaP cells to detect whether endogenous Alien is recruited in vivo in the context of chromatin to the endogenous PSA gene, a well-known hAR target gene. The recruitment of AR to the PSA promoter was enhanced by the presence of CPA. Similarly, the recruitment of Alien to the PSA promoter was also enhanced by CPA treatment of LNCaP cells (Fig. 5CGo). In the absence of ligand, signals were also detected that suggest the AR is recruited to the PSA promoter. This is in line with previous observations of other groups (15). Furthermore, in analyzing the PSA enhancer, which contains AREs, a similar ligand-enhanced recruitment of both AR and Alien was observed. This suggests that the recruitment of Alien to the PSA promoter and enhancer is regulated by the AR ligand CPA. Thus, taken together, these data indicate that Alien interacts with wild-type hAR and the T877A mutant hAR in vivo.

The Binding of AR to Alien Is Similar to that of SMRT Binding to AR
These interaction data revealed that the interaction of Alien with hAR is very similar to that of SMRT with hAR (13). Also, similar to the SMRT-hAR interaction, we observed that the interaction of Alien with hAR is sensitive to the activated PKA pathway (data not shown). Two SUMOylation (small ubiquitin modifier) sites of hAR were described that, when mutated, led to an enhanced hAR-mediated transactivation (32, 33). These two SUMOylation sites prevent binding of SMRT to AR (13). Using the two SUMOylation site mutants of hAR [AR K385E and K518E (lysine to glutamic acid) or AR K385R and K518R (lysine to arginine) (34)], no significant interaction with Alien was observed (Fig. 6AGo). These data suggest that both the hAR N terminus with the first 328 aa and the SUMOylation sites are involved in the regulation of the Alien-hAR interaction.


Figure 6
View larger version (9K):
[in this window]
[in a new window]

  		Fig. 6. The Carboxy-Terminus of SMRT (C-SMRT) Inhibits Interaction of Alien with hAR

The modified mammalian two-hybrid system was used with the indicated expression vectors as described in Fig. 1Go in the absence or presence of CPA. An increase in reporter activity indicates interaction with hAR. A, Point mutants of AR sites known to be SUMOylated were used to detect interaction with Alien. Similar to SMRT, these AR point mutants abrogate interaction with Alien. B, In addition to VP-Alien or VP16, the empty vector or C-SMRT expression vector, lacking the silencing domains, was cotransfected. Expression of C-SMRT inhibits interaction of Alien with AR. –, Absence; +, presence.

 
Therefore, we hypothesized that both SMRT and Alien bind to similar regions on hAR and may compete for binding to hAR. To test this possibility, competition experiments were performed with hAR, the VP16-Alien fusion, and overexpression of C-SMRT encompassing the SMRT C terminus known to lack silencing function and to be sufficient to bind to hAR (13). A competition for the binding to hAR would lead to a decrease in reporter activity and thus a decrease of VP16-Alien interaction in the presence of CPA. That is exactly what was observed (Fig. 6BGo). First, dose-dependency was tested, which revealed that expression of C-SMRT in the absence of CPA did not significantly influence the reporter activity (data not shown). However, the interaction of VP16-Alien with hAR was abrogated, indicated by the lack of activated reporter activity when C-SMRT is coexpressed with VP16-Alien in the presence of CPA. These data suggest a competition between Alien and SMRT for binding to the N terminus of hAR.

Taken together, Alien binds to the hAR N terminus and requires the first 328 aa and the SUMOylation sites. Furthermore, Alien and SMRT use an overlapping interaction region of AR, and the binding of Alien to hAR is influenced by C-SMRT.

The Expression of Alien Leads to Inhibition of Prostate Cancer Cell Growth
Because LNCaP cells are known to grow in an androgen-dependent manner, we analyzed whether CPA treatment in combination with the expression of Alien influences prostate cancer cell growth. Colony formation assays were performed using LNCaP cells in normal serum containing androgens with stable integration of either the Alien expression vector or the empty vector, as control, with or without treatment of CPA or R1881, as control. After selection for stable integration, colony numbers were counted. The number of colonies was compared with LNCaP cells with the control empty vector and plotted as fold inhibition of colony numbers (Fig. 7AGo). Addition of CPA led consistently to a slightly reduced number of colonies, which is indicated as inhibition of colony formation and which also reflects cell growth. Stable integration of Alien reduced only slightly the colony number of cells without ligand treatment. In combination with CPA, interestingly, the colony number was drastically reduced in contrast to treatment with R1881. Furthermore, the growth of LNCaP cells expressing Alien is 2.3 times decreased compared with control cells (data not shown). This suggests that the expression of Alien inhibits cell growth and colony formation of LNCaP cells in the presence of the AR antagonist CPA.


Figure 7
View larger version (15K):
[in this window]
[in a new window]

  		Fig. 7. Alien Inhibits both Colony Formation and PSA Expression of Prostate Cancer Cells in the Presence of CPA

A, Colony formation assays were performed using stable integration of the Alien expression vector in LNCaP cells grown in 5% untreated FBS that is known to contain androgens. During selection with hygromycin for stable integration of Alien or, as control, the empty vector, cells were also treated with or without 10–7 M CPA. Individual cell clones were obtained and the colony numbers were counted and plotted as inhibition of colony formation. Variations of the mean result from triplicate experiments. –, absence; +, presence. B, The endogenous PSA mRNA levels were detected by qRT-PCR of LNCaP cells stably transfected with Alien or control LNCaP cells in the presence of the indicated ligands (10–9 M R1881, 10–8 M DHT, 10–7 M CPA).

 
To test whether the expression of Alien influences the expression of the endogenous PSA gene, quantitative real-time PCR (qRT-PCR) experiments were performed with LNCaP cells stably transfected with Alien (Fig. 7BGo). In the presence of DHT or R1881, no significant change of PSA expression was observed compared with the control LNCaP cells; however, in the presence of CPA, the Alien-expressing LNCaP cells exhibit a significantly reduced PSA expression (P < 0.02). Thus, these results indicate Alien inhibits both the endogenous PSA expression and growth of androgen-dependent prostate cancer cells by CPA.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
In the present study we have characterized the interaction of Alien with hAR. Interestingly, employing different AR ligands, this study proves the notion that Alien preferentially interacts with AR in the presence of CPA. This suggests that CPA can potentially induce different mechanisms as antagonists for AR compared with the pure antagonists Cas or OH-F. The molecular basis remains unclear but could potentially involve other corepressors.

Notably, Alien is recruited to hAR in the presence of the AR antagonist CPA binding to the LBD of AR. Nevertheless, Alien binds to the AR N terminus, which is known to harbor potent transactivation functions (35, 36, 37). This suggests that CPA induces a specific receptor conformation that allows binding of corepressors. Also interesting, an inhibitory domain containing the SUMOylation sites was shown to be localized in the hAR N terminus (32, 33). In line with this deletion of the inhibitory domain or mutating the SUMOylation sites of hAR, it leads to an increase of hAR-mediated transactivation. This indicates that inhibitory factors, such as corepressors, bind to the N-terminal region of hAR. Although two different SUMO-mutants of AR have been used (one with a conserved aa exchange), indicating that SUMOylation might have a possible role for binding to Alien, the in vitro results suggest that Alien binds non-SUMOylated AR at least in vitro, which expresses the notion that SUMOylation per se is not involved for binding of Alien to AR. Interestingly, the corepressor SMRT and Alien bind at least to a similar region of the hAR N terminus. Competition experiments and analyses with hAR deletions confirmed the possibility of at least overlapping binding sites on hAR. The interaction motif of the corepressors SMRT and Alien to mediate the binding to hAR is unknown and will be part of future experiments.

CPA is known to exhibit partial androgen agonism (38). We found this partial agonism to be dependent on the corepressor amount/concentration within a cell (13, 14). Overexpressing corepressors render CPA a potent antagonist. Similarly, corepressor recruitment can also be observed in the mutant AR-T877A. Notably, CPA inhibits the androgen-induced PSA expression in LNCaP cells (38), suggesting that CPA is also an antagonist for the AR mutant AR-T877A. An explanation could be that endogenous corepressors contribute to the CPA-induced inhibition of PSA expression. Thus, stable expression of Alien could therefore further enhance the inhibition of PSA expression.

The inhibition of colony formation by Alien, which was enhanced by CPA treatment, suggests a functional interaction with hAR to control proliferation of LNCaP cells. Endogenous corepressors might mediate the slight inhibition of colony formation by CPA using the empty vector control. The data also suggest that corepressors and corepressor-expression levels at target genes mediate antagonism. In addition, the level of antagonism seems to also be regulated at the level of signaling pathways (13, 39). Abrogation of one of these regulatory levels such as corepressor concentration, corepressor localization, and/or signaling pathways might be involved in the occurrence of refractory prostate cancer.

Thus, the findings suggest that corepressors such as Alien inhibit PSA expression and mediate the growth-inhibitory effect of anti-androgen-bound hAR. The data also suggest that the presence of functional corepressors is important to mediate growth inhibition by treatment with the androgen antagonist CPA. The presented results support the idea that corepressors are crucial molecular targets in prostate cancer therapy. Therefore, it will be very important to analyze in future whether aberrant corepressor function in prostate cancer could be a reason for therapy failure and the occurrence of refractory prostate cancer. The data shown in the present study, together with insights from future work, will give us the tools that are necessary to develop more efficient prostate cancer therapies.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Plasmids and Transfection Experiments
Expression and in vitro translation vectors for hAR, pCMX-C-SMRT, pCMX and the reporters used were generated using standard cloning techniques and were described earlier (13, 14, 30). pVP16-human Alien was generated by in-frame insertion of the Alien cDNA into pCMX-VP16. Information about pGEX-2T and pGST-hAlien were published elsewhere (22).

CV1 cells were grown in DMEM with 10% fetal bovine serum (FBS; GIBCO-Invitrogen, Carlsbad, CA) at 37 C with 5% CO2. Cotransfections were done using a modified CaPO4 method as described earlier (14). In total, 1 x 105 cells were seeded out in six-well dishes using DMEM supplemented with 10% charcoal-treated FBS and transfected 4 h later with 1 µg of reporter plasmid; 0.2 µg of AR expression constructs; 0.2 µg pCMV-LacZ for internal normalization; and 2 µg of VP16-Alien, VP16, pCMX-C-SMRT, or pCMX expression plasmids. Cells were treated with the antagonists (10–7 M) or the agonist R1881 (10–8 or 10–9 M) and harvested 72 h after transfection to measure both luciferase activity and ß-galactosidase activity for normalization. A higher concentration of antagonists was employed due to their lower affinity for AR. Independent duplicate or triplicate experiments were performed each time and were repeated at least three times. At least two different double CsCl gradient-purified plasmid preparations were used. Error bars represent the deviation of the mean value.

GST-Pull-Down
GST-pull-down experiments were performed as described before (24). Briefly, GST or GST-hAlien were bacterially expressed in the strain BL21(lys) via induction of the tac-promoter by adding 0.2 mM isopropyl-ß-D thiogalactopyranoside to the culture medium and incubation for 3 h at 37 C. Proteins were purified on a glutathione-sepharose resin (Amersham Biosciences, Little Chalfont, UK), and interaction studies were performed with in vitro-translated 35S-methionine labeled hAR fragments (TNT kit; Promega Corp., Madison, WI). In each experiment, the amount of the input lane was 10%, and the experiment was repeated at least twice. Bound proteins were separated on sodium dodecyl sulfate (SDS) gels and stained with Coomassie brilliant blue to ensure equal loading of GST fusion proteins. Bound and labeled proteins were detected by fluorography. In the case of full-length hAR, 10–7 M CPA was added to the translation and binding reactions.

ChIP
The growth conditions of LNCaP cells were described earlier (40, 41). After 3 d of cultivation with RPMI supplemented with 2% charcoal-treated FBS, cells were treated with 10–7 M CPA (Sigma, Munich, Germany) for 2 h. Nuclear proteins were cross-linked to DNA by adding formaldehyde directly to the medium, resulting in a final concentration of 1% at 37 C for 10 min. Cross-linking within the cells was stopped by adding glycine at a final concentration of 0.125 M and incubating at room temperature (RT) for 5 min on a rocking platform. Cells then were rinsed twice with ice-cold PBS, collected into ice-cold PBS supplemented with a protease inhibitor cocktail (Roche Diagnostics GmbH, Mannheim, Germany). After centrifugation, the cell pellets were resuspended in lysis buffer (1% SDS; 10 mM EDTA; 50 mM Tris-HCl, pH 8.0; and protease inhibitors). The lysates were sonicated on ice 10 times, 10 sec at 10% of maximum of power (Branson W-250/W; Branson Ultrasonics, Danbury, CT) to yield DNA fragments of 1000 bp in length. After centrifugation, supernatants were collected and diluted in ChIP dilution buffer (0.01% Triton X-100; 2 mM EDTA; 150 mM NaCl; 20 mM Tris-HCl, pH 8.0), followed by preclearing with 30 µl of salmon sperm DNA/protein A agarose 50% slurry (Upstate Biotechnology, Lake Placid, NY) for 1 h at 4 C with agitation. Immunoprecipitation was performed overnight at 4 C with the rabbit anti-AR antibody (Upstate Biotechnology) or with Alien-specific antibody [PEP AK-2 (22)]. The immunocomplexes were collected with 30 µl of salmon sperm DNA/protein A agarose 50% slurry for another 2 h with rotation at 4 C. Agarose beads were pelleted by centrifugation and washed sequentially for 10 min each with 1 ml of the following buffers: light salt wash buffer (0.1% SDS; 1% Triton X-100; 2 mM EDTA; 20 mM Tris-HCl, pH 8; and 150 mM NaCl), high salt wash buffer (0.1% SDS; 1% Triton X-100; 2 mM EDTA; 20 mM Tris-HCl, pH 8; and 500 mM NaCl), and LiCl wash buffer (0.25 M LiCl; 1% Nonidet P-40; 1% deoxycholate; 1 mM EDTA; and 10 mM Tris-HCl, pH 8). Finally, the beads were washed two times with TE buffer (10 mM Tris-HCl; 1 mM EDTA, pH 8). The immunocomplexes were eluted twice from the beads by adding freshly prepared elution buffer (1% SDS, 0.1 M NaHCO3). Eluates were pooled, and adding NaCl to the final concentration of 200 mM and heating at 65 C overnight reversed the cross-linking. The remaining proteins and RNA were digested by adding proteinase K (final concentration, 40 µg/ml) and RNase A (20 µg/ml), respectively, and incubating at 55 C for 3 h. The DNA fragments were purified with a DNA purification kit (QIAquick PCR Purification Kit; Qiagen, Hilden, Germany). ChIP experiments were repeated at least three times.

PCR
For PCR, 2 µl out of 50 µl DNA extraction were used for amplification. The cycling conditions were as follows: preincubation at 94 C for 3 min, 33 cycles of denaturation at 94 C for 45 sec, annealing at 60 C for 30 sec, and elongation at 72 C for 90 sec, and one final incubation at 72 C for 10 min. The PCR products were separated by electrophoresis through with 2.0% agarose supplemented with 2 µg/ml ethidium bromide. The primer sequences were as follows: ARE I-for, TCTGCCTTTGTCCCCTAGAT; ARE I-rev, AACCTTCATTCCCCAGGACT.

CoIP
LNCaP cells (41) were grown in RPMI 1640 supplemented with 2% (vol/vol) charcoal-dextrane-stripped FBS. After 3 d of cultivation, cells were treated with 10–7 M CPA (Sigma). After 2 h, cells were lysed on ice in lysis buffer containing 20 mM Tris (pH 7.5), 200 mM NaCl, 0.5% Nonidet P-40, and protease inhibitor cocktail complete (Roche, Basel, Switzerland). Cell debris was pelleted at 13,000 rpm at 4 C for 15 min. The extract was incubated at 4 C overnight together with a mixture of protein A-sepharose (Amersham Biosciences) and protein G-agarose (Sigma); coupled with Alien-specific antibody [PEP AK-2 (22)], anti-AR (F39.4.1; BioGenex Laboratories, San Ramon, CA), or normal rabbit IgG (Santa Cruz Biotechnology, Santa Cruz, CA); followed by several washing steps with washing buffer containing 20 mM Tris (pH 7.5), 100 mM NaCl, and 0.25% Nonidet P-40. The retained proteins were run on a SDS-PAGE. Western analysis was performed by using the anti-AR or anti-Alien antibody (22) with the enhanced chemiluminescence detection method (Amersham Pharmacia Biotech).

Immunofluorescence
Double immunofluorescence experiments were performed with PC3-ARwt (30) cells cultured on coverslips with charcoal-treated 10% FBS according to Zhang et al. (42). Exponentially growing cells were fixed with 2.5% paraformaldehyde in PBS for 20 min at RT and permeabilized with 0.5% Triton X-100 in cold PBS for 5 min. Cells were rinsed in blocking buffer (20% FBS; 10% glycerol; 100 mM glycine; 0.1% Triton X-100 in PBS, pH 7.4) for 30 min at RT and incubated with the primary antibody [PEP AK-2, 1:75 (22)] for 1 h at RT. After three washing steps (PBS with 0.1% Triton X-100), cells were incubated with the secondary antibody (fluorescein isothiocyanate-conjugated affinity pure goat antirabbit IgG (1:200; Dianova, Hamburg, Germany) for 60 min at RT. After extensive washings, coverslips were counterstained with 4',6'-diamidino-2-phenylindole dihydrochloride. Slides were mounted (3% n-propyle-gallate; 80% glycerole; 20 mM Tris, pH 7.5) and analyzed by confocal laser scanning microscopy (Leica TCS 4D; Leica Lasertechnik, Heidelberg, Germany).

Colony Formation
1.8 x 106 LNCaP cells (41) were seeded out for each 10-cm tissue culture dish and cultured for 2 d in RPMI (GIBCO-Invitrogen) containing normal, untreated 10% FBS (GIBCO-Invitrogen). N-1-(2,3-dioleoyloxy)propyl-N,N,N-trimethylammonium methylsulfate (DOTAP) transfection reagent was used according to the manufacturer’s protocol (Carl Roth GmbH, Karlsruhe, Germany), except the DNA-DOTAP complexes were added without prior dilution to the cells from which the culture medium was not aspirated. Serum free medium (Invitrogen) was used to transfect cells with pETE-Hyg control plasmid (41) or pETE-Hyg-Alien expression vector (each 5 µg for a 10-cm dish). Six to 24 h after transfection, the medium was changed and replaced with RPMI containing normal, untreated 5% FBS and 10–7 M CPA, 10–12 M R1881 (PerkinElmer, Schwerzenbach, Switzerland), or no additional hormone. After a further cultivation of 48 h, selection of transfected LNCaP cells was started by addition of 200 µg/ml hygromycin into the culture medium. Cells were cultured for approximately 2 wk; medium, hormones, and hygromycin were replaced every 2–3 d until untransfected control cells were completely killed by the selection. The surviving stably transfected LNCaP cells and colonies formed were cultured in the same 10-cm dishes for another 48 h. The colonies formed were counted either by using a microscope or after staining cells with crystal violet. Staining colonies with crystal violet was done by washing cells with PBS and subsequent fixation of cells with 1% glutaraldehyde solution for 10 min. Fixed colonies were again washed with PBS and then incubated in a 0.1% crystal violet solution for 30 min. The unbound dye was removed by repeated washing with double distilled H2O. The experiments were performed in triplicates and were repeated four times.

qRT-PCR for Detection of mRNA Levels
In total, 2 x 106 LNCaP or LNCaP-Alien cells were seeded out per 10-cm dish in RPMI containing 10% charcoal-stripped FBS. Seventy-two hours later, medium was replaced with fresh RPMI (10% charcoal-stripped FBS) plus indicated hormones. RNA was isolated 24 h after hormone induction using peqGOLD TriFast (Peqlab, Erlangen, Germany) according to the manufacturer’s protocol. Per sample, 0.88 µg RNA were used in a one-step qRT-PCR reaction using the SuperScript III Platinum SYBR Green One-Step qRT-PCR Kit (Invitrogen) with these primer sequences: PSA-forw, 5'-ACTGCATCAGGAACAAAAGCGTGA-3'; PSA-rev, 5'CGCACACACGTCATTGGAAATAAC-3'; ß-Actin-forw, 5'-ACAGAGCCTCGCCTTTGCCGA-3'; ß-Actin-rev, 5'-CACGATGGAGGGGAAGACG-3'.


   ACKNOWLEDGMENTS
 
We are grateful to Dr. F. Claessens (University of Leuven) for providing the expression vector for the AR mutant K385R/K518R.


   FOOTNOTES
 
This work was supported by a fellowship from the Schering Research Foundation to U.M. and to C.A.R. and grants from the German Research Council (BA1457/2) and Association of International Cancer Research (AICR) to A.B.

Present address for U.M.: Department of Molecular Cell Biology, Catholic University of Leuven, Herestraat 49, B-3000 Leuven, Belgium.

The authors have nothing to declare.

First Published Online March 13, 2007

Abbreviations: aa, Amino acid(s); AR, androgen receptor; ARE, androgen response element; Cas, casodex, bicalutamide; ChIP, chromatin immunoprecipitation; CoIP, coimmunoprecipitation; CPA, cyproterone acetate; CSN2, subunit 2 of the signalosome complex; DHT, dihydrotestosterone; FBS, fetal bovine serum; GST, glutathione S-transferase; hAR, human AR; hAlien, human Alien; LBD, ligand binding domain; OH-F, hydroxyflutamide; PSA, prostate-specific antigen; qRT-PCR, quantitative real-time PCR; R1881, methyltrienolone; RT, room temperature; RU486, mifepristone; SDS, sodium dodecyl sulfate; SMRT, silencing mediator for retinoic acid and thyroid hormone receptors; SUMO, small ubiquitin modifier.

Received for publication November 9, 2006. Accepted for publication March 6, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Brinkmann AO, Trapman J 2000 Prostate cancer schemes for androgen escape. Nat Med 6:628–629[CrossRef][Medline]
  2. Bray F, Sankila R, Ferlay J, Parkin DM 2002 Estimates of cancer incidence and mortality in Europe in 1995. Eur J Cancer 38:99–166[CrossRef][Medline]
  3. Andriole G, Bruchovsky N, Chung LW, Matsumoto AM, Rittmaster R, Roehrborn C, Russell D, Tindall D 2004 Dihydrotestosterone and the prostate: the scientific rationale for 5{alpha}-reductase inhibitors in the treatment of benign prostatic hyperplasia. J Urol 172:1399–1403[CrossRef][Medline]
  4. Ross R, Bernstein L, Judd H, Hanisch R, Pike M, Henderson B 1986 Serum testosterone levels in healthy young black and white men. J Natl Cancer Inst 76:45–48[Medline]
  5. Ntais C, Polycarpou A, Tsatsoulis A 2003 Molecular epidemiology of prostate cancer: androgens and polymorphisms in androgen-related genes. Eur J Endocrinol 149:469–477[Abstract]
  6. Culig Z, Klocker H, Bartsch G, Hobisch A 2002 Androgen receptors in prostate cancer. Endocr Relat Cancer 9:155–170[Abstract]
  7. Langley E, Zhou Z, Wilson EM 1995 Evidence for an anti-parallel orientation of the ligand-activated human androgen receptor dimmer. J Biol Chem 270:29983–29990[Abstract/Free Full Text]
  8. Doesburg P, Kuil CW, Berrevoets CA, Steketee K, Faber PW, Mulder E, Brinkmann AO, Trapman J 1997 Functional in vivo interaction between the amino-terminal, transactivation domain and the ligand binding domain of the androgen receptor. Biochemistry 36:1052–1064[CrossRef][Medline]
  9. Ikonen T, Palvimo JJ, Janne OA 1997 Interaction between the amino- and carboxyl-terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J Biol Chem 272:29821–29828[Abstract/Free Full Text]
  10. He B, Kemppainen JA, Wilson EM 2000 FXXLF and WXXLF sequences mediate the NH2-terminal interaction with the ligand binding domain of the androgen receptor. J Biol Chem 275:22986–22994[Abstract/Free Full Text]
  11. Balk SP 2002 Androgen receptor as a target in androgen-independent prostate cancer. Urology 60:132–139[CrossRef][Medline]
  12. Burke LJ, Baniahmad A 2000 Co-repressors 2000. FASEB J 14:1876–1888[Abstract/Free Full Text]
  13. Dotzlaw H, Moehren U, Mink S, Cato AC, Iniguez Lluhi JA, Baniahmad A 2002 The amino terminus of the human AR is target for corepressor action and antihormone agonism. Mol Endocrinol 16:661–673[Abstract/Free Full Text]
  14. Dotzlaw H, Papaioannou M, Moehren U, Claessens F, Baniahmad A 2003 Agonist-antagonist induced coactivator and corepressor interplay on the human androgen receptor. Mol Cell Endocrinol 213:79–85[CrossRef][Medline]
  15. Kang Z, Janne OA, Palvimo JJ 2004 Coregulator recruitment and histone modifications in transcriptional regulation by the androgen receptor. Mol Endocrinol 18:2633–2648[Abstract/Free Full Text]
  16. Berrevoets CA, Umar A, Trapman J, Brinkmann AO 2004 Differential modulation of androgen receptor transcriptional activity by the nuclear receptor co-repressor (N-CoR). Biochem J 379:731–738[CrossRef][Medline]
  17. Wang Q, Carroll JS, Brown M 2005 Spatial and temporal recruitment of androgen receptor and its coactivators involves chromosomal looping and polymerase tracking. Mol Cell 19:631–642[CrossRef][Medline]
  18. Yoon HG, Wong J 2005 The corepressors SMRT and N-CoR are involved in agonist- and antagonist-regulated transcription by androgen receptor. Mol Endocrinol 20:1048–1060[CrossRef][Medline]
  19. Shang Y, Myers M, Brown M 2002 Formation of the androgen receptor transcription complex. Mol Cell 9:601–610[CrossRef][Medline]
  20. Wang L, Hsu CL, Chang C 2005 Androgen receptor corepressors: an overview. Prostate 63:117–130[CrossRef][Medline]
  21. Lee JW, Choi HS, Gyuris J, Brent R, Moore DD 1995 Two classes of proteins dependent on either the presence or absence of thyroid hormone for interaction with the thyroid hormone receptor. Mol Endocrinol 9:243–254[Abstract]
  22. Dressel U, Thormeyer D, Altincicek B, Paululat A, Eggert M, Schneider S, Tenbaum SP, Renkawitz R, Baniahmad A 1999 Alien, a highly conserved protein with characteristics of a corepressor for members of the nuclear hormone receptor superfamily. Mol Cell Biol 19:3383–3394[Abstract/Free Full Text]
  23. Altincicek B, Tenbaum SP, Dressel U, Thormeyer D, Renkawitz R, Baniahmad A 2000 Interaction of the corepressor Alien with DAX-1 is abrogated by mutations of DAX-1 involved in adrenal hypoplasia congenita. J Biol Chem 275:7662–7667[Abstract/Free Full Text]
  24. Moehren U, Dressel U, Reeb CA, Vaisanen S, Dunlop TW, Carlberg C, Baniahmad A 2004 The highly conserved region of the co-repressor Sin3A functionally interacts with the co-repressor Alien. Nucleic Acids Res 32:2995–3004[Abstract/Free Full Text]
  25. Polly P, Herdick M, Moehren U, Baniahmad A, Heinzel T, Carlberg C 2000 VDR-Alien: a novel DNA-selective vitamin D(3) receptor-corepressor partnership. FASEB J 14:1455–1463[Abstract/Free Full Text]
  26. Tenbaum SP, Juenemann S, Schlitt T, Bernal J, Renkawitz R, Munoz A, Baniahmad A 2003 Alien/CSN2 gene expression is regulated by thyroid hormone in rat brain. Dev Biol 254:149–160[CrossRef][Medline]
  27. Bech-Otschir D, Kraft R, Huang X, Henklein P, Kapelari B, Pollmann C, Dubiel W 2001 COP9 signalosome-specific phosphorylation targets p53 to degradation by the ubiquitin system. EMBO J 20:1630–1639[CrossRef][Medline]
  28. Akiyama H, Sugiyama A, Uzawa K, Fujisawa N, Tashiro Y, Tashiro F 2003 Implication of Trip15/CSN2 in early stage of neuronal differentiation of P19 embryonal carcinoma cells. Brain Res Dev Brain Res 140:45–56[Medline]
  29. Lykke-Andersen K, Schaefer L, Menon S, Deng XW, Miller JB, Wei N 2003 Disruption of the COP9 signalosome Csn2 subunit in mice causes deficient cell proliferation, accumulation of p53 and cyclin E, and early embryonic death. Mol Cell Biol 23:6790–6797[Abstract/Free Full Text]
  30. Peterziel H, Mink S, Schonert A, Becker M, Klocker H, Cato AC 1999 Rapid signalling by androgen receptor in prostate cancer cells. Oncogene 18:6322–6329[CrossRef][Medline]
  31. Taplin ME, Bubley GJ, Ko YJ, Small EJ, Upton M, Rajeshkumar B, Balk SP 1999 Selection for androgen receptor mutations in prostate cancers treated with androgen antagonist. Cancer Res 59:2511–2515[Abstract/Free Full Text]
  32. Poukka H, Karvonen U, Janne OA, Palvimo JJ 2000 Covalent modification of the androgen receptor by small ubiquitin-like modifier 1 (SUMO-1). Proc Natl Acad Sci USA 97:14145–14150[Abstract/Free Full Text]
  33. Iniguez-Lluhi JA, Pearce D 2000 A common motif within the negative regulatory regions of multiple factors inhibits their transcriptional synergy. Mol Cell Biol 20:6040–6050[Abstract/Free Full Text]
  34. Callewaert L, Verrijdt G, Haelens A, Claessens F 2004 Differential effect of small ubiquitin-like modifier (SUMO)-ylation of the androgen receptor in the control of cooperativity on selective versus canonical response elements. Mol Endocrinol 18:1438–1449[Abstract/Free Full Text]
  35. Gast A, Schneikert J, Cato AC 1998 N-terminal sequences of the human androgen receptor in DNA binding and transrepressing functions. J Steroid Biochem Mol Biol 65:117–123[CrossRef][Medline]
  36. Alen P, Claessens F, Verhoeven G, Rombauts W, Peeters B 1999 The androgen receptor amino-terminal domain plays a key role in p160 coactivator-stimulated gene transcription. Mol Cell Biol 19:6085–6097[Abstract/Free Full Text]
  37. Brinkmann AO, Blok LJ, de Ruiter PE, Doesburg P, Steketee K, Berrevoets CA, Trapman J 1999 Mechanisms of androgen receptor activation and function. J Steroid Biochem Mol Biol 69:307–313[CrossRef][Medline]
  38. Chen F, Knecht K, Leu C, Rutledge SJ, Scafonas A, Gambone C, Vogel R, Zhang H, Kasparcova V, Bai C, Harada S, Schmidt A, Reszka A, Freedman L 2004 Partial agonist/antagonist properties of androstenedione and 4-androsten-3ß, 17ß-diol. J Steroid Biochem Mol Biol 91:247–257[CrossRef][Medline]
  39. Hong SH, Privalsky ML 2000 The SMRT corepressor is regulated by a MEK-1 kinase pathway: inhibition of corepressor function is associated with SMRT phosphorylation and nuclear export. Mol Cell Biol 20:6612–6625[Abstract/Free Full Text]
  40. Xiao F, Mirwald A, Papaioannou M, Baniahmad A, Klug J 2005 Secretoglobin 2A1 is under selective androgen control mediated by a peculiar binding site for Sp family transcription factors. Mol Endocrinol 19:2964–2978[Abstract/Free Full Text]
  41. Protopopov AI, Li J, Winberg G, Gizatullin RZ, Kashuba VI, Klein G, Zabarovsky ER 2002 Human cell lines engineered for tetracycline-regulated expression of tumor suppressor candidate genes from a frequently affected chromosomal region, 3p21. J Gene Med 4:397–406[CrossRef][Medline]
  42. Zhang R, Burke LJ, Rasko JE, Lobanenkov V, Renkawitz R 2004 Dynamic association of the mammalian insulator protein CTCF with centrosomes and the midbody. Exp Cell Res 294:86–93[CrossRef][Medline]

NURSA Molecule Pages Link:

Nuclear Receptors:   AR
Coregulators:   Alien  |  SMRT
Ligands:   Dihydrotestosterone  |  Mifepristone  |  Bicalutamide  |  R1881



This article has been cited by other articles:


Home page
 FASEB J.Home page
U. Moehren, M. Papaioannou, C. A. Reeb, A. Grasselli, S. Nanni, M. Asim, D. Roell, I. Prade, A. Farsetti, and A. Baniahmad
Wild-type but not mutant androgen receptor inhibits expression of the hTERT telomerase subunit: a novel role of AR mutation for prostate cancer development
FASEB J, April 1, 2008; 22(4): 1258 - 1267.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
H. V. Heemers and D. J. Tindall
Androgen Receptor (AR) Coregulators: A Diversity of Functions Converging on and Regulating the AR Transcriptional Complex
Endocr. Rev., December 1, 2007; 28(7): 778 - 808.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
21/5/1039    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moehren, U.
Right arrow Articles by Baniahmad, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moehren, U.
Right arrow Articles by Baniahmad, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals