help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2006-0448
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
21/5/1082    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuda, H.
Right arrow Articles by Shi, Y.-B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuda, H.
Right arrow Articles by Shi, Y.-B.
Molecular Endocrinology 21 (5): 1082-1094
Copyright © 2007 by The Endocrine Society

Contrasting Effects of Two Alternative Splicing Forms of Coactivator-Associated Arginine Methyltransferase 1 on Thyroid Hormone Receptor-Mediated Transcription in Xenopus laevis

Hiroki Matsuda, Bindu D. Paul, Cheol Young Choi and Yun-Bo Shi

Section on Molecular Morphogenesis, Laboratory of Gene Regulation and Development, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20892

Address all correspondence and requests for reprints to: Yun-Bo Shi, Building 18 T, Room 106, Laboratory of Gene Regulation and Development, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20892. E-mail: Shi{at}helix.nih.gov.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Thyroid hormone receptors (TRs) can repress or activate target genes depending on the absence or presence of thyroid hormone (T3), respectively. This hormone-dependent gene regulation is mediated by the recruitment of corepressors in the absence of T3 and coactivators in its presence. Many TR-interacting coactivators have been characterized in vitro. Among them is coactivator-associated arginine methyltransferase 1 (CARM1), which methylates histone H3. We are interested in investigating the role of CARM1 in TR-mediated gene expression in vivo during postembryonic development by using T3-dependent frog metamorphosis as a model. We first cloned the Xenopus laevis CARM1 and obtained two alternative splicing forms, CARM1a and CARM1b. Both isoforms are expressed throughout metamorphosis, supporting a role for these isoforms during the process. To investigate whether Xenopus CARM1s participate in gene regulation by TRs, transcriptional analysis was conducted in Xenopus oocyte, where the effects of cofactors can be studied in the context of chromatin in vivo. Surprisingly, overexpression of CARM1b had little effect on TR-mediated transcription, whereas CARM1a enhanced gene activation by liganded TR. Chromatin immunoprecipitation assays showed that both endogenous CARM1a and overexpressed CARM1a and b were recruited to the promoter by liganded TR. However, the binding of liganded TR to the target promoter was reduced when CARM1b was overexpressed, accompanied by a slight reduction in histone methylation at the promoter. These results suggest that CARM1 may play a role in TR-mediated transcriptional regulation during frog development and that its function is regulated by alternative splicing.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
ANURANS UNDERGO metamorphosis to change from the larval to adult form. Anuran metamorphosis is one of the most dramatic phenomena induced by thyroid hormone (T3) (1, 2). The vast majority of the biological effects of T3 are mediated through gene transcription by thyroid hormone receptors (TRs) (2, 3, 4). Studies by us and others in Xenopus laevis have shown that TR is both necessary and sufficient to mediate the metamorphic effects of T3 (5, 6, 7, 8). This makes frog metamorphosis a good model to understand the mechanisms of gene regulation by TRs in vivo.

TRs are hormone-dependent transcription factors belonging to the superfamily of nuclear hormone receptors (2, 3, 4, 9, 10, 11, 12, 13). TR forms heterodimer with 9-cis-retinoic acid receptor (RXR) and binds to T3 response elements (TREs) in/around the promoters of target genes. In the absence of T3, TR represses transcription from T3-inducible promoters, whereas when T3 is present, TR activates transcription from the same promoters. TR accomplishes these by recruiting corepressor or coactivator complexes in the target promoters, respectively (4, 14, 15, 16, 17, 18, 19). In vitro and cell culture studies have led to the isolation and characterization of many TR-interacting cofactor complexes. For example, the SWI/SNF complex has ATP-dependent chromatin remodeling activity; histone acetyltransferases such as cAMP response element binding protein-binding protein (CBP) and p300 contribute to gene regulation through the acetylation of histones and other transcription factors or coactivators; the TRAP (thyroid hormone receptor-associated protein)/DRIP (vitamin D receptor-interacting protein)/mediator complex associates with the recruitment and activation of RNA polymerase II (14, 20, 21, 22).

The coactivators of the steroid receptor coactivator (SRC) family (SRC1/NCoA-1, SRC2/TIF2/GRIP1, and SRC3/pCIP/ACTR/AIB-1/RAC-3/TRAM-1) bind to TR in the presence of T3 and recruit other cofactors, including CBP/p300, protein arginine methyltransferase 1 (PRMT1), and coactivator-associated arginine methyltransferase 1 (CARM1 or PRMT4) (21, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35). We have shown previously that during Xenopus laevis metamorphosis, SRC3 expression is up-regulated by T3, likely indirectly, and that SRC3 is recruited to TR target promoters in a gene- and tissue-dependent manner (36, 37). Furthermore, transgenic studies using a dominant-negative SRC3 have demonstrated that coactivator function is essential for gene regulation by TR and frog metamorphosis (38). Because the dominant-negative SRC3 blocks the binding of all coactivators to TR, it is yet unclear whether SRC3 or other SRCs are indeed required for this process.

In an attempt to determine the role of SRC complexes in metamorphosis, we have begun to investigate the role of SRC-binding coactivator CARM1 (34) during frog development. CARM1 methylates histone H3 at Arg-2, -17, and -26 (39, 40) and the methylation of histone H3 occurs locally at the hormone-regulated promoters as part of the transcriptional activation process (34, 40). Both the methyltransferase activity and the interaction with SRCs are essential for CARM1 to function as a coactivator in nuclear receptor-mediated transcription (41, 42). Furthermore, it has been reported that histone methylation by CARM1 plays important roles with histone acetylation by CBP/p300 in nuclear receptor-mediated transcription (41, 42). In addition, CARM1 methylates CBP/p300 and the methylated CBP/p300 stimulates transcriptional activation by nuclear receptors (43, 44). On the other hand, histone acetylation by p300 enhances the binding affinity of CARM1 to histones and stimulates histone methylation by CARM1 (45).

To understand Xenopus CARM1 function in TR-mediated transcription during development, we report here the cloning and characterization of two alternatively spliced isoforms of CARM1. We show that both CARM1a and CARM1b are constitutively expressed during metamorphosis and that CARM1a but not CARM1b enhances gene activation by liganded TR in the oocyte system. We further demonstrate that, although both CARM1a and b can be recruited by liganded TR to its target promoter, CARM1b also reduces the binding of TR to the promoter, thus abolishing its ability to enhance transcription. These results suggest that alternative splicing regulate the role of CARM1 in TR-mediated transcriptional regulation during frog metamorphosis.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cloning of Two Alternatively Spliced Forms of Xenopus CARM1
To clone the Xenopus laevis CARM1, we searched sequence data banks and obtained a partial cDNA sequence lacking the 5'-end. 5'-rapid amplification of cDNA ends (RACE) was conducted to determine the sequence of the 5'-end. A primer set covering full-length coding region was used to PCR amplify the full-length CARM1. Cloning and sequencing of the PCR products led to the identification of two different forms of the Xenopus laevis CARM1, named CARM1a and b (GenBank accession nos. EF055448 and EF055449), respectively (Fig. 1AGo). The two forms are identical except for an extra region in the C-terminal half of predicted CARM1b protein (Fig. 1AGo). Both clones are highly homologous to CARM1 in other vertebrates and contain highly conserved domains for various functions of the protein (Fig. 1AGo) (46, 47, 48). CARM1a and b have the same methyltransferase domain and the extra region in CARM1b is in the activation domain (Fig. 1AGo).


Figure 1
View larger version (50K):
[in this window]
[in a new window]

  		Fig. 1. Xenopus CARM1 Sequence and the Predicted Alternatively Spliced Forms

A, Comparison of amino acid sequences of CARM1 from different species. The sequences of Xenopus laevis CARM1a and b are shown at the bottom. The stars indicate conserved residues, and dashes indicate spaces introduced for alignment. The green and yellow double arrow lines on the top indicate a region encoding the mixed {alpha}-helices/ß-strands and the ß-barrel structure, respectively, both of which are common features of PRMT family members. The PRMT proteins methylate proteins by transferring the methyl group from S-adenosylmethionine (Ado-Met) to the guanidine nitrogen of arginine, and the conserved Ado-Met binding pocket and arginine binding pocket are shown with red and blue underlines, respectively. The purple underline shows the dimerization arm, which is necessary for the formation of CARM1 dimers and for functioning as methyltransferase. The aqua underline indicates the activation domain. For more details see Refs. 46 47 48 . Note that CARM1b has an additional sequence within this domain. B, Xenopus CARM1a and b are derived from alternative splicing. Top, Schematic representation of the only Xenopus tropicalis CARM1 locus based on the comparison of Xenopus laevis CARM1a and b with the Xenopus tropicalis genomic sequence data. There are 16 exons shown as vertical lines with some exon numbers indicated. Bottom, Intron/exon organizations of Xenopus laevis CARM1a and b as predicted from the alignment of the Xenopus laevis cDNA with the Xenopus tropicalis genome. Only exons 11–16 are shown. Note that CARM1a and b are generated from alternative splicing of exon 14.

 
Because Xenopus laevis is a pseudo-tetraploid organism with many genes duplicated, to determine the origin of the two CARM1 isoforms, we searched data banks for CARM1 in Xenopus tropicalis, a diploid Xenopus species. No cDNA sequence for CARM1 was found for Xenopus tropicalis. A single genomic locus was located in Xenopus tropicalis. Sequence comparison revealed the presence of 16 exons encoding cDNA sequences corresponding to Xenopus laevis CARM1a and b (Fig. 1BGo). CARM1b corresponds to an mRNA containing all 16 exons, whereas CARM1a lacks the predicted exon 14. These data suggest that Xenopus laevis CARM1a and b are derived from alternative splicing of exon 14 and that Xenopus tropicalis may also contain both CARM1a and b.

Constitutive Expression of Xenopus CARM1a and b in the Intestine and Tail during Xenopus laevis Metamorphosis
For CARM1 to participate in gene regulation by TR during metamorphosis, CARM1 should be expressed during this period. Thus, we analyzed the expression of CARM1a and b in Xenopus laevis by RT-PCR. We chose the intestine and tail for this purpose because these two organs are the most studied for metamorphosis. The tail undergoes complete resorption involving mostly apoptosis and the intestine undergoes extensive remodeling where the predominant larval tissue, the tadpole epithelium, also degenerates completely through apoptosis, only to be replaced by the newly developed adult epithelium (1, 2, 49). We isolated total RNA from the intestine and tail from Xenopus laevis tadpoles at stage 54 (the onset of metamorphosis), 58, 61, and 66 (the end of metamorphosis when tail resorption is complete). To analyze the expression of both CARM1 forms, we carried out RT-PCR with a forward primer in exon 13 and reverse primer in exon 15 and found that both CARM1a and b were detected at all stage in tails and intestines (Fig. 2Go, A and C). The expression of CARM1a was constant throughout development in both organs. The signal for CARM1b was weaker, possibly due to the larger size of the PCR product, thus amplifying less efficiently. To verify the expression of CARM1b, we carried out a second set of RT-PCR by using a reverse primer in exon 14, thus only amplifying CARM1b, as shown in Fig. 2Go, B and D, CARM1b expression was also constitutive in both organs throughout metamorphosis. The constitutive expression was also confirmed by quantitative RT-PCR for the level of CARM1b or the level of CARM1a plus CARM1b (Fig. 2EGo). This expression profile suggests that both CARM1a and b may participate in gene regulation by TR during metamorphosis.


Figure 2
View larger version (40K):
[in this window]
[in a new window]

  		Fig. 2. Constitutive Expression of both CARM1 Forms during Frog Metamorphosis

Xenopus laevis carm1 expression was analyzed in both intestine (A, B, and E) and tail (C, D, and E) at stage 54 (onset of metamorphosis), stage 58, stage 61, and stage 66 (no tail at stage 66, the end of metamorphosis) by RT-PCR (A–D) and quantitative RT-PCR (E). A and C, RT-PCR with primers f and r-a, which amplify both CARM1a and b, producing bands of 201 bp (for CARM1a) and 276 bp (for CARM1b), respectively. The star indicates a likely nonspecific band. B and D, RT-PCR with primers f and r-b, which amplify only CARM1b (198 bp). The rpl8 internal control PCR product was 578 bp. E, Quantitative RT-PCR analysis of CARM1 (CARM1a and CARM1b) or CARM1b expression in the tail and intestine during metamorphosis. Note that both CARM1a and b are expressed constitutively in both the tail and intestine during development.

 
CARM1a, But Not CARM1b, Enhances Transcriptional Activation by TR in the Presence of T3
To investigate whether Xenopus CARM1a and b can influence gene regulation by TR, we analyzed the effect of overexpression of either form on TR-mediated gene expression in Xenopus oocytes, where one can study gene regulation in the context of chromatin (50). As a reporter, we injected into oocyte nucleus a plasmid containing the T3-dependent promoter of Xenopus TRßA gene driving the expression of firefly luciferase (51, 52). We also coinjected the internal control plasmid driving the expression of Renilla luciferase. Because the oocyte lacks TR/RXR, we microinjected their mRNAs together with mRNAs encoding FLAG-tagged CARM1a and b (F-CARM1a and b, respectively) into the cytoplasm. As shown in Fig. 3AGo, expression of TR/RXR in the absence of T3 led to the repression of the reporter gene and expression of either F-CARM1a or F-CARM1b had little effect on the reporter gene expression with or without TR/RXR expression. In the presence of T3, F-CARM1a enhanced the activation by liganded TR but not the basal expression in the absence of TR. In contrast, F-CARM1b had little effect on either the basal expression or the activation by liganded TR (Fig. 3AGo).


Figure 3
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 3. CARM1a But Not CARM1b Enhances Transcription by Liganded TR in the Frog Oocyte

A, Oocytes were injected into the cytoplasm with mRNAs encoding indicated proteins followed by injection of reporter DNA into the nucleus. The oocytes were then incubated with or without T3 before harvesting for luciferase assays. The protein extract from the samples with T3 treatment was also analyzed by Western blot with anti-FLAG antibody to show similar expression of FLAG-tagged CARM1a and b (F-CARM1a and b) in the oocytes. Note that CARM1 by itself did not have a significant effect on the T3-dependent promoter in the absence of TR and that CARM1a but not CARM1b enhanced TR-dependent transcriptional activation in the presence of T3. B, Dose-dependent enhancement of transcriptional activation by CARM1a but not CARM1b. Increasing amounts of CARM1a (1.15, 3.45, and 6.9 ng) or CARM1b (1.725, 5.175, and 10.35 ng) mRNA were coinjected with mRNAs for TR/RXR into the cytoplasm, followed by the injection of the reporter DNA into the nucleus. The oocytes were then incubated with or without T3 before harvesting for luciferase assays. Note that the samples 3, 7, and 11 had very little luciferase activity (thus the columns are not visible) due to repression by unliganded TR with or without CARM1 overexpression. The protein extract from the CARM1 mRNA injected samples was also analyzed by Western blot with anti-FLAG antibody to show the expression of FLAG-tagged CARM1a and b. The stars indicate pairs of samples with significant differences (P < 0.05).

 
Although both F-CARM1a and b were expressed at similar levels in the experiments above (Fig. 3AGo, bottom), it is possible that F-CARM1b may enhance TR function at different concentrations. Thus, we microinjected increasing amounts of the mRNA for F-CARM1a or b together with TR/RXR mRNAs. As shown in Fig. 3BGo, higher levels of mRNA injection led to higher levels of expression of both F-CARM1a and b. F-CARM1a expression led to the enhancement of the activation by liganded TR in a dose-dependent manner. In contrast, at all concentrations of F-CARM1b used, the transcriptional levels of the reporter gene was not significantly different from that in the absence of overexpressed CARM1b, although a small increase was observed at the highest dose (see Discussion for a possible explanation). Thus, the different isoforms of CARM1 have different coactivator activity in TR-mediated transcription.

Both CARM1 Isoforms Are Localized in the Oocyte Nucleus
There are several possibilities for the lack of effects by CARM1b on gene regulation by TR. These include that 1) CARM1b is not localized in the nucleus, 2) CARM1b cannot be recruited to the target gene by TR, and 3) CARM1b cannot methylate histone H3 at the promoter, even though it has the same methyltransferase domain. Thus, we first determined the localization of CARM1 in the oocyte. We microinjected mRNA encoding F-CARM1a or b into oocytes and prepared whole oocyte extracts for Western blotting with a commercial anti-CARM1 antibody, which recognized in vitro-translated Xenopus CARM1a and b (data not shown). As shown in Fig. 4AGo and consistent with the Western blots with the anti-FLAG antibody above, both F-CARM1a and b were expressed in the injected oocytes. Interestingly, the uninjected oocytes expressed a protein of the size of CARM1a but not b (Fig. 4AGo). The presence of CARM1 in the oocyte is consistent with the observed methylation of histone H3-R17 in the Xenopus oocytes (53). To determine the localization of the endogenous CARM1a, we manually separated the nucleus or germinal vesicle from the rest of the oocyte (collected as the cytoplasmic fraction). Protein extracts were prepared for whole oocytes, isolated nuclei, or the cytoplasmic fraction and analyzed by western blotting with the anti-CARM1 antibody. As shown in Fig. 4BGo, the endogenous CARM1a was found exclusively in the nucleus. When similar experiments were performed with oocytes injected with mRNA for F-CARM1a and b, Western blot analysis with the anti-FLAG antibody showed that both overexpressed F-CARM1a and b were predominantly, if not exclusively, in the nucleus (Fig. 4CGo).


Figure 4
View larger version (28K):
[in this window]
[in a new window]

  		Fig. 4. Localization of Both CARM1a and b in the Oocyte Nucleus

A, Oocyte contains endogenous CARM1a but not CARM1b. Extracts from uninjected oocytes, or oocytes injected with FLAG-tagged CARM1a or CARM1b mRNA were analyzed by Western blot with anti-CARM1 antibody. The FLAG-tagged CARM1a migrated at similar position as the endogenous CARM1a but FLAG-tagged CARM1b migrated slower as expected. B, Endogenous CARM1 is present in the nucleus. Extracts from the whole oocytes (W), the isolated nuclei (N), or the remaining cytoplasm after the removal of the nucleus (C), were analyzed by Western blot with anti-CARM1 antibody. Note the presence of CARM1 in the nuclear but not cytoplasmic sample. C, Overexpressed F-CARM1a and b are also present in the nuclei of oocytes. Oocytes were injected with mRNAs for FLAG-tagged CARM1a and b. After overnight incubation, the oocytes were isolated and analyzed as in B except the use of anti-FLAG antibody for detecting the overexpressed proteins. Note that essentially all F-CARM1a was in the nucleus. A small amount of F-CARM1b was present in the cytoplasmic sample, possibly due to contaminating nuclear fraction. It is also possible that overexpression might have led to some cytoplasmic accumulation of the proteins. The smaller bands detected might be due to degradation of overexpressed proteins.

 
Both CARM1 Isoforms Are Recruited to the Target Promoter in Oocytes by Liganded TR
Next we investigated whether CARM1b could be recruited to the promoter by using chromatin immunoprecipitation (ChIP) assay. After overnight incubation, the oocytes injected with the reporter DNA and various mRNAs were subjected to ChIP assay with the anti-CARM1 or FLAG antibody. The immunoprecipitated DNA was analyzed by quantitative PCR with two sets of primers, one for the TRE region of target promoter and the other for the negative control region in the ampicillin resistance gene (ß-lactamase) located in the same plasmid but far away from the target promoter (Fig. 5AGo). When ChIP assay was done with anti-CARM1 antibody on oocytes lacking overexpressed F-CARM1, endogenous CARM1 was found to be recruited to the TRE by TR when T3 was present (Fig. 5BGo). Only background signal was found on the control ampicillin resistance gene. Because only CARM1a is expressed in oocytes, these data indicate that CARM1a is recruited by liganded TR to the promoter.


Figure 5
View larger version (22K):
[in this window]
[in a new window]

  		Fig. 5. The Recruitment of Both CARM1a and b to the TRE of TRß Promoter in the Oocytes by Liganded TR

A, Schematic diagram of the reporter plasmid containing the T3-dependent promoter of the Xenopus TRßA gene. Two sets of forward and reverse primers were designed for real-time PCR analysis of the promoter region containing the TRE (top) and a region in the ampicillin resistance gene (bottom), respectively. B, ChIP assay was performed with anti-CARM1 antibody showing the recruitment of endogenous CARM1a to the promoter by TR. Oocytes were injected with the reporter DNA and indicated mRNAs. After overnight incubation in the presence and absence of T3, the oocytes were isolated and subjected to ChIP assay with anti-CARM1 antibody. The precipitated DNA was amplified for detection of the TRE region of the TRßA promoter or the ampicillin resistance gene. Note the enhanced signal of the promoter region but not the ampicillin resistance gene in the presence of both TR/RXR and T3, showing the recruitment of endogenous CARM1a to the promoter. C, ChIP assay showing that overexpressed FLAG-tagged CARM1a (F-CARM1a) and b can be recruited by TR to the promoter. Oocytes were injected with the reporter DNA and indicated mRNAs. After overnight incubation in the presence or absence of T3, the oocytes were isolated and subjected to ChIP assay with anti-FLAG antibody. The precipitated DNA was amplified for detection of the TRE region of the TRßA promoter or the ampicillin resistance gene. Note the enhanced signal of the promoter region but not the ampicillin resistance gene in the presence of both TR/RXR and T3, showing the recruitment of F-CARM1a and b to the promoter. The stars indicate pairs of samples with significant differences (P < 0.05).

 
When similar experiments were performed with anti-FLAG antibody on oocytes injected with mRNA for F-CARM1a or b, we observed, as expected from the data in Fig. 5AGo, that F-CARM1a was recruited by liganded TR (Fig. 5CGo). Similarly, we found that F-CARM1b was also recruited to the promoter by TR in the presence of T3, although the signal for F-CARM1b recruitment was consistently weaker than that of F-CARM1a in several independent experiments.

CARM1b Competitively Inhibits Transcriptional Activation by CARM1a
The above results suggest that CARM1b may compete with CARM1a for recruitment to the promoter by TR and therefore interfere with the coactivation by CARM1a. To test this possibility, we coinjected mRNAs for F-CARM1a and/or b into the frog oocytes. Again, F-CARM1a enhanced the activation by liganded TR and F-CARM1b failed to do so (Fig. 6Go, top panel). Interestingly, when F-CARM1a and F-CARM1b was coexpressed at similar levels (Fig. 6Go, bottom panel), the reporter gene activity was in between that when F-CARM1a alone was overexpressed and that when F-CARM1b was overexpressed or when no CARM1 was overexpressed (Fig. 6Go, top panel, compare lanes 2–5). These results suggest that CARM1b can competitively inhibit CARM1a function.


Figure 6
View larger version (26K):
[in this window]
[in a new window]

  		Fig. 6. CARM1b Competitively Inhibits Transcriptional Activation by CARM1a

Oocytes were injected with the reporter DNA and indicated mRNAs. Totally 11.5 ng of mRNAs were microinjected per oocyte in all experiments by including anti-sense stromelysin-3 mRNA (As-ST3). After overnight incubation in the presence and absence of T3, the oocytes were isolated and subjected to luciferase activity (top) or Western blot analysis with anti-FLAG antibody for the expression of F-CARM1a and b. Note that the expression of F-CARM1a but not F-CARM1b alone enhanced activation by liganded TR and coexpression of F-CARM1b reduced the enhancement by F-CARM1a. The stars indicate pairs of samples with significant differences (P < 0.05).

 
Histone Methylation Is Reduced by CARM1b Overexpression in Oocytes
To investigate why CARM1b failed to activate transcription despite its recruitment to the promoter, we then analyzed methylation levels at the target promoter by using ChIP assay with an antibody against methylated R17 of histone H3, a target of CARM1. As shown in Fig. 7Go, overexpression of TR/RXR led to enhanced methylation in the promoter region in the presence of T3 (Fig. 7Go), likely due to the recruitment of endogenous CARM1a. When F-CARM1a was overexpressed, the methylation level was further elevated (Fig. 7Go) in the promoter region. In contrast, when F-CARM1b was overexpressed, the methylation level at the promoter was reproducibly reduced, although only slightly compared with liganded TR/RXR alone.


Figure 7
View larger version (14K):
[in this window]
[in a new window]

  		Fig. 7. The Methylation of R17 of Histone H3 Is Enhanced and Reduced by F-CARM1a and F-CARM1b Overexpression, Respectively

Oocytes were injected with the reporter DNA and indicated mRNAs. After overnight incubation in the presence or absence of T3, the oocytes were isolated and subjected to ChIP assay with an antibody against methylated of R17 of histone H3. The precipitated DNA was amplified for detection of the TRE region of the TRßA promoter or the ampicillin resistance gene. Note the methylation in the promoter region was increased by TR/RXR and T3. Overexpression of F-CARM1a caused a slight but reproducible enhancement, whereas overexpression of F-CARM1b led to a small reduction. The stars indicate pairs of samples with significant differences (P < 0.05).

 
TR Binding to the TRE Is Reduced by CARM1b Overexpression
Because CARM1b has the same conserved methyltransferase domain as CARM1a, the reduced methylation at the promoter was puzzling given the recruitment of CARM1b by liganded TR. Thus, we analyzed binding of TR to the TRE in vivo by ChIP assay with an anti-TR antibody. In the absence of T3, TR was bound to the TRE and this binding was not affected by the overexpression of either F-CARM1a or F-CARM1b (Fig. 8AGo). Upon T3 treatment, TR binding to the TRE was found to be enhanced under our ChIP assay conditions. Although this was not expected, it was reproducible under our ChIP conditions and is likely due to stabilization of TR binding by coactivator complexes recruited in the presence of T3 or due to different antigenic epitope exposure of TR in the cross-linked complexes in the presence and absence of T3, thereby affecting immunoprecipitation efficiency. Regardless, TR binding to the TRE in the presence of T3 was not affected when F-CARM1a was overexpressed. Interestingly and surprisingly, when F-CARM1b was overexpressed, a very significant reduction in TR binding to the TRE was observed (Fig. 8AGo), even though similar levels of TR was present in the oocytes (Fig. 8BGo). This result suggests that the stability of TR binding to the TRE in vivo can be influenced by the cofactor complexes recruited. The complexes containing F-CARM1b appear to weaken the binding of TR to the TRE compared with those containing F-CARM1a.


Figure 8
View larger version (23K):
[in this window]
[in a new window]

  		Fig. 8. F-CARM1b Overexpression Reduces the Binding of Liganded TR to the TRE

A, Oocytes were injected with the reporter DNA and indicated mRNAs. After overnight incubation in the presence or absence of T3, the oocytes were isolated and subjected to ChIP assay with an antibody against Xenopus TR. The precipitated DNA was amplified for detection of the TRE region of the TRßA promoter or the ampicillin resistance gene. Note the binding of TR to the promoter region was increased by T3 and that overexpression of F-CARM1b but not F-CARM1a caused a significant reduction in TR binding in the presence of T3. B, Western blot on the protein extracts from the same oocytes as in panel A with anti-TR antibody shows similar expression levels of TR in the injected oocytes. The stars indicate pairs of samples with significant differences (P < 0.05).

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
Frog metamorphosis is a unique model to understand the in vivo function and mechanism of TR-mediated transcription (7). Its total dependence on T3 makes it possible to correlate the gene regulation pathways regulated by TR with developmental events in various organs/tissues. Indeed, we and other have shown that TR function is not only necessary but also sufficient for mediating the metamorphic effects (at least those that were analyzed) of T3 during metamorphosis. Furthermore, we have shown that the coactivator SRC3 is recruited by liganded TR in a tissue- and gene-specific manner and that coactivator recruitment is not only necessary for metamorphosis and but also the dominant contributor in gene activation induced by T3 (with corepressor release as a minor component in this) (37, 38), both of which were not predicted based on in vitro and cell culture studies. On the other hand, it remains possible that SRC3 or other members of the SRC family, although they may participate in, are not essential for metamorphosis or gene regulation by TR. In an attempt to address this, we have begun to study the role of cofactors that participate in gene regulation by TR through interacting with SRCs. Our results here show that the Xenopus laevis CARM1 is expressed during metamorphosis, and thus may potentially participate in gene regulation by TR during this process. More importantly, we demonstrate there that there are two alternatively spliced forms of CARM1 with CARM1a but not CARM1b enhances gene activation by liganded TR in vivo.

The Xenopus laevis CARM1a and CARM1b differ only by an extra segment present in the C-terminal activation domain. Comparison with Xenopus tropicalis genomic sequence revealed that this segment is encoded by an extra exon, suggesting that the two forms are derived from alternative splicing, with CARM1b representing a novel form of CARM1 so far discovered in any vertebrate species. It is unclear why CARM1b fails to enhance gene activation by liganded TR, although the extra segment is present in the activation domain. Four different isoforms of CARM1 have been reported in rat and all are able to enhance nuclear receptor-mediated transcription. Interestingly, one isoform, v3 (variant 3), can enhance transcription more than the others and without a requirement for methyltransferase activity, even though it has the same methyltransferase domain but alternative splicing results in the truncation in the same region where the additional sequence Xenopus CARM1b is located (54). Thus, it is not obvious why Xenopus CARM1b fails to enhance TR activation of gene transcription. We have analyzed several potential steps where CARM1b’s function may fail. We have shown that both CARM1 isoforms are localized in the nucleus and can be recruited to the TRE of T3-inducible promoter in chromatin. Interestingly, despite the fact that both CARM1 isoforms have the same methyltransferase domain, the level of methylated R17 of histone H3 was reduced at the target promoter when CARM1b was overexpressed in the oocytes. In contrast, CARM1a overexpression enhances the methylation at the promoter. Our ChIP analysis of TR binding showed that overexpression of CARM1b but not CARM1a reduced the binding of TR to the TRE in chromatin in the presence of T3. Because CARM1b can be recruited by liganded TR to the TRE, the reduced TR binding as detected by ChIP assay may reflect reduced stability of the TR-coactivator complexes at the TRE. Interestingly, in CARM1 knockout cells, nuclear factor-{kappa}B recruitment to some promoters was reduced (55), suggesting that CARM1 can influence transcription factor binding to their targets. Because TR association with TRE may be affected by the complex interactions among different proteins and DNA at the TRE, it may not be surprising that the recruitment of different cofactors may lead to different stabilities of the TR complexes at the TRE. Such a notion is also supported by earlier in vitro observations of the effects of other coactivators on the binding to DNA by TR and estrogen receptor (56, 57, 58) and is also consistent with the fact that TR association with TRE was enhanced in the presence of T3 in vivo under our ChIP conditions.

Although it remains to be determined why CARM1b reduces the association of TR with the TRE, our findings suggest a potential mechanism for the failure of CARM1b to enhance TR function in the presence of T3. Protein arginine methyltransferases function as homodimers (46, 47, 48). The frog oocyte contains CARM1a that participates as homodimers in gene activation by TR in the presence of T3 as shown by its recruitment to the TRE. When CARM1a is overexpressed, it increases the levels of CARM1a homodimers and thus enhances the activation by liganded TR. When CARM1b is overexpressed or when both CARM1a and CARM1b are overexpressed, three kinds of dimers will form: CARM1a homodimers, CARM1b homodimers, and CARM1a/CARM1b heterodimers. We suggest that, because of the extra amino acids encoded by the extra exon in the activation domain, CARM1b homodimers or CARM1a/CARM1b heterodimers, when recruited by TR to the TRE, weakens the overall association of TR-coactivator complexes with the TRE in chromatin. The reduction in TR-coactivator complexes at the TRE would account for the observed lower levels of CRAM1b recruitment and histone methylation at the TRE when CARM1b was overexpressed. This would counteract any potential transcriptional enhancement due to CARM1b recruitment to the promoter, either through histone methylation or other mechanisms (e.g. it is possible that for the fraction of the injected promoter plasmid that remained bound by liganded TR, histone methylation was enhanced by CARM1b. This might have enhanced transcription. Alternatively, CARM1b homo- and heterodimers might methylate other proteins to affect transcription). Consequently, there are no significant effects of CARM1b overexpression on gene activation by liganded TR.

Clearly, future experiments will be needed to determine whether and how both homo- and/or heterodimers of CARM1b weaken TR association with TRE in vivo. It is also worth investigating whether our findings here are promoter specific. It is interesting to note that zebrafish CARM1 has some extra amino acid present at the location whether the extra exon in CARM1b is located. Thus, it is possible that CARM1b or related forms of CARM1 may have conserved functions. Given our findings here, it is interesting to speculate that the relative levels of CARM1a and CARM1b may influence it function in gene regulation by at least TR, if not other nuclear receptors or other transcription factors. During frog metamorphosis, both forms are expressed at least at the mRNA level, although Western blot analysis with the anti-CARM1 antibody has not been sufficiently sensitive for us to detect the two isoforms during metamorphosis. Because we have shown that at least one of the CARM1 binding- and TR-binding coactivators, the Xenopus laevis SRC3, is used by liganded TR during metamorphosis, it is likely that both CARM1a and CARM1b are recruited by TR during metamorphosis when endogenous concentration of T3 rises to high levels. The development of antibodies sensitive and specific for each CARM1 isoform in the future should allow the verification of this possibility (despite several attempts, we have not been able to detect the endogenous CARM1a or 1b in developing tadpole tissues with the current antibody). More importantly, it will be of interest to genetically alter the levels of each isoform to determine their function in gene activation by TR and frog metamorphosis.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Experimental Animals
All experiments involving Xenopus laevis animals described here were conducted in accord with accepted standards of humane animal care and approved by National Institute of Child Health and Human Development Animal Use and Care Committee. Tadpoles of Xenopus laevis were reared in the laboratory or purchased from Xenopus 1, Inc. Animals at indicated stages were killed for RNA isolation.

Cloning and Constructs
Total RNAs were extracted from the intestine of tadpoles at stage 56 by TRIZOL (Invitrogen, Carlsbad, CA), and a cDNA library was constructed by using the SMART RACE cDNA Amplification Kit (BD Biosciences) for 5'-RACE. Primers were designed for 5' RACE based on a CARM1 cDNA sequence in the expressed sequence tag database. A DNA fragment was amplified with a gene-specific primer (5'-CTGTTACAGCCC AGGGTGACAAT-3') and the universal primer mix from the kit as the forward primer in 5' RACE. DNA fragments from 5' RACE were cloned into pcRT7/NT-TOPO Topo vector (Invitrogen). Several clones were isolated and sequenced to obtain the 5'-end of the Xenopus CARM1 coding region.

Forward (GACAGACTACTCGAGATGGCGGCAGTGTCGGTGTT) and reverse (5'-GTCGTATCTACTAGTTTAACTCCCATAATGCATTG-3') primers were used to amplify the full-length Xenopus CARM1. The PCR products were cloned into T7TS vector (59). Several clones were sequenced and found to be identical in sequence.

For expression and detection in frog oocytes, three copies of the FLAG tag were added to the N terminus of Xenopus CARM1 by PCR with a primer containing FLAG sequence (GACTAACCGGTATGGACTAAAAAGACCATGACGGTGATTATAAAGATCATGATATCGATTACAAGGATGACGATGACAAGCTTCTCGAGATGGCGGCAGT, where the underlined letters encode the three repeats of the FLAG-tag and the bold letters are from the CARM1 sequence) and the fusion protein was cloned in the T7TS vector.

RT-PCR
Total RNA were extracted from the intestine and tail of tadpoles at stage 54, 58, 61, and 66 (no tail at this stage) by TRIZOL (Invitrogen) and followed by deoxyribonuclease treatment with DNA-free (Ambion, Austin, TX) to remove any DNA contamination. RT-PCR was performed by using Super-Script One-Step RT-PCR with Platinum Taq (Invitrogen) with 500 ng total RNA as the template. For detection of both CARM1a and b, forward primer f (ACACAGGAGGGGCATATACAATG) and reverse primer r-a (5'-TGCAGATCCTTGCACTATGCCCG-3') were used. For detection of only CARM1b, reverse primer was changed to primer r-b: 5'-GGAGGTTCCGAGTGTCAGGT-3'. All RT-PCRs included an internal control amplifying a fragment of ribosomal protein L8 (rpL8) (60, 61).

Quantitative RT-PCR with a Taqman probe was also carried out to quantify gene expression levels on ABI 7000 (Applied Biosciences, Foster City, CA) as described previously (62). For detection of both CARM1a and b, forward primer GATGTCCGGACTCAGAGAAGAG), reverse primer TGTACCGCCGACGACTCT and FAM-labeled Taq-man probe TCCGCTCGCTGAACAC were used. For detection of only CARM1b, forward primer GTGAGCCTCCTGCAGTCT, reverse primer GGTTCCGAGTGTCAGGTCTTG and FAM-labeled Taq-man probe CTGCACTCGGAGCCC were used. A set of primer/probe specific for ribosomal protein rpL8 (62) was used as a control for RNA input for each sample, and the expression level of the gene of interest in each sample was normalized to that of rpL8.

Transcription Assay in Xenopus Oocytes and Western Blot Analysis
The transcription assay in the Xenopus oocyte was previously described in detail (63). To express proteins in the oocytes, expression plasmids were used to make the corresponding mRNAs with T7 or SP6 in vitro transcription kits (mMESSAGE mMACHINE; Ambion). The mRNAs (1.15 ng/oocyte for TR and RXR, 1.15–4.60 ng/oocyte for FLAG tagged CARM1a (F-CARM1a), 1.725–6.9 ng/oocyte for F-CARM1b) were microinjected into the cytoplasm. When indicated, the amount of RNA injected per oocyte was equalized by including 4.6–11.5 ng/oocyte of antisense mRNA of stromelysin-3, an extracellular protease (62), although the amount of nonspecific RNA injected has no effect on reporter gene expression (data not shown). The firefly luciferase reporter plasmid TRE-Luc (0.33 ng/oocytes), containing the T3-regulated promoter of Xenopus TRßA gene, and the control Renilla luciferase vector phRG-TK (0.03 ng/oocytes) were coinjected into nucleus after mRNA injection. After overnight incubation at 18 C in the absence or presence of 100 nM T3, oocyte lysates were prepared for luciferase assay with the dual-luciferase assay kit (Promega) to determine the relative expression levels from the T3-regulated promoter over the control promoter. Nine identically injected oocytes for each sample were divided into three groups and luciferase assay was done for each group. Each data point represented the average of the three groups. The data shown here are representative of three to six independent experiments with similar results. A portion of the lysates was used for Western blotting with indicated antibodies.

ChIP Assay
The mRNAs (5.75 ng/oocytes for TR, RXR and F-CARM1a, 8.625 ng/oocyte for F-CARM1b) were injected into the cytoplasm of 20 oocytes. The nucleus of the oocytes was then injected with reporter DNA TRE-Luc (0.99 ng/oocyte) and phRG-TK (0.09 ng/oocyte). After overnight incubation at 18 C, the oocytes were treated with 1% formaldehyde for 15 min. The oocytes were washed twice with MBSH [10 mM HEPES (pH 7.6), 88 mM NaCl, 1 mM KCl, 2.4 mM NaHCO3 0.8 mM MgSO4, 0.4 mM CaCl2, 0.3 mM Ca(NO3)2] and then incubated with 100 mM Tris-HCl (pH 9.4), 10 mM dithiothreitol at 30 C for 15 min. The oocytes were then rinsed once with the homogenization buffer [20 mM Tris-HCl (pH 7.6), 60 mM KCl, 15 mM NaCl, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride and Complete Mini EDTA-free (Roche, Indianapolis, IN; proteinase inhibitor cocktail tablets)] and homogenize in the homogenization buffer. The homogenates were sonicated on ice and centrifuged at 13,000 rpm for 15 min at 4 C. The chromatin in the supernatant was diluted with equal volume of ChIP I buffer [0.1% sodium deoxycholate; 1% Triton X-100; 2 mM EDTA; 50 mM HEPES (pH 7.5); 150 mM NaCl, 0.4 mM phenylmethylsulfonyl fluoride and Complete Mini EDTA-free (Roche; proteinase inhibitor cocktail tablets)], quantitated, and frozen in aliquots at –80 C.

For immunoprecipitation, the DNA concentration of the chromatin was diluted to 10 ng/µl with a solution of equal volume of the homogenization buffer and ChIP Buffer I. After preclearing with salmon sperm DNA/protein A-agarose beads (Upstate Cell Signaling Solutions, Lake Placid, NY), input samples were taken, and 100 µl of each chromatin sample were added to tubes with antibodies against CARM1 (Upstate), TR [PB, (50)], or antimethylated R17 of histone H3 (Upstate), and salmon sperm DNA/protein A-agarose beads. The mixture was incubated overnight at 4 C. After incubation, the beads were washed with 1 ml of ChIP Buffer I, ChIP Buffer II, ChIP Buffer III and TE in succession (Upstate). After the last wash, 100 µl of elution buffer were added to the samples as well as the input controls and incubated at 65 C for 6 h. The DNA was purified by QIAquick PCR Purification Kit (QIAGEN) and eluted with 40 µl EB buffer (QIAGEN).

Quantitative PCR with Taq-man probes was carried out to analyze the ChIP DNA on ABI 7000 (Applied Biosciences) by using gene-specific primers for the TRß promoter (6) and ampicillin resistance gene (forward primer: 5'-GCCGAGCGCAGAAGTG-3', reverse primer: 5'-TCTAGCTTCCCGGCAACAATTAA-3', and FAM-labeled Taq-man probe: 5'-CCGCCTCCATCCAGTCTA-3'). All ChIP experiments were done three to four times with similar results.


   FOOTNOTES
 
This work was supported by the Intramural Research Program of the National Institute of Child Health and Human Development, National Institutes of Health (NIH). H.M. was supported in part by a Japan Society for the Promotion of Science (NIH) fellowship.

Present address for B.D.P.: Solomon H. Snyder Department of Neuroscience, Woods Basic Science Building, Room 807, 725 North Wolfe Street, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205.

Present address for C.Y.C.: Division of Marine Environment & BioScience, Korea Maritime University, Busan 606-791, Korea.

Disclosure Statement: The authors have nothing to disclose.

First Published Online February 20, 2007

Abbreviations: CARM1, Coactivator-associated arginine methyltransferase 1; CBP, cAMP response element binding protein-binding protein; ChIP, chromatin immunoprecipitation; PRMT1, protein arginine methyltransferase 1; RACE, rapid amplification of cDNA ends; RXR, 9-cis-retinoic acid receptor; SRC, steroid receptor coactivator; TR, thyroid hormone receptors.

Received for publication October 26, 2006. Accepted for publication February 15, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Dodd MHI, Dodd JM 1976 The biology of metamorphosis. In: Lofts B, ed. Physiology of the amphibia. New York: Academic Press; 467–599
  2. Shi YB 1999 Amphibian metamorphosis: from morphology to molecular biology. New York: John Wiley, Sons, Inc.
  3. Lazar MA 1993 Thyroid hormone receptors: multiple forms, multiple possibilities. Endocr Rev 14:184–193[CrossRef][Medline]
  4. Yen PM 2001 Physiological and molecular basis of thyroid hormone action. Physiol Rev 81:1097–1142[Abstract/Free Full Text]
  5. Schreiber AM, Das B, Huang H, Marsh-Armstrong N, Brown DD 2001 Diverse developmental programs of Xenopus laevis metamorphosis are inhibited by a dominant negative thyroid hormone receptor. Proc Natl Acad Sci USA 98:10739–10744[Abstract/Free Full Text]
  6. Buchholz DR, Tomita A, Fu L, Paul BD, Shi Y-B 2004 Transgenic analysis reveals that thyroid hormone receptor is sufficient to mediate the thyroid hormone signal in frog metamorphosis. Mol Cell Biol 24:9026–9037[Abstract/Free Full Text]
  7. Buchholz DR, Paul BD, Fu L, Shi YB 2006 Molecular and developmental analyses of thyroid hormone receptor function in Xenopus laevis, the African clawed frog. Gen Comp Endocrinol 145:1–19[CrossRef][Medline]
  8. Buchholz DR, Hsia VS-C, Fu L, Shi Y-B 2003 A dominant negative thyroid hormone receptor blocks amphibian metamorphosis by retaining corepressors at target genes. Mol Cell Biol 23:6750–6758[Abstract/Free Full Text]
  9. Oppenheimer JH, Schwartz HL, Mariash CN, Kinlaw WB, Wong NC, Freake HC 1987 Advances in our understanding of thyroid hormone action at the cellular level. Endocr Rev 8:288–308[Medline]
  10. Samuels HH, Forman BM, Horowitz ZD, Ye S 1988 Regulation of gene expression by thyroid hormone. J Clin Invest 81:957–967[Medline]
  11. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889–895[Abstract/Free Full Text]
  12. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  13. Tsai MJ, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Ann Rev Biochem 63:451–486[CrossRef][Medline]
  14. Ito M, Roeder RG 2001 The TRAP/SMCC/mediator complex and thyroid hormone receptor function. Trends Endocrinol Metab 12:127–134[CrossRef][Medline]
  15. Rachez C, Freedman LP 2000 Mechanisms of gene regulation by vitamin D(3) receptor: a network of coactivator interactions. Gene 246:9–21[CrossRef][Medline]
  16. Zhang J, Lazar MA 2000 The mechanism of action of thyroid hormones. Annu Rev Physiol 62:439–466[CrossRef][Medline]
  17. Burke LJ, Baniahmad A 2000 Co-repressors 2000. FASEB J 14:1876–1888[Abstract/Free Full Text]
  18. Jepsen K, Rosenfeld MG 2002 Biological roles and mechanistic actions of co-repressor complexes. J Cell Sci 115:689–698[Abstract/Free Full Text]
  19. Jones PL, Shi YB 2003 N-CoR-HDAC corepressor complexes: roles in transcriptional regulation by nuclear hormone receptors. In: Workman JL, ed. Current topics in microbiology and immunology: protein complexes that modify chromatin. Berlin: Springer-Verlag 237–268
  20. Huang Z-Q, Li J, Sachs LM, Cole PA, Wong J 2003 A role for cofactor—cofactor and cofactor—histone interactions in targeting p300, SWI/SNF and Mediator for transcription. EMBO J 22:2146–2155[CrossRef][Medline]
  21. McKenna NJ, O’Malley BW 2001 Nuclear receptors, coregulators, ligands, and selective receptor modulators: making sense of the patchwork quilt. Ann NY Acad Sci 949:3–5[Abstract/Free Full Text]
  22. Rachez C, Freedman LP 2001 Mediator complexes and transcription. Curr Opin Cell Biol 13:274–280[CrossRef][Medline]
  23. Hong H, Kohli K, Trivedi A, Johnson DL, Stallcup MR 1996 GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc Natl Acad Sci USA 93:4948–4952[Abstract/Free Full Text]
  24. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  25. Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan XY, Sauter G, Kallioniemi OP, Trent JM, Meltzer PS 1997 AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277:965–968[Abstract/Free Full Text]
  26. Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569–580[CrossRef][Medline]
  27. Li H, Gomes PJ, Chen JD 1997 RAC3, a steroid/nuclear receptor-associated coactivator that is related to SRC-1 and TIF2. Proc Natl Acad Sci USA 94:8479–8484[Abstract/Free Full Text]
  28. Takeshita A, Cardona GR, Koibuchi N, Suen CS, Chin WW 1997 TRAM-1, a novel 160-kDa thyroid hormone receptor activator molecule, exhibits distinct properties from steroid receptor coactivator-1. J Biol Chem 272:27629–27634[Abstract/Free Full Text]
  29. Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfeld MG 1997 The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function. Nature 387:677–684[CrossRef][Medline]
  30. Suen CS, Berrodin TJ, Mastroeni R, Cheskis BJ, Lyttle CR, Frail DE 1998 A transcriptional coactivator, steroid receptor coactivator-3, selectively augments steroid receptor transcriptional activity. J Biol Chem 273:27645–27653[Abstract/Free Full Text]
  31. Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  32. Voegel JJ, Heine MJ, Tini M, Vivat V, Chambon P, Gronemeyer H 1998 The coactivator TIF2 contains three nuclear receptor-binding motifs and mediates transactivation through CBP binding-dependent and -independent pathways. EMBO J 17:507–519[CrossRef][Medline]
  33. Demarest SJ, Martinez-Yamout M, Chung J, Chen H, Xu W, Dyson HJ, Evans RM, Wright PE 2002 Mutual synergistic folding in recruitment of CBP/p300 by p160 nuclear receptor coactivators. Nature 415:549–553[CrossRef][Medline]
  34. Chen D, Ma H, Hong H, Koh SS, Huang SM, Schurter BT, Aswad DW, Stallcup MR 1999 Regulation of transcription by a protein methyltransferase. Science 284:2174–2177[Abstract/Free Full Text]
  35. Koh SS, Chen DG, Lee YH, Stallcup MR 2001 Synergistic enhancement of nuclear receptor function by p160 coactivators and two coactivators with protein methyltransferase activities. J Biol Chem 276:1089–1098[Abstract/Free Full Text]
  36. Paul BD, Shi Y-B 2003 Distinct expression profiles of transcriptional coactivators for thyroid hormone receptors during Xenopus laevis metamorphosis. Cell Res 13:459–464[CrossRef][Medline]
  37. Paul BD, Buchholz DR, Fu L, Shi Y-B 2005 Tissue- and gene-specific recruitment of steroid receptor coactivator-3 by thyroid hormone receptor during development. J Biol Chem 280:27165–27172[Abstract/Free Full Text]
  38. Paul BD, Fu L, Buchholz DR, Shi Y-B 2005 Coactivator recruitment is essential for liganded thyroid hormone receptor to initiate amphibian metamorphosis. Mol Cell Biol 25:5712–5724[Abstract/Free Full Text]
  39. Schurter BT, Koh SS, Chen D, Bunick GJ, Harp JM, Hanson BL, Henschen-Edman A, Mackay DR, Stallcup MR, Aswad DW 2001 Methylation of histone H3 by coactivator-associated arginine methyltransferase 1. Biochemistry 40:5747–5756[CrossRef][Medline]
  40. Bauer UM, Daujat S, Nielsen SJ, Nightingale K, Kouzarides T 2002 Methylation at arginine 17 of histone H3 is linked to gene activation. EMBO Rep 3:39–44[CrossRef][Medline]
  41. Lee YH, Koh SS, Zhang X, Cheng X, Stallcup MR 2002 Synergy among nuclear receptor coactivators: selective requirement for protein methyltransferase and acetyltransferase activities. Mol Cell Biol 22:3621–3632[Abstract/Free Full Text]
  42. Chen D, Huang SM, Stallcup MR 2000 Synergistic, p160 coactivator-dependent enhancement of estrogen receptor function by CARM1 and p300. J Biol Chem 275:40810–40816[Abstract/Free Full Text]
  43. Xu W, Chen H, Du K, Asahara H, Tini M, Emerson BM, Montminy M, Evans RM 2001 A transcriptional switch mediated by cofactor methylation. Science 294:2507–2511[Abstract/Free Full Text]
  44. Chevillard-Briet M, Trouche D, Vandel L 2002 Control of CBP co-activating activity by arginine methylation. EMBO J 21:5457–5466[CrossRef][Medline]
  45. Daujat S, Bauer UM, Shah V, Turner B, Berger S, Kouzarides T 2002 Crosstalk between CARM1 methylation and CBP acetylation on histone H3. Curr Biol 12:2090–2097[CrossRef][Medline]
  46. Zhang X, Cheng X 2003 Structure of the predominant protein arginine methyltransferase PRMT1 and analysis of its binding to substrate peptides. Structure 11:509–520[Medline]
  47. Zhang X, Zhou L, Cheng X 2000 Crystal structure of the conserved core of protein arginine methyltransferase PRMT3. EMBO J 19:3509–3519[CrossRef][Medline]
  48. Teyssier C, Chen DG, Stallcup MR 2002 Requirement for multiple domains of the protein arginine methyltransferase CARM1 in its transcriptional coactivator function. J Biol Chem 277:46066–46072[Abstract/Free Full Text]
  49. Shi Y-B, Ishizuya-Oka A 1996 Biphasic intestinal development in amphibians: embryogensis and remodeling during metamorphosis. Curr Topics Dev Biol 32:205–235[Medline]
  50. Wong J, Shi Y-B 1995 Coordinated regulation of and transcriptional activation by Xenopus thyroid hormone and retinoid X receptors. J Biol Chem 270:18479–18483[Abstract/Free Full Text]
  51. Ranjan M, Wong J, Shi YB 1994 Transcriptional repression of Xenopus TR ß gene is mediated by a thyroid hormone response element located near the start site. J Biol Chem 269:24699–24705[Abstract/Free Full Text]
  52. Amano T, Leu K, Yoshizato K, Shi Y-B 2002 Thyroid hormone regulation of a transcriptional coactivator in Xenopus laevis: implication for a role in postembryonic tissue remodeling. Dev Dyn 223:526–535[CrossRef][Medline]
  53. Li J, Lin Q, Yoon HG, Huang ZQ, Strahl BD, Allis CD, Wong J 2002 Involvement of histone methylation and phosphorylation in regulation of transcription by thyroid hormone receptor. Mol Cell Biol 22:5688–5697[Abstract/Free Full Text]
  54. Ohkura N, Takahashi M, Yaguchi H, Nagamura Y, Tsukada T 2005 Coactivator-associated arginine methyltransferase 1, CARM1, affects pre-mRNA splicing in an isoform-specific manner. J Biol Chem 280:28927–28935[Abstract/Free Full Text]
  55. Covic M, Hassa PO, Saccani S, Buerki C, Meier NI, Lombardi C, Imhof R, Bedford MT, Natoli G, Hottiger MO 2005 Arginine methyltransferase CARM1 is a promoter-specific regulator of NF-{kappa}B-dependent gene expression. EMBO J 24:85–96[CrossRef][Medline]
  56. Kim MY, Woo EM, Chong YT, Homenko DR, Kraus W 2006 Acetylation of estrogen receptor {alpha} by p300 at lysines 266 and 268 enhances the deoxyribonucleic acid binding and transactivation activities of the receptor. Mol Endocrinol 20:1479–1493[Abstract/Free Full Text]
  57. Dialllo EM, Thompson DL, Koenig RJ 2005 A method for efficient production of recombinant thyroid hormone receptors reveals that receptor homodimer-DNA binding is enhanced by the coactivator TIF2. Protein Expr Purif 40:292–298[CrossRef][Medline]
  58. Landel CC, Kushner PJ, Greene GL 1995 Estrogen receptor accessory proteins: effects on receptor-DNA interactions. Environ Health Perspect Suppl 7:23–28
  59. Tomita A, Buchholz DR, Obata K, Shi YB 2003 Fusion protein of retinoic acid receptor a with promeyelocytic leukaemia protein or promyelocytic leukaemia zinc-finger protein recruits N-CoR-TBLR1 corepressor complex to repress transcription in vivo. J Biol Chem 278:30788–30795[Abstract/Free Full Text]
  60. Hasebe T, Hartman R, Matsuda H, Shi YB 2006 Spatial and temporal expression profiles suggest the involvement of gelatinase A and membrane type 1 matrix metalloproteinase in amphibian metamorphosis. Cell Tissue Res 324:105–116[CrossRef][Medline]
  61. Shi YB, Liang VC-T 1994 Cloning and characterization of the ribosomal protein L8 gene from Xenopus laevis. Biochimica et Biophysica Acta 1217:227–228[Medline]
  62. Fu L, Ishizuya-Oka A, Buchholz DR, Amano T, Shi Y-B 2005 A causative role of stromelysin-3 in ECM remodeling and epithelial apoptosis during intestinal metamorphosis in Xenopus laevis. J Biol Chem 280:27856–27865[Abstract/Free Full Text]
  63. Tomita A, Buchholz DR, Shi Y-B 2004 Recruitment of N-CoR/SMRT-TBLR1 corepressor complex by unliganded thyroid hormone receptor for gene repression during frog development. Mol Cell Biol 24:3337–3346[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   TRα  |  TRβ  |  RXRα
Coregulators:   CARM1
Ligands:   Thyroid hormone




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
21/5/1082    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuda, H.