Molecular Endocrinology, doi:10.1210/me.2006-0524
Molecular Endocrinology 21 (5): 1066-1081
Copyright © 2007 by The Endocrine Society
A Structural and in Vitro Characterization of Asoprisnil: A Selective Progesterone Receptor Modulator
Kevin P. Madauss,
Eugene T. Grygielko,
Su-Jun Deng,
Anthony C. Sulpizio,
Thomas B. Stanley,
Charlene Wu,
Steve A. Short,
Scott K. Thompson,
Eugene L. Stewart,
Nicholas J. Laping,
Shawn P. Williams and
Jeffrey D. Bray
Departments of Computational, Analytical and Structural Sciences (K.P.M., E.L.S., S.P.W.), and Gene Expression and Protein Biochemistry (S.-J. D., T.B.S., S.A.S.) GlaxoSmithKline Discovery Research, Research Triangle Park, North Carolina 27709; and Departments of Urogenital Biology (E.T.G., A.C.S., C.W., N.J.L., J.D.B.) and Medicinal Chemistry (S.K.T.), GlaxoSmithKline Cardiovascular and Urogenital Center for Excellence in Drug Discovery, King of Prussia, Pennsylvania 19406
Address all correspondence and requests for reprints to: Jeffrey D. Bray, GlaxoSmithKline Pharmaceuticals, 709 Swedeland Road, King of Prussia, Pennsylvania 19406. E-mail: jeffrey.d.bray{at}gsk.com.
 |
ABSTRACT
|
|---|
Selective progesterone receptor modulators (SPRMs) have been suggested as therapeutic agents for treatment of gynecological disorders. One such SPRM, asoprisnil, was recently in clinical trials for treatment of uterine fibroids and endometriosis. We present the crystal structures of progesterone receptor (PR) ligand binding domain complexed with asoprisnil and the corepressors nuclear receptor corepressor (NCoR) and SMRT. This is the first report of steroid nuclear receptor crystal structures with ligand and corepressors. These structures show PR in a different conformation than PR complexed with progesterone (P4). We profiled asoprisnil in PR-dependent assays to understand further the PR-mediated mechanism of action. We confirmed previous findings that asoprisnil demonstrated antagonism, but not agonism, in a PR-B transfection assay and the T47D breast cancer cell alkaline phosphatase activity assay. Asoprisnil, but not RU486, weakly recruited the coactivators SRC-1 and AIB1. However, asoprisnil strongly recruited the corepressor NCoR in a manner similar to RU486. Unlike RU486, NCoR binding to asoprisnil-bound PR could be displaced with equal affinity by NCoR or TIF2 peptides. We further showed that it weakly activated T47D cell gene expression of Sgk-1 and PPL and antagonized P4-induced expression of both genes. In rat leiomyoma ELT3 cells, asoprisnil demonstrated partial P4-like inhibition of cyclooxygenase (COX) enzymatic activity and COX-2 gene expression. In the rat uterotrophic assay, asoprisnil demonstrated no P4-like ability to oppose estrogen. Our data suggest that asoprisnil differentially recruits coactivators and corepressors compared to RU486 or P4, and this specific cofactor interaction profile is apparently insufficient to oppose estrogenic activity in rat uterus.
 |
INTRODUCTION
|
|---|
PROGESTERONE (P4) IS A steroid hormone essential for coordinating normal mammalian female reproductive physiology (1, 2, 3). The physiological actions of P4 are mediated by interaction with the progesterone receptor (PR), a member of the nuclear hormone superfamily of ligand-activated transcription factors (4, 5). Ligand-occupied PR binds directly to DNA at P4 response elements (6) and recruits coregulatory proteins that activate or repress transcription via interactions with the general transcription apparatus (7, 8, 9, 10). PR-dependent transcriptional specificity depends on the availability of PR isoforms and coregulatory factors in a target cell (11, 12, 13, 14). PRs can also interact with other transcription factors or signaling pathways to modulate transcriptional activity, such as AP-1 and the RelA(p65) subunit of nuclear factor-
B (15, 16, 17). They can also interact with Src kinase to activate MAPK signaling (18, 19) and compete for binding of general transcriptional machinery components, thus preventing access of other transcriptional activators in a process known as "squelching" (20, 21). Therefore, synthetic PR ligands could differentially affect transcription of PR target genes through selective recruitment of factors resulting in the differential regulation of gene expression in the various P4 target tissues.
There are two predominant receptor isoforms, designated PR-A and PR-B, transcribed from the same gene by two distinct promoters, with the only difference being that human PR-B is larger by an additional 164 amino acids at the amino terminus (22, 23, 24). As a result, PR-A and PR-B have differing transcriptional activities (11, 12, 25). Both isoforms have two activation function domains (AFs): the constitutive AF-1 proximal to the DNA-binding domain, and the ligand-dependent AF-2 domain in the C terminus (26, 27). There is a unique third AF, designated AF-3, in the amino terminus of PR-B that may contribute to its differential transactivational properties (28). Studies in mice with selective ablation of a PR isoform revealed that PR-A is necessary for ovulation and modulates the antiproliferative effects of P4 in the uterus, and PR-B is required for normal mammary gland development and function (29, 30). Recent evidence has confirmed the existence of a functional third isoform lacking both AF-2 and AF-3 domains, designated PR-C, that appears to be most critical for the onset of parturition (31). The presence of multiple PR isoforms potentially increases the specificity and versatility of hormone action in any given target tissue.
Synthetic progestins interact with PR to activate or repress gene expression in target cells in a manner similar to P4. Progestins are used for contraception, hormone therapy, and treatment of some gynecological disorders. The clinical profile of each progestin differs, but all have the ability to repress estrogen- induced endometrial proliferation in vivo (32). The ability of PR to repress estrogen receptor (ER) function has been demonstrated in vitro as well (11, 12, 13, 33). Often the inclusion of a progestin in contraception and hormone therapy is for its ability to repress the endometrial mitogenic effects of estrogens. PR antagonists oppose the action of P4, and the only clinically relevant therapeutic agent in this class is mifepristone (RU486). RU486 is used primarily for pregnancy termination in combination with the prostaglandin misoprostol, but it has usages for treatment of certain PR-mediated or gynecological conditions (34, 35). A third class of PR ligands now being developed are the selective PR modulators (SPRMs) (36, 37).
Asoprisnil (Fig. 1
) is a steroidal SPRM in late-stage clinical development that exhibits partial agonist/antagonist properties and tissue selective effects in animals and humans. The partial agonist effects of asoprisnil, unlike RU486, can be demonstrated by changes in the morphology of the rabbit uterine epithelium (McPhail test) and on the guinea pig uterus and vagina (36). However, the agonist effects of asoprisnil in the rabbit uterus never reached the level of maximum epithelial stimulation of a full agonist. Asoprisnil has at least one metabolite, designated J912 (Fig. 1
), that differs by a single hydrogen and also has activity on PR, albeit with reported reduced affinity and efficacy (38). In addition, asoprisnil had a unique endometrial effect based on histological examination of healthy cycling women when taken for 30 d (39). The preclinical and clinical data suggest that asoprisnil is a SPRM.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 1. Chemical Structures of PR Ligands Discussed in this Study
The Ki of these ligands used for human PR are (in nanomoles ± SE): P4, 4.3 ± 1.0; RU486, 0.82 ± 0.01; and asoprisnil, 0.85 ± 0.01 (obtained from Ref. 55 ).
|
|
The unique pharmacological properties of asoprisnil led us to undertake a detailed mechanistic study to elucidate its mode of action. Published data are scarce on the action of asoprisnil in standard cellular assays or rat pharmacology models used in pharmaceutical development. Our molecular and pharmacological characterization suggests that asoprisnil is different from both P4 and RU486. Asoprisnil induced interactions with both coactivators and corepressors via the ligand binding domain (LBD) of PR. Asoprisnil demonstrated mixed partial agonism/antagonism on endogenous cell-based endpoints, unlike either P4 or RU486. Finally, the weak partial agonism of asoprisnil was insufficient to oppose estrogen in the rat uterotrophic model, a classic pharmacological model of estrogen opposition.
 |
RESULTS
|
|---|
Crystal Structures of PR-LBD Bound to Asoprisnil/SMRT (2.1 Å) and Asoprisnil/Nuclear Receptor Corepressor (NCoR) (2.6 Å) Show the Antagonist Conformation of PR-LBD with Direct Ligand/Corepressor Interaction
The structure of the PR/asoprisnil/corepressor complex demonstrated that the functional changes associated with compound binding are matched by structural changes in the LBD of PR (PR-LBD) compared with the standard agonist position seen in the P4/PR-LBD crystal structure (pdb code: 1A28) (40). Surprisingly, the PR-F domain (residues 920933) maintained the same conformation in the agonist (P4) and antagonist (asoprisnil) complexes (Fig. 2
). Together with helix 11, the F domain defined two fixed points that limited AF-2 conformational changes to the flexible linker connecting helix 11 with the AF-2. Constrained by the fixed F domain and helix 11, the PR-LBD AF-2 helix shifted from the agonist conformation to pack antiparallel to helix 11 (Fig. 2
). This movement had two consequences: it made room for the longer corepressor helix, and it displaced Glu911, a residue observed to be critical for coactivator binding (41).

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 2. Overlay of PR Agonist Conformation with PR Antagonist Conformation
A, Overlay of PR agonist conformation with PR antagonist conformation. Cyan is PR from the asoprisnil/SMRT structure, yellow is the corepressor peptide SMRT, and green is PR from the P4 structure. Note that the peptide clashes with the AF-2 of the P4 structure. B, Same overlay as panel A, but the view is rotated 180°.
|
|
The two PR/asoprisnil/corepressor complex crystal structures overlay well with each other, as seen in Fig. 3A
, and the general position and orientation of the peptide agree with that seen in the complex with peroxisome proliferator-activated receptor (PPAR)-
(40). The statistics for the PR/asoprisnil/corepressor structures presented here are in Table 1
. The corepressors NCoR and SMRT contain the LXXLL motif, which is a common motif for coactivators and corepressors within the nuclear receptor superfamily (42). Specifically, NCoR and SMRT contain the LXXXIXXXL/I motif that is found to interact with antagonist-bound nuclear receptor (NR)-LBD complexes (43). Although the NCoR and SMRT peptides were 25 and 17 residues long, respectively, only the common 12-residue region of the corepressors was seen in the crystal structures. The polar 11ß-benzaldoxime substituent of asoprisnil is 3.22 Å from Leu917 in NCoR and 3.16 Å from the corresponding leucine (2263) in SMRT. Mifepristone (RU486) differs from asoprisnil in that a less polar dimethyl amine replaces the benzaldoxime substituent (Fig. 1
). This replacement allows for a potentially stronger hydrophobic interaction between RU486 and the corepressor that may account for the increased recruitment of corepressors by RU486. The corepressor peptides also had specific polar interactions with residues of PR- Arg740 on the loop between helix 3 and helix 4, Lys734 on helix 3, and Glu752 on helix 4, as well as hydrophobic interactions that stabilize the corepressor binding.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 3. Overlay of PR/Asoprisnil Complexed with SMRT or NCoR Corepressor Structures
A, Asoprisnil/SMRT structure (yellow) and SMRT (purple), overlaid with asoprisnil/NCoR structure (blue) and NCoR (blue). Note the asoprisnil interaction with the leucine in the corepressor peptides. The leucine in the SMRT structure is 3.16 Å from the ligand asoprisnil. B, Asoprisnil/SMRT structure (yellow) and the P4 structure (green) binding pockets overlaid with the ligands in bold. Note that the 11ß extension of asoprisnil collides with Met909 of the P4 binding pocket.
|
|
The A-ring ketone interactions with Arg684 and Gln725 of PR appeared to lock the steroidal asoprisnil into the same orientation and position as P4 (Fig. 3B
), but the asoprisnil 11ß pendant group occupied the same space in the pocket as the side chain of the AF-2 residue Met909. To accommodate the asoprisnil pendant group within the ligand pocket, the AF-2 was pushed out of the agonist position and adopted the alternate conformation observed. This movement created a T-shaped binding pocket that differed from the basically planar binding site observed in the P4-containing crystal structure (Fig. 3B
) (44).
Mammalian Two-Hybrid and Fluorescence Polarization Interaction Assays with NCoR Confirmed that Asoprisnil Can Induce an Antagonist-Like Conformation of the PR-LBD
To confirm the crystallographic observations, we used a mammalian two-hybrid assay to examine the effect of asoprisnil on the PR-LBD. This assay measures the ability of certain PR antagonists to promote an interaction between the PR-LBD and the C-terminal domain of NCoR. The PR antagonist RU486 had an EC50 of 0.04 nM, and asoprisnil similarly induced a concentration-dependent (EC50 = 0.02 nM) interaction with 73% efficacy compared with RU486 (Fig. 4
). In addition, fluorescence polarization showed that the relative potency of asoprisnil-induced NCoR peptide recruitment was less than RU486 but more that P4 (Fig. 5A
) and is consistent with the observed interaction of asoprisnil with the corepressor peptides in the solved crystal. The ability of transcription intermediary factor 2 (TIF2) coactivator or NCoR corepressor peptides to compete for the binding of fluorescent NCoR peptide to asoprisnil or RU486 bound to glutathione-S-transferase (GST)-PR was investigated. Unlabeled NCoR and TIF2 peptides successfully competed for binding with RU486 as the ligand; however, NCoR displayed approximately 10-fold more affinity than TIF2 (Fig. 5B
). In contrast, both TIF2 and NCoR displayed similar affinities when asoprisnil was the ligand (Fig. 5C
). These data confirmed that asoprisnil induced an antagonist-like conformational change to the PR-LBD, consistent with the structural analyses; however, asoprisnil produced a unique coactivator and corepressor peptide interaction profile compared with RU486.

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 4. Asoprisnil and RU486 Induced a Functional Interaction between PR-LBD and NCoR C-Terminal Domain in a Mammalian Two-Hybrid Assay
Plasmids expressing the chimeric proteins VP16/PR-LBD and GAL4/NCoR, and a GAL4-luciferase reporter plasmid (pGL5-luc) were transiently transfected into COS-7 cells. At 24 h after transfection, cells were treated with increasing concentrations (1015 to 107 M) of P4, asoprisnil, or RU486 for another 24 h, and then luciferase activity was measured as described in Materials and Methods. The data for asoprisnil (73%), RU486 (100%), and P4 (3%) are from four independent experiments and represented as mean relative luciferase units ± SEM normalized to maximal RU486 activity equal to 100%.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 5. Affinities of Coactivator and Corepressor Peptides for GST-PR-LBDs Purified with Ligands
A, The apparent affinities of GST-PR-LBDs purified with RU486 (circles), asoprisnil (triangles), or P4 (squares) were determined by fluorescence polarization using a fluorescein-labeled NCoR peptide. Each data point is represented as mean ± SD. Apparent affinities from four independent measurements are 0.75 ± 0.2 µM (RU486), 1.5 ± 0.2 µM (asoprisnil), and 7.0 ± 0.4 µM (P4). B and C, Inhibition of GST-PR-LBD (2 µM) purified with asoprisnil (B) or RU486 (C) binding to 5 nM fluorescein NCoR peptide by dimethylsulfoxide (circles), NCoR (triangles), and TIF2 (squares). Apparent affinities for the NCoR peptide are 2.4 ± 0.3 µM with asoprisnil and 1.5 ± 0.4 µM with RU486. Apparent affinities for the TIF2 peptide are 1.9 ± 0.2 µM with asoprisnil and 14 ± 2 µM with RU486.
|
|
Asoprisnil Demonstrated Full PR Antagonism in CV-1 Cells Transfected with Human or Rat PR
Asoprisnil demonstrated no agonist activity in CV-1 cells cotransfected with full-length human or rat PR-B and with luciferase under control of the PR-responsive mouse mammary tumor virus (MMTV) promoter (Fig. 6A
). Asoprisnil also had no agonist activity when tested using human PR-A, which has significantly reduced activity compared with PR-B when agonist bound (data not shown). Asoprisnil and RU486 demonstrated full antagonism of P4-stimulated activity (Fig. 6B
). In these cotransfection assays asoprisnil displayed similar potency at the human or rat PR-B, having IC50 values of 1.0 and 1.6 nM, respectively. This potency was less than that of RU486, which had IC50 values of 0.005 and 0.002 nM for human and rat PR-B, respectively. Asoprisnil, like RU486, was a full antagonist in this standard in vitro progestational assay.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 6. Asoprisnil Demonstrated Only Antagonism in Human or Rat PR-B Ligand-Dependent MMTV-Luciferase Activity in CV-1 Cells
Plasmids expressing either full-length human or rat PR-B and a MMTV-luciferase reporter plasmid were transiently transfected into CV-1 cells. At 24 h after transfection, cells were treated with increasing concentrations (1014 to 105 M) of P4, asoprisnil, or RU486 for another 24 h, and then luciferase activity was measured as described in Materials and Methods. A, Asoprisnil was unable to stimulate luciferase activity through human or rat PR-B in a ligand-dependent manner. B, Asoprisnil and RU486 demonstrated full antagonism as assayed by the ability to oppose 10 nM P4. The data are from three independent experiments and are represented as mean relative luciferase units ± SEM normalized to maximal P4 activity equal to 100%.
|
|
Asoprisnil, But Not RU486, Demonstrated Partial Agonism/Antagonism on Steroid Receptor Coactivator (SRC-1) and Amplified in Breast Cancer 1 (AIB1) Coactivator Recruitment with Reduced Efficacy Compared with P4
Because asoprisnil has been reported to demonstrate P4-like agonism in selected species and tissues and we demonstrated the interaction of a coactivator peptide (Fig. 5C
), the ability of asoprisnil to facilitate the interaction of the PR-LBD and coactivators was examined. Taking advantage of the fact that NR coactivator proteins have endogenous transcriptional potentiating activities, full-length coactivators were cotransfected with galactosidase-4 (GAL4)/PR-LBD. P4 induced full-length SRC-1 and AIB1 to interact with the PR-LBD with EC50 values of 0.55 and 1.3 nM, respectively (Fig. 7
, A and B). Interactions between SRC-1 and AIB1 were induced by asoprisnil-bound PR-LBD and demonstrated activity that was 23 and 21% of P4, respectively, whereas RU486 failed to show detectable interaction with either coactivator (Fig. 7
, A and B). RU486 could fully antagonize P4-stimulated activity for both SRC-1 and AIB1, but asoprisnil only partially antagonized SRC-1- and AIB1-dependent activities by 49 and 43%, respectively (Fig. 7C
). Consistent with the peptide competition data, SRC-2/TIF-2 also demonstrated this profile (data not shown). These data suggest that asoprisnil is a PR modulator with partial agonist properties in ligand-dependent coactivator recruitment to the PR-LBD.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 7. Asoprisnil Demonstrated the Ability to Weakly Recruit Coactivators via the PR-LBD in COS-7 Cells
Plasmids expressing the chimeric protein GAL4/PR-LBD and either full-length coactivators and a GAL4-luciferase reporter plasmid (pGL5-luc) were transiently transfected into COS-7 cells. At 24 h after transfection, cells were treated with increasing concentrations (1015 to 105 M) of P4, asoprisnil, or RU486 for another 24 h, and then luciferase activity was measured as described in Materials and Methods. A, Asoprisnil (23%) weakly induced an interaction between GAL4/PR-LBD and SRC-1. B, Asoprisnil (21%) weakly induced an interaction between GAL4/PR-LBD and AIB1. C, Asoprisnil partially antagonized SRC-1 by 49% and AIB1 by 43%, whereas RU486 fully antagonized 10 nM P4-stimulated luciferase activity with either coactivator. The data are from four independent experiments and represented as mean relative luciferase units (RLU) ± SEM normalized to maximal P4 activity equal to 100%.
|
|
Asoprisnil, But Not RU486, Demonstrated Weak Activation of Serum Glucocorticoid Kinase-1 (Sgk-1) and Periplakin (PPL) Gene Expression in T47D Breast Cancer Cells
The ability of asoprisnil to facilitate interactions with coactivators in a heterologous system suggested that asoprisnil may exhibit agonism in an endogenous system. The T47D breast cancer cell line is well characterized and P4-responsive, expressing high, constitutive levels of endogenous PR. We confirmed that asoprisnil had no detectable agonism in the commonly used T47D cell alkaline phosphatase assay (45, 46). However, asoprisnil was a full and potent antagonist with an IC50 of 2 nM against P4-induced activity; this was comparable to RU486 with IC50 of 0.3 nM. Although these data are consistent with our PR-B transfection data, it may be that this assay has insufficient sensitivity to detect very weak partial agonism.
There is a significant amount of literature describing PR-mediated gene expression in T47D breast cancer cells (14, 47). To investigate the effects of asoprisnil on gene expression, we selected two genes that have been demonstrated to be PR-regulated with large and consistent fold-change expression by agonists: Sgk-1 (48) and PPL (Ref. 49 ; and Grygielko, E. T., and J. D. Bray, unpublished data). Asoprisnil demonstrated weak, but significant agonism on PPL gene expression with a maximal induction of 2.5-fold (15% of P4), whereas RU486 failed to stimulate PPL expression (Fig. 8A
). Asoprisnil significantly antagonized by 80% and RU486 fully antagonized P4-induced PPL expression (Fig. 8B
). Similar results were obtained for P4-stimulated Sgk-1 expression with a maximal 3.9-fold increase (5% of P4), with RU486 having no detectable agonism (Fig. 8C
). Asoprisnil and RU486 inhibited P4-stimulated Sgk-1 expression by 95 and 99%, respectively (Fig. 8D
). Using sensitive P4-responsive endpoints, we showed that asoprisnil demonstrated weak partial agonism on selected T47D cell gene expression.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 8. Asoprisnil Demonstrated Weak Partial Agonist Activity on Endogenous PPL and Sgk-1 Gene Expression in T47D Human Breast Cancer Cells
After 24 h of serum starvation, T47D cells were treated with increasing concentrations (1014 to 106 M) of P4, asoprisnil, or RU486 for 18 h, then RNA was extracted and subjected to quantitative TaqMan RT-PCR analysis as described in Materials and Methods. A, Concentration response showed that asoprisnil had weak agonism (15%) on PPL gene expression, whereas RU46 was inactive. B, Asoprisnil (100 nM) demonstrated 80% partial antagonism compared with RU486 (100 nM) on 10 nM P4-stimulated PPL gene expression. C, Concentration response showed that asoprisnil had weak agonism (5%) on Sgk-1 gene expression, whereas RU46 was inactive. D, Asoprisnil (100 nM) demonstrated reduced antagonism compared with RU486 (100 nM) on 10 nM P4-stimulated Sgk-1 gene expression (95% vs. 99%, respectively). The data are from three independent experiments and represented as fold induction ± SEM normalized with RPL32 gene expression. *, P < 0.05; **, P < 0.001.
|
|
Asoprisnil Demonstrated Partial Agonism/Antagonism on Cyclooxygenase (COX)-2 Gene Expression in Rat ELT-3 Cells, But Only Partial Antagonism on COX Activity
The agonist and antagonist activity of asoprisnil was also profiled in rat ELT3 cells. ELT3 cells are neoplastic uterine leiomyoma cells derived from the Eker strain of rat that contain functional ERs and PRs (50). It is known that P4 via PR can inhibit the activity of COX in the myometrium and that a functional withdrawal of P4 precedes myometrial contractions (51, 52, 53). We observed that P4 produced a concentration-dependent decrease in COX enzyme activity in ELT3 cells (Fig. 9A
). 17ß-Estradiol (E2) alone had no effect in this assay and did not affect the P4 COX inhibition curve. RU486 also had no effect on basal COX activity, but could fully reverse the P4-dependent repression (Fig. 9B
). Asoprisnil alone did not repress COX activity in a P4-like manner but, in contrast to RU486, only partially reversed P4-dependent repression by 32% (Fig. 9B
). This lack of functional PR-mediated agonist activity was similar to the lack of observable asoprisnil-induced alkaline phosphatase in T47D cells. To confirm and extend these observations, we measured COX-2 gene expression from a matched sample set used for the COX enzyme assay. The COX-2 gene expression correlated well with activity (Fig. 9
, CE), and additionally, asoprisnil repressed COX-2 expression alone (Fig. 9E
). ELT6 cells, which lack PR, failed to show P4 repression of COX confirming the requirement of PR in these cells (data not shown). The reduced efficacy of asoprisnil compared with RU486 in reversing P4-suppressed COX activity may partially explain the reduced abortifacient character of asoprisnil in preclinical studies.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 9. Asoprisnil and RU486 Antagonized P4-Mediated Inhibition of COX Enzymatic Activity in ELT3 Cells
After 24 h of serum starvation, ELT3 cells were treated with increasing concentrations of E2, P4, asoprisnil, or RU486, or E2 (10 nM) plus increasing concentrations of P4, asoprisnil, or RU486 for 24 h. A and B, Arachidonic acid (105 M) was added, the supernatant was removed, and PGE2 production was measured by EIA as described in Materials and Methods. CE, RNA was extracted from the cells and subjected to quantitative TaqMan RT-PCR analysis as described in Materials and Methods.
|
|
Asoprisnil Could Not Oppose E2, But Antagonized P4 in the Rat Uterotrophic Model
Because the cellular data suggested that asoprisnil was a weak partial agonist, we examined the ability of asoprisnil to oppose E2 in the rat uterotrophic model. In this model, P4 inhibits the E2-driven increase in uterine wet weight. In addition to uterine wet weight change, gene expression was employed as another endpoint because it has proven more sensitive than physiological readouts. Asoprisnil had no effect on E2-induced uterine wet weight gain and, in fact, antagonized the ability of P4 to oppose E2 (Fig. 10A
). The lack of P4-like activity for asoprisnil in this model is consistent with results previously reported (45). Furthermore, we observed that asoprisnil, unlike P4, did not oppose E2-induced up-regulation of C3 and c-fos gene expression and, indeed, asoprisnil could inhibit P4-induced suppression of these genes (Fig. 10
, B and C). Investigation with other gene expression markers yielded no detectable E2-opposition via gene expression (data not shown).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 10. Asoprisnil Did Not Decrease E2-Stimulated Uterine Wet Weight and Gene Expression Activities and Antagonized the Antiestrogenic Activities of P4 on the Rat Uterus
Ovariectomized Sprague-Dawley rats were treated daily with vehicle, E2 (0.08 mg/kg), P4 (10 mg/kg), asoprisnil (30 mg/kg), E2 plus P4, E2 plus asoprisnil, or E2 plus P4 plus asoprisnil for 2 d. The animals were killed, and the whole uterus was carefully excised, trimmed, blotted, and weighed. Tissue was snap-frozen in liquid nitrogen for later RNA extraction. RNA was extracted from the tissue and subjected to quantitative TaqMan RT-PCR analysis as described in Materials and Methods. P4 can reverse these endpoints, but asoprisnil does not. Furthermore, asoprisnil blocked the effects of P4 (n = 5 or 6). a, P < 0.05; b, P < 0.01, compared with vehicle; c, P < 0.05; d, P < 0.01 compared with E2 only.
|
|
 |
DISCUSSION
|
|---|
Here, we report a comprehensive characterization of asoprisnil and begin to develop a profile for pharmaceutical development of novel SPRMs. Asoprisnil as a SPRM, was developed primarily in animal pharmacology models; thus, there is a general lack of published in vitro data (38). Notably lacking was information around the conformation that asoprisnil induced on PR. Cocrystal structural studies of the PR-LBD with repressor peptides demonstrate that asoprisnil induces a conformational shift in the AF-2 helix that favorably permits corepressor binding, as well as a direct interaction of asoprisnil with the corepressor. A mammalian two-hybrid system confirmed that asoprisnil could induce an interaction of the PR-LBD with the corepressor NCoR in a concentration dependent manner.
The PR/asoprisnil complex crystal structure was solved in the presence of peptides from the corepressors SMRT (pdb code: 2OVH) and NCoR (pdb code: 2OVM). These structures revealed how specific interactions with the compound produced a dramatic rearrangement of the AF-2, favoring corepressor binding. A direct contact between the compound and a side chain on the corepressor peptide was observed, which may account for the decreased affinity of corepressor for PR/asoprisnil relative to PR/RU486. This direct contact also suggests the possibility that ligands can be designed to influence specific cofactor binding. The asoprisnil/SMRT structure is overlaid with the PPAR/SMRT structure (pdb code: 1KQQ) in Fig. 11
(54). The ligand in the PPAR structure (GW6471) does not interact with the SMRT peptide, and the AF-2 helix is in a different conformation from the PR/asoprisnil structure. The different AF-2 helix conformations show that for antagonist conformations in NRs, it is more important that the AF-2 moves to disrupt the coactivator binding groove and make room for the corepressor than where the AF-2 is moved.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 11. Overlay of PR/Asoprisnil/SMRT with PPAR /GW4671/SMRT
A, The PR protein is in cyan, the PPAR protein is in magenta, the PR/SMRT and asoprisnil is in yellow, and the PPAR/SMRT and ligand is in orange. Note that the corepressors have the same general position and orientation, but that the PPAR/SMRT is closer to the protein. B, The proteins have been dropped, and the ligands and SMRT peptides remain. Note that the PPAR ligand does not interact with the PPAR SMRT.
|
|
These data are consistent with data that suggest asoprisnil induced a conformation inconsistent with PR agonism in an ELISA-like assay (55). However, the structure also revealed that, whereas coactivator peptide-bound PR-LBD complexed with asoprisnil was not obtained, there was the potential to interact with coactivators. This potential for coactivator interaction was confirmed by the ability of asoprisnil to induce a weak interaction of full-length SRC-1 or AIB1 with the PR-LBD (Fig. 4
), and peptide competition experiments demonstrating that NCoR interaction with asoprisnil-bound to GST-PR could be competed with TIF2 coactivator peptides (Fig. 5C
). These data suggest an inherent flexibility of NR-LBDs for ligands, because RU486 and asoprisnil have differential activities based on the profiling we have performed. The data suggest that asoprisnil induced a conformation in the PR-LBD more favorable for interaction with corepressors, but we cannot rule out potential enhanced molecular interaction of coactivators with the AF-1 domain when asoprisnil is bound to full-length PR. The constructs used to generate the physical interaction data lack the AF-1 region, and this region has been shown to be involved in the partial agonism detected for RU486 (56). However, the physiological or pharmacological relevance is not well understood because our assays involving full-length PR fail to show any further increase in agonism compared with the coactivator recruitment assay data. Indeed, our data suggest a weak partial agonist/strong partial antagonist character for asoprisnil.
Interaction of the corepressor NCoR with asoprisnil-bound PR was consistently observed in our studies. NCoR is an essential gene product (57), but the relevance of corepressor interaction with steroid NRs is poorly understood. Although antagonist-bound receptors interact with corepressors (reviewed in Ref. 58), to our knowledge, no endogenous ligand for this class demonstrates physiological activities with corepressors. Because these experiments presented are not exhaustive, it may be hypothesized that the most significant PR agonism demonstrated by asoprisnil will be found in cells, tissues, or species that have an excess of coactivator proteins, a specific coactivator, or a ratio favoring coactivators compared with corepressor proteins. It has been shown that altering the ratios or levels of coactivator proteins results in enhanced agonism for RU486 (59). However, due to the large number of bona fide cofactors already identified, establishing the relevant cofactors for a given ligand will be difficult.
The coactivators SRC-1 and AIB1 are physiologically relevant for PR based on genetic manipulation studies in mice performed in the OMalley laboratory. Targeted disruption of SRC-1 resulted in a severe reproductive phenotype, especially in the uterus (60), whereas AIB1 knockout animals showed impaired mammary gland development and function (61). Recently, use of a PRAI transgene on the background of mice lacking SRC-1 or AIB1 confirmed the contribution of PR to the phenotypes; suggesting that SRC-1 is the predominant PR-used coactivator in the uterus, and PR predominantly recruits AIB1 in the mammary gland (62, 63). Pharmacological evaluation of SPRMs in these animals may provide a way to improve the therapeutic index by demonstrating tissue-selective activation of the transgene. Again, it is possible that asoprisnil may recruit other coactivators for PR, thus explaining a potential discrepancy among assays and species.
We observed that asoprisnil had assay-dependent effects, appearing as either a pure antagonist or a weak partial agonist. In both CV-1 cells transfected with PR-B and the T47D alkaline phosphatase assay, asoprisnil was a pure antagonist. Asoprisnil, like RU486, exhibited no P4-like inhibition of COX enzymatic activity in ELT3 cells. But unlike the complete reversal of P4 suppression of COX activity produced by RU486, asoprisnil could only partially reverse the P4 suppression. Examining COX-2 gene expression in these PR-responsive cells, asoprisnil demonstrated partial P4-like agonism inversely correlating to its degree of antagonism. Despite these suggestions of agonist activity, asoprisnil was never observed to have agonism efficacy comparable to P4 in any assay.
To increase our ability to detect weak agonism, we chose genes with large fold induction after P4 stimulation in T47D cells. These genes demonstrate no PR isoform selectivity and represent both direct (Sgk-1) and indirect (PPL) regulation (Ref. 14 ; and Bray, J. D., K. B. Horwitz, and C. R. Lyttle, unpublished data). Examination of genes with less robust induction (>10-fold) failed to demonstrate asoprisnil-induced activation (data not shown). In general, the observed gene expression changes were more sensitive for identifying activities than transfection-based or functional assays but, in turn, suffer from the inability to control for certain variables, such as the presence of other NRs and cofactors or the concentrations and ratios of such.
Ultimately, the weak partial agonistic character exhibited by asoprisnil in some cell-based assays did not translate into PR-mediated antiestrogenic uterine activities in the rat. Indeed, asoprisnil was previously reported to be relatively inactive in the rat uterotrophic assay and could induce labor in rodents, consistent with a high degree of PR antagonism (45). However, in the highly sensitive McPhail test of estrogen-primed immature rabbit epithelium, asoprisnil exhibits both significant agonism and antagonism, albeit reduced compared with P4 and RU486, respectively (36). It may be that because the rabbit has only the PR-B isoform that asoprisnil has increased agonism in that model due to the lack of potential PR-A mediated inhibition of PR-B (64). Additionally, asoprisnil demonstrated PR agonism in guinea pig luteolysis inhibition and lack of labor-inducing activity (36). We also confirmed these findings in guinea pigs (Sulpizio, A. C., unpublished data). Preliminary in vitro experiments with primary guinea and rat endometrial stromal cells do not show any clear asoprisnil-mediated agonistic differences (Grygielko, E. T., and J. D. Bray, unpublished data). These preclinical effects clearly reflect the mixed agonism/antagonism of asoprisnil and may be suggestive of species-selective activity. Asoprisnil is metabolized to a less efficacious SPRM, J912, as evaluated by the rabbit epithelial transformation assay (45), although this appears not to matter in the rabbits because asoprisnil is more efficacious than J912. Because it has been reported that asoprisnil undergoes similar metabolism to J912 in a variety of species including rats, it may explain the lack of detectable efficacy in our uterotrophic model. However, confirmation would require additional pharmacokinetic/pharmacodynamic evaluations comparing both asoprisnil and J912. Because asoprisnil is the most advanced SPRM in terms of clinical development, the predictive value of the animal model is less well understood compared with full PR agonists.
Receptor modulators are distinct from traditional ligands of NRs in that they possess both tissue-dependent antagonist and agonist activity. The concept of NR modulation has been successfully demonstrated for the ER, and the discovery of tamoxifen, the first selective ER modulator (SERM) has provided an effective therapy for estrogen-dependent breast cancer (65). However, tamoxifen demonstrated weak partial agonism on the uterus. Second-generation representatives of these agents such as raloxifene are able to fully antagonize estrogen activity in the uterus while maintaining sufficient agonist activity on bone ERs (66). For PR ligands, SPRMs, as represented by asoprisnil, exhibit partial agonist/antagonist and/or tissue selective effects. Agents of this type may provide improved therapies for the treatment of uterine proliferative diseases such as endometriosis and leiomyoma. Because it is possible that SPRMs are less transcriptionally active than progestins and less transcriptionally repressive than PR antagonists, they may provide the benefits of each class, without the undesired adverse events. For progestins, these include weight gain, breast tenderness, acne, breakthrough bleeding, loss of libido, and mood effects; and for antiprogestins (defined by RU486), these include abortifaciency, endometrial thickening, and potential antagonism of other NRs. At this time, it is not understood where the balance of therapeutic efficacy and reduced adverse effects lies. However, it is likely that the weak agonist/strong antagonist character of asoprisnil will oppose long-term progestogenic actions on the uterus in humans, thus limiting its therapeutic potential to conditions that do not rely on PR agonism for efficacy, or for a reduced duration of treatment.
 |
MATERIALS AND METHODS
|
|---|
PR-LBD (residues 678933) was expressed and purified as described previously (67) with the following modifications. NCoR or SMRT corepressor peptide (SMRT 23372353: TNMGLEAIIRKALMGKY; NCoR 20512075: GHSFADPASNLGLEDIIRKALMGSF) was added to GST-PR fusion protein (GST-PR 1:2 peptide).
The protein was concentrated to 4 mg/ml. The PR/NCoR/asoprisnil complex crystallized spontaneously in the fraction collection tube simply requiring the collection of crystals. The collection was accomplished by pipetting the protein solution directly from the fraction collection tube onto a cover slide and harvesting the largest crystals. The crystals were frozen by quick dunk in 25% glycerol. The PR/SMRT/asoprisnil crystals came from 10% PEG 3350, 0.4 M NaCl, 0.1 M Tris (pH 8.0), and were frozen by slow exchange in 25% glycerol. The crystal structures were solved using the molecular replacement program Amore (PR-LBD/P4 structure as a model pdb code 1A28), and built and refined using Quanta/CNX. The data sets were collected at IMCA-17ID at the Advanced Photon Source.
The fluorescence polarization assay was conducted using varied concentrations of GST-PR-LBDs purified in the presence of ligand and incubated with 10 nM of fluorescein-labeled NCoR peptide [NCoR2 20512075 (GHSFADPASNLGLEDIIRKALMGSF)] in 10 mM HEPES (pH 7.4), 0.15 M NaCl, 3 mM EDTA, 0.005% polysorbate-20, and 5 mM dithiothreitol in a final volume of 40 µl in black 384-well plates for 2 h at room temperature. Plates were read using the Fusion FP plate reader using 485 nm excitation and 520 nm emission filters. Binding curves were plotted, and apparent affinities were determined by nonlinear least squares fit of the data to a simple 1:1 interaction model. Competition assays were done by competing the binding of 2 µM GST-PR-LBDs to 5 nM of the fluorescein-labeled peptide in the presence of 20 µM ligand by either the NCoR (GHSFADPASNLGLEDIIRKALMGSF) or TIF2 732 to 756 (QEPVSPKKKENALLRYLLDKDDTKD) peptides.
Chemicals and Reagents
P4, RU486, and 17ß-estradiol (E2) were purchased from Sigma Chemical Co. (St. Louis, MO). Asoprisnil was synthesized for GlaxoSmithKline CVU CEDD Medicinal Chemistry (according to the method described in Ref. 68). These compounds were prepared in 100% ethanol for in vitro assays. P4 and E2 were diluted into a vehicle of 10% ethanol/90% corn oil, and asoprisnil was prepared in a vehicle consisting of 3% dimethylsulfoxide/6% Cavitron (pH 3.5) before administration to the animals. Tissue culture medium reagents were purchased from Invitrogen (Carlsbad, CA), except for fetal bovine serum (FBS), which was purchased from HyClone (Logan, UT).
Cell Culture
T47D human breast carcinoma cells and ELT-3 rat leiomyoma cells (obtained from Cheryl Walker, University of Texas MD Anderson Cancer Center) were maintained in DMEM/F12 supplemented with 10% FBS, 2 mM glutamine, and penicillin/streptomycin (Invitrogen) at 37 C in a humidified incubator with 5% CO2. CV-1 African green monkey cells and COS-7 African green monkey cells were maintained in DMEM (high glucose) supplemented with 10% FBS, 2 mM glutamine, and penicillin/streptomycin (Invitrogen) at 37 C in a humidified incubator with 5% CO2.
Plasmids
The cDNA encoding amino acids 634933 of human PR were subcloned in-frame into the pM and the pVP16 plasmids (Invitrogen) to generate GAL4 DNA binding domain and VP16 activation domain fusions, respectively. The cDNA encoding amino acids 19442453 of human NCoR were subcloned in-frame into pM plasmid to generate a GAL4 DNA binding domain fusion. Plasmid pG5luc is a reporter construct with firefly luciferase under control of the yeast GAL4 promoter (Promega, Madison, WI). Full-length rat PR-B cDNA was subcloned into pcDNA3.1 expression vector (Invitrogen). Full-length human PR-A and PR-B were subcloned into pFastBac1 (Invitrogen) as previously described (69). Plasmid pFBM-MMTV-luc had MMTV promoter from pLM253 inserted into pFastBac1 to replace the CMV promoter to control expression of firefly luciferase as previously described (70). The cDNAs encoding full-length rat PR-B and human SRC-1 and AIB1 were subcloned into pcDNA3.1 expression vector (Stratagene, La Jolla, CA). All plasmids were confirmed by restriction digestion and DNA sequencing, with expression in cultured cells confirmed by Western blot, when applicable.
Transfections
Briefly, 30,000 COS-7 or CV-1 cells per well were plated into 96-well plates in DMEM containing 5% charcoal-stripped FBS overnight. Transfection of cells was performed using Lipofectamine Plus following manufacturers specifications (Invitrogen). The medium was removed, and 50 µl of OptiMEM (Invitrogen) was added to each well. The transfection mix (10 µl) was added, containing appropriate plasmid DNAs detailed separately below for each experiment. After 3 h, 40 µl of DMEM containing 5% FBS was added, and cells were permitted to recover overnight. Medium was removed and the cells were treated for 24 h with P4, asoprisnil, or RU486 alone, or 10 nM P4 plus increasing concentrations of asoprisnil or RU486. Each plasmid was tested individually and in combination, demonstrating no ligand-independent reporter transactivation, and ligand-dependent signaling required all plasmids. Plasmid pM3VP16 was cotransfected with pG5luc as a positive control for transfection and luciferase quantification. A modified full-length coactivator recruitment assay was performed (71). The amount of plasmid DNA per well was 0.02 µg of GAL4/PR-LBD, 0.04 µg of coactivator, and 0.04 µg of pG5luc in COS-7 cells. The mammalian two-hybrid assay used 0.02 µg of GAL4/NCoR, 0.04 µg of VP16/PR-LBD, and 0.04 µg of pG5luc plasmid DNA per well in COS-7 cells. The PR-MMTV assay used 0.025 µg of pFBM-MMTV-luc and 0.025 µg of either human PR-B or human PR-A, or 0.01 µg of rat PR-B DNAs in CV-1 cells.
Luciferase Assays
At the end of DNA transfection assays, 100 µl of Steady-Glo reagent (Promega) was added to each well. Plates were incubated for 15 min to ensure complete cell lysis and luciferase reaction and read in a Wallac 1420 Victor2 Multilabel (PerkinElmer, Waltham, MA), and the data were analyzed to obtain EC50 and IC50 values using GraphPad Prism 4 (GraphPad Software, San Diego, CA).
Alkaline Phosphatase Assay
A modified alkaline phosphatase assay was performed (72, 73, 74). Briefly, 40,000 T47D cells per well were plated in 96-well plates in DMEM/F12 containing 2% charcoal-stripped FBS overnight. The next day, the cells were treated overnight with P4, asoprisnil, or RU486 alone, or 10 nM P4 plus increasing concentrations of asoprisnil or RU486. The medium was removed, cells were washed with PBS, and then 50 µl of 0.1 M Tris-HCl (pH 9.8) containing 0.2% Triton X-100 was added to each well with 15 min of shaking. After this incubation, 150 µl of 0.1 M Tris-HCl (pH 9.8) containing 4 mM p-nitrophenyl phosphate was added. Vmax (rate of reaction; the velocity at maximal concentrations of substrate) measurements were taken at 5-min intervals for 30 min at 405 nM using a SpectraMAX PLUS spectrophotometer (Molecular Devices, Sunnyvale, CA), and the data were analyzed to obtain EC50 and IC50 values using GraphPad Prism 4.
T47D and ELT3 Gene Expression
T47D cells were plated as above. Cells were treated for 18 h and then lysed with RLT buffer containing guanidine thiocyanate (QIAGEN, Valencia, CA). Total RNA is isolated from the lysed cells in the Biorobot Universal System using RNeasy technology (QIAGEN). Briefly, the RNA isolation methodology combines the selective binding properties of a silica gel-based membrane with the speed of vacuum technology. A Rnase-free Dnase step was added to the isolation method to remove genomic DNA. Approximately 500 ng of RNA from each sample was used to generate cDNA using Multiscribe enzyme (Applied Biosystems, Foster City, CA). For quantitative PCR (qPCR), 1x Fast Universal PCR mastermix was combined with approximately 50 ng of sample and specific probe and primer sets and processed under accelerated PCR conditions for 40 cycles. The following genes were quantified: human Sgk-1, probe, 6FAM-TCCACCTTCTGTGGCAC-GCCG-TAMRA; forward primer, TGCAAGGAGAACATTGAACACAA; reverse primer-GCACCTCAGGTGCGAGATACT; and human PPL, probe, 6FAM-CAGGCCAAGCATTTT-ATACATACCCTCGCT-TAMRA; forward primer, GACGCAGTGACCTCCTTGGT; and reverse primer, TGTGGGCGGGACTCTGA. A relative quantification methodology was used for fold change analysis using the housekeeper gene human ribosomal protein L32 (RPL32) for normalization: probe, VIC-CGCTCACAATGTTTCCTCCA-TAMRA; forward primer, TGA-CTCTGATGGCCAGTTGG; and reverse primer, CGCAA-AGCCATCGTGGAAAGAGCT.
The ELT3 cells were processed using the same above-mentioned methods used for T47d cell RNA isolation and qPCR. The gene for rat COX-2 was quantified in ELT-3 cells with the following probe and primers: probe, 6FAM-CTCTGCGCTTGCCCTGGCCTC-TAMRA; forward primer, CCACCTCTGCGATGCTCTTC; and reverse primer, CATTCACCACGGTTTTGACATG. A relative quantification methodology was used for fold change analysis using the housekeeper gene rat RPL32 for normalization: probe, VIC-AGGCATCGACAACAGGGTGCGG-TAMRA; forward primer, GAAACTGGCGGAAACCCA; and reverse primer, GGATCTGGCCCTTGAATCTTC.
COX Assay
ELT3 cells were plated at 10,000 cells per well in 96-well plates in DMEM 0.5% FBS the day before the experiment. Next day, the cells were washed two times with PBS, and DMEM phenol red free and 5% charcoal-stripped FBS medium were added. Cells then were treated with different concentrations of estrogen, P4, RU486, asoprisnil alone, or 1 nM estrogen plus P4, RU486, or asoprisnil in 200 µl total volume and incubated for 24 h. The following day, arachidonic acid was added to a final concentration of 10 µM and further incubated for 10 min. The reaction was stopped on ice, and 50 µl of supernatant was transferred to the enzyme-linked immunoassay (EIA) plate for prostaglandin E2 (PGE2) measurement (Cayman 514040 PGE2 EIA kit; Cayman Chemical Co., Ann Arbor, MI). Measurements were taken at 405 nm using a SpectraMAX PLUS spectrophotometer (Molecular Devices), and the data were analyzed to obtain EC50 and IC50 values using GraphPad Prism 4.
Ovariectomized Rat Uterotrophic Model
The procedures involving the use of rats in these experiments were reviewed and approved by the Institutional Animal Care and Use Committee in accordance with National Institutes of Health guidelines (NIH Publication No. 85-23). The animals were housed singly with food and water ad libitum on a 12-h light, 12-h dark cycle.
Ovariectomized female, 10-wk-old female Sprague-Dawley rats (Charles River Laboratories, Inc., Wilmington, MA) weighing between 250 and 300 g were used. The ovariectomies were performed by the supplier with a minimum of 10 d before treatment. The animals were randomized into groups of five or six and treated once daily for 3 d, orally by gavage (by mouth) in a volume of 3 ml with either asoprisnil (30 mg/kg) or vehicle, and/or sc injection in the hindquarter with P4 (10 mg/kg) in a volume of 0.2 ml. On the second and third days of treatment, the animals, except the untreated control and P4-only groups, were also treated with E2 (0.08 mg/kg) sc. Approximately 24 h after the final treatment, the uteri were surgically removed, stripped of remaining fat and mesentery, weighed, and snap-frozen on dry ice. The animals were then euthanized by exsanguination.
Rat Uterus Gene Expression
A subsample of frozen rat uterus was homogenized in 750 µl of Qiazol containing phenol using a bead mill (QIAGEN). The homogenized samples were chloroform-extracted, and the resulting aqueous phase was separated for total RNA isolation in the Biorobot Universal System (QIAGEN). The methodology is similar to the aforementioned cell isolation protocol. The isolated total RNA was checked for quality and quantity using spectrophotometric OD in the M2 plate reader (Molecular Devices). Approximately, 1 µg of RNA from each sample was used to generate cDNA using Multiscribe enzyme (Applied Biosystems). For qPCR, 1x Fast Universal PCR mastermix was combined with approximately 50 ng of sample and specific probe and primer sets and processed under accelerated PCR conditions for 40 cycles. The following genes were quantified: rat v-fos FBJ murine osteosarcoma viral oncogene homolog (c-fos), probe, 6FAM-AGC CAA GTG CCG GAA TCG GAG G-TAMRA; forward primer, TCC GAA GGG AAA GGA ATA AGA TG; reverse primer, CGC TTG GAG CGT ATC TGT CA; and complement 3 (C3), probe, 6FAM-AGCATTCCATCGTCCTTCTCCGGATG; forward primer, GGTCGGTCAAGGTCTACTCCTACTA; reverseprimer, CACAGCGGCACATTTCATTG. A relative quantification methodology was used for fold change analysis using the housekeeper gene rat RPL32 for normalization: probe, VIC-AGGCATCGACAACAGGGTGCGG-TAMRA; forward primer, GAAACTGGCGGAAACCCA; and reverse primer, GGATCTGGCCCTTGAATCTTC.
 |
ACKNOWLEDGMENTS
|
|---|
The authors acknowledge Juan-Li Gu and Natalie Burrows for their excellent technical assistance; Roy Katso for providing the full-length PR containing plasmids and pFBM-MMTV-luc; and Bruce Wisely for providing the SRC-1 and AIB1 expression plasmids. Use of the IMCA-CAT beamline 17-ID at the Advanced Photon Source was supported by the companies of the Industrial Macromolecular Crystallography Association through a contract with the Center for Advanced Radiation Sources at the University of Chicago.
 |
FOOTNOTES
|
|---|
Disclosure Statement: The authors have nothing to disclose.
First Published Online March 13, 2007
Abbreviations: AF, Activation function domain; AIB1, amplified in breast cancer 1; COX, cyclooxygenase; E2, 17ß-estradiol; EIA, enzyme-linked immunoassay; ER, estrogen receptor; FBS, fetal bovine serum; GAL4, galactosidase-4; GST, glutathione-S-transferase; LBD, ligand binding domain; MMTV, mouse mammary tumor virus; NCoR, nuclear receptor corepressor; NR, nuclear receptor; P4, progesterone; PGE2, prostaglandin E2; PPAR, peroxisome proliferator-activated receptor; PPL, periplakin; PR, progesterone receptor; qPCR, quantitative PCR; RPL32, ribosomal protein L32; Sgk-1, serum glucocorticoid kinase-1; SPRM, selective PR modulator; SRC, steroid receptor coactivator; TIF2, transcription intermediary factor 2.
Received for publication December 6, 2006.
Accepted for publication March 5, 2007.
 |
REFERENCES
|
|---|
- Baulieu EE 1989 Contragestion and other clinical applications of RU 486, an antiprogesterone at the receptor. Science 245:13511357[Abstract/Free Full Text]
- Lydon JP, DeMayo FJ, Funk CR, Mani SK, Hughes AR, Montgomery Jr CA, Shyamala G, Conneely OM, OMalley BW 1995 Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities. Genes Dev 9:22662278[Abstract/Free Full Text]
- Graham JD, Clarke CL 1997 Physiological action of progesterone in target tissues. Endocr Rev 18:502519[Abstract/Free Full Text]
- Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P 1995 The nuclear receptor superfamily: the second decade. Cell 83:835839[CrossRef][Medline]
- Robinson-Rechavi M, Escriva GH, Laudet V 2003 The nuclear receptor superfamily. J Cell Sci 116:585586[Free Full Text]
- Beato M 1989 Gene regulation by steroid hormones. Cell 56:335344[CrossRef][Medline]
- Klein-Hitpass L, Tsai SY, Weigel NL, Allan GF, Riley D, Rodriguez R, Schrader WT, Tsai MJ, OMalley BW 1990 The progesterone receptor stimulates cell-free transcription by enhancing the formation of a stable preinitiation complex. Cell 60:247257[CrossRef][Medline]
- Tsai MJ, OMalley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451486[CrossRef][Medline]
- Leonhardt SA, Edwards DP 2002 Mechanism of action of progesterone antagonists. Exp Biol Med (Maywood) 227:969980[Abstract/Free Full Text]
- McKenna NJ, Lanz RB, OMalley BW 1999 Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 20:321344[Abstract/Free Full Text]
- Vegeto E, Shahbaz MM, Wen DX, Goldman ME, OMalley BW, McDonnell DP 1993 Human progesterone receptor A form is a cell- and promoter-specific repressor of human progesterone receptor B function. Mol Endocrinol 7:12441255[Abstract/Free Full Text]
- Tung L, Mohamed MK, Hoeffler JP, Takimoto GS, Horwitz KB 1993 Antagonist-occupied human progesterone B-receptors activate transcription without binding to progesterone response elements and are dominantly inhibited by A-receptors. Mol Endocrinol 7:12561265[Abstract/Free Full Text]
- McDonnell DP, Goldman ME 1994 RU486 exerts antiestrogenic activities through a novel progesterone receptor A form-mediated mechanism. J Biol Chem 269:1194511949[Abstract/Free Full Text]
- Richer JK, Jacobsen BM, Manning NG, Abel MG, Wolf DM, Horwitz KB 2002 Differential gene regulation by the two progesterone receptor isoforms in human breast cancer cells. J Biol Chem 277:52095218[Abstract/Free Full Text]
- Gronemeyer H 1991 Transcription activation by estrogen and progesterone receptors. Annu Rev Genet 25:89123[CrossRef][Medline]
- Kalkhoven E, Wissink S, van der Saag PT, van der Burg B 1996 Negative interaction between the RelA(p65) subunit of NF-KB and the progesterone receptor. J Biol Chem 271:62176224[Abstract/Free Full Text]
- Bamberger AM, Bamberger CM, Gellersen B, Schulte HM 1996 Modulation of AP-1 activity by the human progesterone receptor in endometrial adenocarcinoma cells. Proc Natl Acad Sci USA 93:61696174[Abstract/Free Full Text]
- Migliaccio A, Piccolo D, Castoria G, Di Domenico M, Bilancio A, Lombardi M, Gong W, Beato M, Auricchio F 1998 Activation of the Src/p21ras/Erk pathway by progesterone receptor via cross-talk with estrogen receptor. EMBO J 17:20082018[CrossRef][Medline]
- Boonyaratanakornkit V, Scott MP, Ribon V, Sherman L, Anderson SM, Maller JL, Miller WT, Edwards DP 2001 Progesterone receptor contains a proline-rich motif that directly interacts with SH3 domains and activates c-Src family tyrosine kinases. Mol Cell 8:269280[CrossRef][Medline]
- Meyer ME, Gronemeyer H, Turcotte B, Bocquel MT, Tasset D, Chambon P 1989 Steroid hormone receptors compete for factors that mediate their enhancer function. Cell 57:433442[CrossRef][Medline]
- Meyer ME, Quirin-Stricker C, Lerouge T, Bocquel MT, Gronemeyer H 1992 A limiting factor mediates the differential activation of promoters by the human progesterone receptor isoforms. J Biol Chem 267:1088210887[Abstract/Free Full Text]
- Lessey BA, Alexander PS, Horwitz KB 1983 The subunit structure of human breast cancer progesterone receptors: characterization by chromatography and photoaffinity labeling. Endocrinology 112:12671274[Abstract/Free Full Text]
- Kastner P, Krust A, Turcotte B, Stropp U, Tora L, Gronemeyer H, Chambon P 1990 Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J 9:16031614[Medline]
- Gronemeyer H, Meyer ME, Bocquel MT, Kastner P, Turcotte B, Chambon P 1991 Progestin receptors: isoforms and antihormone action. J Steroid Biochem Mol Biol 40:271278[CrossRef][Medline]
- McDonnell DP, Shahbaz MM, Vegeto E, Goldman ME 1994 The human progesterone receptor A-form functions as a transcriptional modulator of mineralocorticoid receptor transcriptional activity. J Steroid Biochem Mol Biol 48:425432[CrossRef][Medline]
- Edwards DP 2000 The role of coactivators and corepressors in the biology and mechanism of action of steroid hormone receptors. J Mammary Gland Biol Neoplasia 5:307324[CrossRef][Medline]
- Tetel MJ, Giangrande PH, Leonhardt SA, McDonnell DP, Edwards DP 1999 Hormone-dependent interaction between the amino- and carboxyl-terminal domains of progesterone receptor in vitro and in vivo. Mol Endocrinol 13:910924[Abstract/Free Full Text]
- Tung L, Abdel-Hafiz H, Shen T, Harvell DME, Nitao LK, Richer JK, Sartorius CA, Takimoto GS, Horwitz KB 2006 Progesterone receptors (PR)-B and -A regulate transcription by different mechanisms: AF-3 exerts regulatory control over coactivator binding to PR-B. Mol Endocrinol 20:26562670[Abstract/Free Full Text]
- Mulac-Jericevic B, Mullinax RA, DeMayo FJ, Lydon JP, Conneely OM 2000 Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B isoform. Science 289:17511754[Abstract/Free Full Text]
- Mulac-Jericevic B, Lydon JP, DeMayo FJ, Conneely OM 2003 Defective mammary gland morphogenesis in mice lacking the progesterone receptor B isoform. Proc Natl Acad Sci USA 100:97449749[Abstract/Free Full Text]
- Condon JC, Hardy DB, Kovaric K, Mendelson CR 2006 Up-regulation of the progesterone receptor (PR)-C isoform in laboring myometrium by activation of nuclear factor-
B may contribute to the onset of labor through inhibition of PR function. Mol Endocrinol 20:764775[Abstract/Free Full Text] - Schindler AE, Campagnoli C, Druckmann R, Huber J, Pasqualini JR, Schweppe KW, Thijssen JHH 2003 Classification and pharmacology of progestins. Maturitas 46:716[Medline]
- Kraus WL, Weis KE, Katzenellenbogen BS 1995 Inhibitory cross-talk between steroid hormone receptors: differential targeting of estrogen receptor in the repression of its transcriptional activity by agonist- and antagonist-occupied progestin receptors. Mol Cell Biol 15:18471857[Abstract]
- Cadepond F, Ulmann A, Baulieu EE 1997 RU486 (mifepristone): mechanisms of action and clinical uses. Annu Rev Med 48:129156[CrossRef][Medline]
- Spitz IM 2003 Progesterone antagonists and progesterone receptor modulators: an overview. Steroids 68:981993[CrossRef][Medline]
- Elger W, Bartley J, Schneider B, Kaufmann G, Schubert G, Chwalisz K 2000 Endocrine pharmacological characterization of progesterone antagonists and progesterone receptor modulators with respect to PR-agonistic and antagonistic activity. Steroids 65:713723[CrossRef][Medline]
- Chabbert-Buffet N, Meduri G, Bouchard P, Spitz IM 2005 Selective progesterone receptor modulators and progesterone antagonists: mechanisms of action and clinical applications. Hum Reprod Update 11:293307[Abstract/Free Full Text]
- Chwalisz K, Perez MC, DeManno D, Winkel C, Schubert G, Elger W 2005 Selective progesterone receptor modulator development and use in the treatment of leiomyomata and endometriosis. Endocr Rev 26:423438[Abstract/Free Full Text]
- Chwalisz K, Elger W, Stickler T, Mattia-Goldberg C, Larsen L 2005 The effects of 1-month administration of asoprisnil (J867), a selective progesterone receptor modulator, in healthy premenopausal women. Hum Reprod 20:10901099[Abstract/Free Full Text]
- Xu EH, Lambert MH 2003 Structural insights into regulation of nuclear receptors by ligands. Nucl Recept Signal 1:e004
- Bledsoe RK, Montana VG, Stanley TB, Delves CJ, Apolito CJ, McKee DD, Consler TG, Parks DJ, Stewart EL, Willson TM, Lambert MH, Moore JT, Pearce KH, Xu HE 2002 Crystal structure of the glucocorticoid receptor ligand binding domain reveals a novel mode of receptor dimerization and coactivator recognition. Cell 110:93105[CrossRef][Medline]
- Robyr D, Wolffe AP, Wahli W 2000 Nuclear hormone receptor coregulators in action: diversity for shared tasks. Mol Endocrinol 14:329347[Free Full Text]
- Cohen RN, Brzostek S, Kim B, Chorev M, Wondisford FE, Hollenberg AN 2001 The specificity of interactions between nuclear hormone receptors and corepressors is mediated by distinct amino acid sequences within the interacting domains. Mol Endocrinol 15:10491061[Abstract/Free Full Text]
- Williams SP, Sigler PB 1998 Atomic structure of progesterone complexed with its receptor. Nature 393:392396[CrossRef][Medline]
- DeManno D, Elger W, Garg R, Lee R, Schneider B, Hess-Stumpp H, Schubert G, Chwalisz K 2003 Asoprisnil (J867): a selective progesterone receptor modulator for gynecological therapy. Steroids 68:10191032[CrossRef][Medline]
- Winneker RC, Fensome A, Wrobel JE, Zhang Z, Zhang P 2005 Nonsteroidal progesterone receptor modulators: structure activity relationships. Semin Reprod Med 23:4657[CrossRef][Medline]
- Jacobsen BM, Richer JK, Sartorius CA, Horwitz KB 2003 Expression profiling of human breast cancers and gene regulation by progesterone receptors. J Mammary Gland Biol Neoplasia 8:257268[CrossRef][Medline]
- Boonyaratanakornkit V, McGowan E, Sherman L, Mancini MA, Cheskis BJ, Edwards DP 2007 The role of extranuclear signaling actions of progesterone receptor in mediating progesterone regulation of gene expression and the cell cycle. Mol Endocrinol 21:359375[Abstract/Free Full Text]
- Bray JD, Jelinsky S, Ghatge R, Bray JA, Tunkey C, Saraf K, Jacobsen BM, Richer JK, Brown EL, Winneker RC, Horwitz KB, Lyttle CR 2005 Quantitative analysis of gene regulation by seven clinically relevant progestins suggests a highly similar mechanism of action through progesterone receptors in T47D breast cancer cells. J Steroid Biochem Mol Biol 97:328341[CrossRef][Medline]
- Howe SR, Gottardis MM, Everitt JI, Goldsworthy TL, Wolf DC, Walker C 1995 Rodent model of reproductive tract leiomyomata. Establishment and characterization of tumor-derived cell lines. Am J Pathol 146:15681579[Abstract]
- Engstrom T 2001 The regulation by ovarian steroids of prostaglandin synthesis and prostaglandin-induced contractility in non-pregnant rat myometrium. Modulating effects of isoproterenol. J Endocrinol 169:3341[Abstract]
- Tsuboi K, Iwane A, Nakazawa S, Sugimoto Y, Ichikawa A 2003 Role of prostaglandin H2 synthase 2 in murine parturition: study on ovariectomy-induced parturition in prostaglandin F receptor-deficient mice. Biol Reprod 69:195201[Abstract/Free Full Text]
- Farina M, Ribeiro ML, Weissmann C, Estevez A, Billi S, Vercelli C, Franchi A 2004 Biosynthesis and catabolism of prostaglandin F2(
) (PGF2[
]) are controlled by progesterone in the rat uterus during pregnancy. J Steroid Biochem Mol Biol 91:211218[CrossRef][Medline] - Xu HE, Stanley TB, Montana VG, Lambert MH, Shearer BG, Cobb JE, McKee DD, Galardi CM, Plunket KD, Nolte RT, Parks DJ, Moore JT, Kliewer SA, Willson TM, Stimmel JB 2002 Structural basis for antagonist-mediated recruitment of nuclear co-repressors by PPAR[
]. Nature 415:813817[Medline] - Pullen MA, Laping N, Edwards R, Bray J 2006 Determination of conformational changes in the progesterone receptor using ELISA-like assays. Steroids 71:792798[CrossRef][Medline]
- Meyer ME, Pornon A, Ji JW, Bocquel MT, Chambon P, Gronemeyer H 1990 Agonistic and antagonistic activities of RU486 on the functions of the human progesterone receptor. EMBO J 9:39233932[Medline]
- Jepsen K, Hermanson O, Onami TM, Gleiberman AS, Lunyak V, McEvilly RJ, Kurokawa R, Kumar V, Liu F, Seto E, Hedrick SM, Mandel G, Glass CK, Rose DW, Rosenfeld MG 2000 Combinatorial roles of the nuclear receptor corepressor in transcription and development. Cell 102:753763[CrossRef][Medline]
- Smith CL, OMalley BW 2004 Coregulator function: a key to understanding tissue specificity of selective receptor modulators. Endocr Rev 25:4571[Abstract/Free Full Text]
- Liu Z, Auboeuf D, Wong J, Chen JD, Tsai SY, Tsai MJ, OMalley BW 2002 Coactivator/corepressor ratios modulate PR-mediated transcription by the selective receptor modulator RU486. Proc Natl Acad Sci USA 99:79407944[Abstract/Free Full Text]
- Xu J, Qiu Y, DeMayo FJ, Tsai SY, Tsai MJ, OMalley BW 1998 Partial hormone resistance in mice with disruption of the steroid receptor coactivator-1 (SRC-1) gene. Science 279:19221925[Abstract/Free Full Text]
- Xu J, Liao L, Ning G, Yoshida-Komiya H, Deng C, OMalley BW 2000 The steroid receptor coactivator SRC-3 (p/CIP/RAC3/AIB1/ACTR/TRAM-1) is required for normal growth, puberty, female reproductive function, and mammary gland development. Proc Natl Acad Sci USA 97:63796384[Abstract/Free Full Text]
- Han SJ, Jeong J, DeMayo FJ, Xu J, Tsai SY, Tsai MJ, OMalley BW 2005 Dynamic cell type specificity of SRC-1 coactivator in modulating uterine progesterone receptor function in mice. Mol Cell Biol 25:81508165[Abstract/Free Full Text]
- Han SJ, DeMayo FJ, Xu J, Tsai SY, Tsai MJ, OMalley BW 2006 Steroid receptor coactivator (SRC)-1 and SRC-3 differentially modulate tissue-specific activation functions of the progesterone receptor. Mol Endocrinol 20:4555[Abstract/Free Full Text]
- Loosfelt H, Atger M, Misrahi M, Guiochon-Mantel A, Meriel C, Logeat F, Benarous R, Milgrom E 1986 Cloning and sequence analysis of rabbit progesterone-receptor complementary DNA. Proc Natl Acad Sci USA 83:90459049[Abstract/Free Full Text]
- Fisher B, Costantino JP, Wickerham DL, Redmond CK, Kavanah M, Cronin WM, Vogel V, Robidoux A, Dimitrov N, Atkins J, Daly M, Wieand S, Tan-Chiu E, Ford L, Wolmark N 1998 Tamoxifen for prevention of breast cancer: report of the National Surgical Adjuvant Breast and Bowel Project P-1 Study. J Natl Cancer Inst 90:13711388[Abstract/Free Full Text]
- Cummings SR, Eckert S, Krueger KA, Grady D, Powles TJ, Cauley JA, Norton L, Nickelsen T, Bjarnason NH, Morrow M, Lippman ME, Black D, Glusman JE, Costa A, Jordan VC 1999 The effect of raloxifene on risk of breast cancer in postmenopausal women: results from the MORE Randomized Trial. JAMA 281:21892197[Abstract/Free Full Text]
- Madauss KP, Deng SJ, Austin RJ, Lambert MH, McLay I, Pritchard J, Short SA, Stewart EL, Uings IJ, Williams SP 2004 Progesterone receptor ligand binding pocket flexibility: crystal structures of the norethindrone and mometasone furoate complexes. J Med Chem 47:33813387[CrossRef][Medline]
- Schubert G, Ring S, Erhart B, Mueller G 2002 Procedures for the production of 4-(17a-methyl-substituted) 93-oxoestra-4,9-dien-11-yl)benzaldehyde (1E or 1Z)-oximes. Ger Offen DE 10056675 A1
- Katso RM, Parham JH, Caivano M, Clay WC, Condreay JP, Gray DW, Lindley KM, Mason SJ, Rieger J, Wakes NC, Cairns WJ, Merrihew RV 2005 Evaluation of cell-based assays for steroid nuclear receptors delivered by recombinant baculoviruses. J Biomol Screen 10:715724[Abstract]
- Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, Galardi C, Wilson JG, Lewis MC, Roth ME 2000 A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 6:517526[CrossRef][Medline]
- Shao D, Berrodin TJ, Manas E, Hauze D, Powers R, Bapat A, Gonder D, Winneker RC, Frail DE 2004 Identification of novel estrogen receptor
antagonists. J Steroid Biochem Mol Biol 88:351360[CrossRef][Medline] - Di Lorenzo D, Albertini A, Zava D 1991 Progestin regulation of alkaline phosphatase in the human breast cancer cell line T47D. Cancer Res 51:44704475[Abstract/Free Full Text]
- Di Lorenzo D, Gianni M, Savoldi GF, Ferrari F, Albertini A, Garattini E 1993 Progesterone induced expression of alkaline phosphatase is associated with a secretory phenotype in T47D breast cancer cells. Biochem Biophys Res Commun 192:10661072[CrossRef][Medline]
- Zhang Z, Lundeen SG, Zhu Y, Carver JM, Winneker RC 2000 In vitro characterization of trimegestone: a new potent and selective progestin. Steroids 65:637643[CrossRef][Medline]
NURSA Molecule Pages Link:
- Nuclear Receptors:
PPARα
|
PR
- Coregulators:
SRC-1
|
GRIP1
|
AIB1
|
NCOR
|
SMRT
- Ligands:
GW6471
|
17β-Estradiol
|
Progesterone
|
Mifepristone
This article has been cited by other articles:

|
 |

|
 |
 
H. C. A. Raaijmakers, J. E. Versteegh, and J. C. M. Uitdehaag
The X-ray Structure of RU486 Bound to the Progesterone Receptor in a Destabilized Agonistic Conformation
J. Biol. Chem.,
July 17, 2009;
284(29):
19572 - 19579.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Abdel-Hafiz, M. L. Dudevoir, and K. B. Horwitz
Mechanisms Underlying the Control of Progesterone Receptor Transcriptional Activity by SUMOylation
J. Biol. Chem.,
April 3, 2009;
284(14):
9099 - 9108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Bulun
Endometriosis
N. Engl. J. Med.,
January 15, 2009;
360(3):
268 - 279.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Hodgson, H. C. Shen, A. N. Hollenberg, and S. P. Balk
Structural basis for nuclear receptor corepressor recruitment by antagonist-liganded androgen receptor
Mol. Cancer Ther.,
October 1, 2008;
7(10):
3187 - 3194.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Morikawa, N. Ohara, Q. Xu, K. Nakabayashi, D. A. DeManno, K. Chwalisz, S. Yoshida, and T. Maruo
Selective progesterone receptor modulator asoprisnil down-regulates collagen synthesis in cultured human uterine leiomyoma cells through up-regulating extracellular matrix metalloproteinase inducer
Hum. Reprod.,
April 1, 2008;
23(4):
944 - 951.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Dietz, S. Du, C. W. Bolten, M. A. Payne, C. Xia, J. R. Blinn, J. W. Funder, and X. Hu
A Number of Marketed Dihydropyridine Calcium Channel Blockers Have Mineralocorticoid Receptor Antagonist Activity
Hypertension,
March 1, 2008;
51(3):
742 - 748.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. M. McGowan, A. J. Russell, V. Boonyaratanakornkit, D. N. Saunders, G. M. Lehrbach, C. M. Sergio, E. A. Musgrove, D. P. Edwards, and R. L. Sutherland
Progestins Reinitiate Cell Cycle Progression in Antiestrogen-Arrested Breast Cancer Cells through the B-Isoform of Progesterone Receptor
Cancer Res.,
September 15, 2007;
67(18):
8942 - 8951.
[Abstract]
[Full Text]
[PDF]
|
 |
|