| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
(ER
) and Represses ER
Messenger RNA and Protein Expression in Breast Cancer Cell LinesDepartment of Cell Biology (B.D.A., B.A.W.) and Department of Molecular, Microbial and Structural Biology and Center for Vascular Biology (H.F.), University of Connecticut Health Center, Farmington, Connecticut 06030
Address all correspondence and requests for reprints to: Bruce White, Department of Cell Biology, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, Connecticut 06030. E-mail: BWhite{at}nso2.uchc.edu.
| ABSTRACT |
|---|
|
|
|---|
-negative breast cancer, regulates the expression of ER
. Two putative miR-206 sites, (hER
1 and hER
2), were found in silico within the 3'-untranslated region of human ER
mRNA. Transfection of MCF-7 cells with pre-miR-206 or 2'-O-methyl antagomiR-206 specifically decreased or increased, respectively, ER
mRNA levels. Overexpression of pre-miR-206 reduced ER
and ß-actin protein levels, with no effect on ERß, E-cadherin, or glyceraldehyde-3-phosphate dehydrogenase. Reporter constructs containing the hER
1 or hER
2 binding sites inserted into the 3'-untranslated region of the luciferase mRNA conferred a 1.6- and 2.2-fold repression of luciferase activity, respectively, in HeLa cells. Both miR-206 sites responded accordingly to exogenous hsa-pre-miR-206 and 2'-O-methyl antagomiR-206, and both sites were rendered inactive by mutations that disrupted hybridization to the 5'-seed of miR-206. A C
T single nucleotide polymorphism in the hER
1 site increased repression of luciferase activity to approximately 3.3-fold in HeLa cells. MiR-206 levels were higher in ER
-negative MB-MDA-231 cells than ER
-positive MCF-7 cells, but only the ER
1 site mediated significantly more repression in reporter constructs. MiR-206 expression was strongly inhibited by ER
agonists, but not by an ERß agonist or progesterone, indicating a mutually inhibitory feedback loop. These findings provide the first evidence for the posttranscriptional regulation of ER
by a micro-RNA in the context of breast cancer. | INTRODUCTION |
|---|
|
|
|---|
The results of animal studies, including mouse estrogen receptor (ER)
(
ERKO) and ERß (ßERKO) knockouts, indicate that the proliferative effects of estrogen are mediated primarily by ER
(4, 5). For example,
ERKO mice, but not ßERKO mice, show extremely stunted mammary ductal growth. In this respect, ER
acts as a ligand-activated oncogene product in reproductive tissues and indeed the overexpression of ER
correlates with a higher risk for breast and endometrial cancers (6, 7). As such, it is not surprising that ER
expression and activity are tightly regulated by numerous mechanisms. Expression of the human ER
gene (ESR1) is controlled at the transcriptional level by seven different promoters used in a cell-specific manner (8). Furthermore, this complex transcriptional unit can undergo alternative splicing, which has been shown to generate shorter ER
isoforms (9). The ER
protein is also subjected to posttranslational regulation, including phosphorylation, acetylation, sumoylation, and polyubiquitination by HECT domain-containing E3 ligases (e.g. E6-AP, Rsp5/Rpf1) (10, 11, 12, 13, 14, 15). Posttranslational regulation of ER
activity also involves ER
-protein interactions with calmodulin, cyclin D1, BRCA1, metastasis-associated protein-2, transcriptional factors (e.g. c-fos/c-jun heterodimers), and coregulatory proteins (e.g. steroid receptor coregulator 1, cAMP response element-binding protein-binding protein/p300) (16, 17, 18).
A hallmark of most human breast cancers is the dysregulation of ER
expression. Approximately 70% of diagnosed primary breast cancers overexpress ER
, which can have profound implications for the treatment and prognosis of breast cancer. ER
-positive (ER
+) breast cancer cells are dependent on E2 for their survival and progression (19). Consequently, ER
+ breast cancers respond favorably to adjuvant therapy with selective estrogen modulators (20), which act as ER
antagonists in breast tissue. Additionally, inhibitors of CYP19-aromatase are effective adjuvant drugs for the treatment of ER
+ breast cancers in postmenopausal women (21).
In contrast, about one-third of breast cancer patients are diagnosed with a form of cancer that does not express ER
. These ER
-negative (ER
) breast cancer cells are typically more transformed and undergo proliferation independently of estrogenic stimulation (7, 19). Thus, the inability to use established endocrine/hormonal therapies mentioned above limits the treatment options for these patients. Multiple mechanisms involved in the silencing of ER
in these breast tumor types have been identified, including mutations within the open reading frame of the ESR1 gene (9), as well as the loss of ER
expression through transcriptional silencing by promoter-proximal DNA methylation at CpG islands in the ESR1 gene (7, 22, 23, 24). However, given the complex regulation of ER
in normal cells (see above), it is likely that other mechanisms lead to or reinforce the loss of ER
in some cancer cells. A better understanding of these mechanisms might uncover causal links between the loss of ER
and the gain of transforming signaling pathways, as well as provide insight into the physiological regulation of ER
density among tissues in the face of changing reproductive states.
One mechanism for the posttranscriptional silencing of gene expression is the targeting of mRNAs by one or more specific micro-RNAs (miRNAs). miRNAs are a novel class of regulatory molecules that have been shown to control gene expression at the posttranscriptional level (25). The genes for these small noncoding RNAs, positioned along intragenic and intergenic regions within the human genome, are transcribed by RNA polymerase II and in some cases RNA polymerase III (26, 27, 28). The primary miRNAs are then processed by a complex of both nuclear and cytosolic RNase III enzymes to form mature miRNAs, which are approximately 1924 nucleotides in length (29, 30, 31). The RNaseIII-like nuclease Dicer, along with other RNA-binding/modifying proteins, engineers the dissociation of the two strands and the selection of the mature (guide) miRNA strand (32, 33, 34). The single-stranded miRNA becomes incorporated into a ribonucleoprotein complex, the core component of which is the Argonaute protein family (35, 36, 37), and forms imprecise hybrids with the 3'-untranslated region (3'-UTR) of a particular target mRNA. The transcript is then directed toward a process of mRNA cleavage or alternatively undergoes translational inhibition (38, 39, 40, 41).
Dysregulation of miRNA expression might occur through either a genetic or epigenetic alteration of a miRNA gene, or by the presence of single-nucleotide polymorphisms (SNPs) that reside within the 3'-UTR of miRNA target mRNAs (42, 43). Dysregulation of miRNA expression is currently under intense investigation, which has revealed that miRNAs can act as oncogenes (so-called "oncomiRs") or as tumor-suppressors (25). For instance, let-7 functions as a tumor suppressor in the lungs, because its down-regulation in lung carcinoma allows for increased expression of the Ras protein (44). In some cancers, tumor suppressor miRNAs are completely absent due to gene deletion. The miRNA cluster harboring miR-15a and miR-161 at chromosome 13q14 exists within a deleted region associated with chronic lymphocytic leukemia (45). These two miRNAs target and repress the antiapoptotic BCL-2 transcript, thereby allowing for unchecked survival/proliferation of lymphocytes. Conversely, some miRNAs are up-regulated in cancer and appear to act as oncogenes. The miRNAs, miR-221, miR-222, and miR-146, are up-regulated in papillary thyroid carcinomas (46). These miRNAs target c-kit, which may play a selective role in the pathogenesis of this type of cancer.
The evidence for miRNA regulation of ER
in human breast cancer is limited. A key study by Kenealy et al. (47) determined that segments of the hER
3'-UTR lead to the destabilization of ER
, potentially through interactions with certain regulatory elements. These regions within the extremely long hER
3'-UTR are likely to be miRNA binding sites, which would provide a novel mechanism for the posttranscriptional regulation of ER
. Microarray studies on miRNA levels in various human breast cancer tissues have revealed that some miRNAs are up-regulated in breast cancer vs. normal breast tissue, and a smaller cohort of miRNAs are up-regulated in ER
vs. ER
+ tumors (48). One miRNA observed to be up-regulated in ER
breast cancer was miR-206. In the current study, we demonstrate that miR-206 decreases endogenous ER
mRNA and protein levels in human MCF-7 breast cancer cells by acting through two specific miR-206 target sites within the 3'-UTR of the human ER
transcript. These findings provide the first evidence of a specific miRNA involved in the regulation of the human ER
in breast cancer cell lines.
| RESULTS |
|---|
|
|
|---|
3'-UTR Contains Two Potential miR-206 Target Sites via in Silico Analysis
, in silico analysis was performed using RNA hybrid (49) and miRanda (50). Because ER
has an extremely long 3'-UTR of 4.3 kb, an attempt was made to verify and constrain our results for the most favorable miRNA binding locations. Discovery of miRNA target sites via miRanda are determined by the degree of complementarity of a sequence to the guide strand of a specific miRNA, and whether this sequence resides within a conserved region. The RNA hybrid program uses a free energy (
G) algorithm to calculate favorable binding interactions between a miRNA and potential sites within the mRNA of interest.
|
G of not more than 25 kcal/mol, that tend to cluster in isolated regions of the 3'-UTR of ER
. These 65 sites were selected to contain fewer than three potential hairpin formations and have minimal G:U basepairing. Importantly, this in silico data revealed the existence of two putative miR-206 target sites within the 3'-UTR of ER
(Fig. 1B
-negative breast cancer (48), were not identified in our analysis of the ER
3'-UTR. Both miR-206 sites have a similar free energy of 25.7 kcal/mol. The first site (hER
1) is approximately 95% conserved from human to rat, whereas the second site (hER
2) was found only in humans and was determined through RNA hybrid.
MiR-206 Regulates Endogenous ER
mRNA and Protein Expression in Breast Cancer Cells
Regulation by miRNAs of protein translation can be due to translational repression and/or mRNA degradation. To assess whether miR-206 has a functional role in the down-regulation of endogenous ER
expression by either of these mechanisms, MCF-7 cells were transfected with synthetic miR-206-specific RNAs, and 24 h after transfection the cells were assayed for ER
mRNA expression (Fig. 2
).
|
mRNA levels (Fig. 2A
was repressed by approximately 2.5-fold with 100 nM of hsa-pre-miR-206 and was specific because no changes were noted in RPL-19 mRNA levels. Synthetic pre-miR-neg (a scrambled miRNA sequence) did not alter ER
, RPL-19, or miR-206 RNA levels. To further validate these results, MCF-7 cells were treated with 2'-O-methyl antagomiRs, which are single-stranded modified RNAs that have a complimentary sequence to mature miRNAs and function by sequestering/degrading endogenous miRNAs (51, 52). When 20 nM antagomiR-206 was transfected into MCF-7 cells, ER
mRNA increased as much as 7.5-fold (Fig. 2B
mRNA levels in MCF-7 cells, probably through a mechanism of mRNA degradation/ cleavage.
The effects of miR-206 on ER
protein levels in MCF-7 cells were examined by constructing a miR-206 expression construct (PS-206). The pre-miR-206 along with 38 bp of endogenous flanking sequence was inserted downstream of the cytomegalovirus (CMV) promoter in the pSilencer 4.1-CMV neo vector (Fig. 3A
). Transfection of 5 µg PS-206 into duplicate dishes of MCF-7 cells for 72 h increased miR-206 levels by approximately 50-fold, as assayed by real-time PCR and Northern blot analysis (Fig. 3B
). Duplicate dishes of MCF-7 and T47D cells were then transfected with 5, 10, and 20 µg of PS-206 or PS-neg for 48 h (Fig. 3C
). PS-206 induced a dose-dependent decrease in ER
, reducing it by approximately 70% at 20 µg of vector in both cell lines. This effect was highly specific, in that elevated miR-206 had no effect on ERß, E-cadherin, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The PS-neg construct, which expressed a small interfering RNA against GAPDH, effectively repressed GAPDH levels by about 5075% after 48 h with the 20-µg treatment. These results demonstrate that miR-206 has the ability to reduce ER
expression in human breast cancer cells. PS-206 induced a dose-dependent decrease in nonmuscle ß-actin as well. Subsequent TargetScan analysis indicated that a potential miR-206 target site is located at position 223255 in the 3'-UTR of ß-actin. This finding is likely related to the role of miR-206 in striated muscle differentiation from myoblasts (see Discussion).
|
mRNA in HeLa Cells
by miR-206 occurred through direct targeting of the ER
3'-UTR. A luciferase reporter assay (53) was used to determine whether miR-206 could bind to the two putative miR-206 target sites (Fig. 1B
3'-UTR. In this assay, levels of luciferase activity correlated to translational repression and/or destabilization of the luciferase mRNA. Luciferase reporter constructs were made to contain either the miR-206 target site-1 (pIS-ER
1) or miR-206 target site-2 (pIS-ER
2) in the 3'-UTR of luciferase (Fig. 4A
|
1 or pIS-ER
2 constructs in HeLa cells for 24 h conferred repression of luciferase activity as compared with the control (pIS-0) construct (Fig. 4B
1 and pIS-ER
2 constructs yielded a 1.6- and 2.2-fold repression in luciferase activity, respectively, as compared with pIS-0. In the miR-206 site-1, insertion of a T residue allowed for complementation with the fourth nucleotide of the miRNA (see arrowhead in Fig. 1B
1 and pIS-ER
2, which is expected. Collectively, these data indicate the presence of two specific miR-206 binding sites within the 3'-UTR of the ER
transcript.
To confirm that miR-206 is the specific miRNA repressing the activity of our constructs, we performed experiments in which the endogenous pool of miR-206 was altered in the HeLa cells. Transfection of pre-miR-206 further repressed luciferase activity in a dose-dependent manner in both ER
constructs (Fig. 5A
). In contrast, pre-miR-206 had no effect on the pIS-0 and pIS-33 constructs [which does not contain a miRNA binding site or includes a nonspecific sequence containing a miR-19a binding site in phosphatase and tensin analog mRNA (53), respectively]. Conversely, 2'-O-methyl antagomiRs restored luciferase activity in both the pIS-ER
1 and pIS-ER
2 constructs by approximately 1.5-fold at the highest dose of 40 nM (Fig. 5B
). Neither pre-miR-206 nor antagomiR-206 had an effect on the 5'-mutant constructs (pIS-ER
15' and pIS-ER
25') (Fig. 5C
). A let-7-specific modified RNA was then used to determine whether miR-206 specifically targeted the predicted miR-206 sites within ER
. Whereas the let-7 specific RNAs were confirmed as biologically active (data not shown), no effect was seen on either pIS-ER
1 or pIS-ER
2 (Fig. 5D
). These results indicate that both miR-206 target sites identified in the human ER
3'-UTR specifically interact with miR-206, which in turn represses the corresponding ER
mRNA and protein expression.
|
T SNP within the miR-206 target site-1 of the ER
3'-UTR (Fig. 6A
T functional variant alters the positions of the compliment base pairing between miR-206 and the ER
3'-UTR, such that nucleotides 10 and 11 of miR-206 would bind to the 3'-UTR as opposed to nucleotides 11 and 12. According to Elbashir et al. (55), one would predict that this shift would allow for enhanced Argonaute2 (Ago2)-mediated mRNA degradation through the intrinsic slicer actions of the Ago2 protein. To determine whether the functional variant affected the binding capability and the function of miR-206, luciferase constructs with the variant (pIS-ER
1-SNP) were transfected into HeLa cells as mentioned above. When compared with the pIS-0 and pIS-ER
1 constructs, reporter activity in the p-206-SNP constructs was significantly lowered by approximately 3.6- and 2.2-fold, respectively (Fig. 6B
1-SNP-transfected cells were treated with 200 nM pre-miR-206 (186.42 ± 6.04 light units/µl; P < 0.005) as compared with the untreated pIS-ER
-SNP levels (440 ± 9.01 light units/µl) (Fig. 6B
3'-UTR.
|
miR-206 Binding Sites Confer Luciferase Repression in Breast Cancer Cells
+ MCF-7 cells and ER
MDA-MB-231 cells. Quantitative real-time and end-point PCR analysis revealed that miR-206 levels were significantly higher (1.8-fold ± 0.41; P < 0.05) in MDA-MB-231 cells than in MCF-7 cells (Fig. 7A
1, pIS-ER
2, or pIS-ER
1-SNP construct (Fig. 7B
2 site displayed significantly greater repression in the MDA-231 cells vs. the MCF-7 cells (1.6-fold ± 0.34; P < 0.05). No change in activity was observed in the mutant construct (pIS-ER
15') when compared with pIS-0. To show that the decrease in reporter activity was due to a loss of luciferase mRNA, MCF-7 cells were transfected with ß-gal and various pIS-ER
1 constructs. RT-PCR was then employed with primers directed toward ß-gal and luciferase mRNA (Fig. 7C
1 or the pIS-ER
1-SNP constructs, which was subsequently rescued in cells treated with 40 nM antagomiR-206. It was observed that cells transfected with pIS-ER
1-SNP had the lowest levels of luciferase mRNA. The higher levels of miR-206 and its activity in the ER
MDA-231 cells, as compared with the ER
+ MCF-7 cells, raises the possibility that miR-206 could contribute to the loss of ER
expression in these cells.
|
-selective agonist), miR-206 levels dropped 4- to 5-fold within a 24-h period. Interestingly, the 10 nM diarylproprionitrile (DPN) (an ERß-selective agonist) treatment slightly enhanced miR-206 expression, whereas 1 nM progesterone had no effect. The luciferase assay was then used as a functional assay to confirm these results (Fig. 8B
1, pIS-ER
15', or pIS-ER
1-SNP luciferase constructs for 24 h with media containing 0, 0.1, or 1.0 nM E2. When the luciferase expression was normalized to ß-gal, all of the expression constructs had an enhanced luciferase activity with the increased concentrations of estrogen. However, when each construct was then compared with the relative pIS-0 values, both pIS-ER
1 and pIS-ER
1-SNP constructs had a higher expression of luciferase with increased doses of estrogen. The pIS-ER
15'-construct served as a negative control and was unresponsive to the estrogen treatments. These findings indicate that ER
-selective agonists decrease miR-206 levels and activity in MCF-7 cells.
|
| DISCUSSION |
|---|
|
|
|---|
because it was one of three miRNAs with enhanced expression in ER
vs. ER
+ breast cancer, and for which in silico analysis revealed two sites within the 3'-UTR of the ER
transcript (48). We demonstrate herein that miR-206 represses endogenous ER
expression in both human MCF-7 and T47D breast cancer cells. This regulation is specific to ER
, because overexpression of miR-206 has no effect on the levels of ERß, E-cadherin, or GAPDH. We also show that miR-206 regulates ER
mRNA through two specific miR-206 target sites harbored within the first 1200 bp of the 3'-UTR of the ER
transcript. These findings provide the first evidence of a specific miRNA that may contribute to the silencing of ER
in human breast cancer cells.
Recently, other receptors have been found to be regulated by miRNAs. These include the mammalian angiotensin II type I receptor, the Drosophila melanogaster DAF-16 insulin/IGF-1 receptor, and the two nuclear hormones receptors, nhr-23 and 25, in C. elegans (59, 60, 61). In addition to the regulation of receptors, miRNAs have been shown to regulate downstream effector proteins, including Sma- and Mad-related protein 3, Ras, and the coactivator protein, amplified in breast cancer 1 (AIB-1; also called steroid receptor coregulator 3) that interacts with ER
in the promotion of proliferation in breast cancer (44, 62, 63).
Previous functional studies on miR-206 have focused on its role in muscle differentiation, because tissue arrays have shown that miR-206 is highly abundant in skeletal and cardiac muscle across several species (64, 65). Induction of the C2C12 mesenchymal stem cell line to form myotubes involves the increase in myogenic transcription factors, MyoD and myogenin, which in turn, bind to the putative promoter region of the miR-206 gene and stimulate miR-206 expression (66). MiR-206 directly decreases the expression of several mRNAs, including the p180 subunit of DNA polymerase
(Pola1), while indirectly decreasing antimyogenic factors such as Id13 and MyoR (64). Our findings also raise the possibility that miR-206 could be involved in the clearing of nonmuscle ß/
-actin during muscle development because only
-actin is present within mature muscle. This hypothesis is supported by our observation that overexpression of miR-206 led to a dramatic decrease in ß-actin protein levels in MCF-7 levels, and that the TargetScan database found miR-206 sites in both ß- and
-actin.
When myogenesis was induced in the C2C12 cell line, other myogenic miRNAs, including miR-1 and miR-133, were also up-regulated (66, 67). It is worth noting that miR-1 has a sequence similar to miR-206 and is predicted to regulate some of the same target mRNAs. Although we did not examine miR-1 here because it was apparently not detected previously in breast tissue (48), miR-1 could potentially regulate ER
at the same sites as miR-206. It should be emphasized that we detected at least 65 putative miRNA target sites in the 3'-UTR of the ER
transcript. Thus, it is likely that multiple miRNAs regulate ER
expression in a combinatorial manner in different cell types. In support of this, our preliminary studies utilizing luciferase assays and antagomiRs, as previously described, indicate that the miRNA, let-7d, also directly regulates ER
mRNA (data not shown).
In seminal studies, the miRNAs, let-7 and lin-4, were shown to function as negative regulators of gene expression by mediating translation repression of the target mRNAs, lin-14 and lin-41, respectively (38, 40, 68, 69). Recently it has been shown that miRNA/mRNA hybridization can also mediate mRNA cleavage through the slicer activity of Ago2, a protein within the RNA-induced silencing complex (36, 70, 71). In our experiments miR-206 reduced the presence of both the ER
mRNA and protein, indicating that Ago2 could induce the cleavage of miR-206-ER
mRNA hybrids. An interesting observation was that the C/T SNP could potentially modulate miR-206 binding to the conserved target site within the ER
3'-UTR by shifting nucleotides 11/12 to 10/11 of the miRNA, selectively enhancing Ago2-induced slicing of the ER
message.
The abundance of miR-206 in skeletal muscle is well established, but the expression of miR-206 in other tissues is less studied. Human tissue screens failed to detect miR-206 in any female reproductive organs (64). In contrast, Iorio et al. (48) found in a panel of 29 differentially expressed miRNAs (normal vs. cancer) that miR-206 was the seventh most abundant in normal tissue and was further increased in breast cancer. These conflicting findings might be explained by the fact that miR-206 expression is under hormonal regulation, and thus miR-206 levels may vary according to a womans endocrine status. We observed that the ER
-agonists, E2 and PPT, strongly repressed miR-206 expression in MCF-7 cells, whereas the ERß-specific agonist, DPN, and progesterone had no effect on miR-206 expression. Thus, miR-206 expression in the normal breast tissue may vary depending upon the time at which the sample was obtained during the menstrual cycle, and whether the donor was taking oral contraceptives, pregnant, or was pre- or postmenopausal.
Given the role of miR-206 in myogenic differentiation (64), and its ability to target a nuclear hormone receptor, ER
, which is vital for proliferative signaling in breast tissue, one would place miR-206 into the category of a tumor suppressor. In fact, we observed a decrease in cell proliferation as well as an increase in cell death when cells were treated with the PS-206 construct compared with those transfected with the PS-negative construct (data not shown). Given the apparent antiproliferative action of miR-206, it is somewhat counterintuitive that miR-206 expression is elevated in more transformed breast cancers (48). However, the role of miR-206 during the progression of breast cancer may shift from one as a classic tumor suppressor to one that contributes to the tumorigenic process known as "oncogenic addiction" (72). By this mechanism, cells progress to a cancerous state by altering gene expression through selective mutations allowing for increased growth and metastasis. It is likely that breast cells acquire genetic and epigenetic alterations that lead to diminished ER
expression. Presumably, those cells that have also acquired oncogenic mutations will be able to continue growth in the presence of attenuated ER
signaling. These cells would also be expected to have increased levels of miR-206, which would further inhibit expression of any residual ER
mRNA. In the face of other up-regulated oncogenic signaling pathways, this would allow the cell to undergo a proliferative switch from a stage tightly controlled by estrogen-dependent growth to a more transformed estrogen-independent status.
The C/T SNP (rs9341070) identified within the conserved hER
1 site1 appears to be an evolutionary remnant, in that the T residue is found in rodents, but has changed to a C in primates. Our data indicate that this SNP is a functional variant, in that the T residue at this position allows miR-206 to target and down-regulate the hER
1 site more effectively. One might predict that this polymorphism would result in lower levels of ER
expression, and thus, inhibit the viability and progression of estrogen-dependent cancer cells. Clearly, many factors contribute to different rates of a disease among different ethnic groups. However, it is noteworthy to mention that Hispanics and Utah residents with ancestry from northern and western Europe have a higher incidence of the C/T SNP, and lower rates of breast cancer compared with the general population, as determined from the HapMap, SNP500Cancer, and SEER databases (73, 74, 75).
The hormonal regulation of miRNAs has been barely studied but clearly has major implications for normal development and other physiological processes. The insect hormone, ecdysone, increases miR-100, miR-125, and let-7, and decreases miR-34, during metamorphosis in Drosophila, and juvenile hormone opposed the effects of ecdysone in insect cells in vitro (76). Our findings revealed the existence of an apparent feedback loop between E2 and miR-206, with mutual repression between the two factors, which may contribute to the ability of estrogen-responsive tissues to alternate between mitotically quiescent and proliferative states. This loop is reminiscent of the mutually repressive interaction between the transcription factor, Yan, and miR-7 in Drosophila photoreceptors (77). In the absence of epidermal growth factor receptor signaling, Yan is expressed and represses miR-7 gene transcription in progenitor cells. Epidermal growth factor receptor signaling induces the rapid degradation of Yan, allowing another transcription factor, Pointed-P1, to compete for the miR-7 promoter and increase miR-7 expression. MiR-7 then binds to the 3'-UTR of Yan, to ensure stable down-regulation of Yan, which allows for photoreceptor differentiation. Another example of the mutual repression between a miRNA and a transcription factor involves the role of miR-223 in granulopoiesis (78).
The specific function of miR-206 in the normal breast tissue, if any, will require further study. MiR-206 could function in a mutually negative feedback loop to temporally regulate ER
expression and ductal/lobuloalveolar proliferation. Placental estrogen production is high during pregnancy and induces ductal growth and ductal branching within the breast (79). Estrogen-induced repression of miR-206 may facilitate ductal growth. In contrast, the abrupt loss of placental estrogens at parturition may allow miR-206 levels to rise sharply, thereby terminating growth and promoting a differentiated function (as it does in muscle). In the continued absence of estrogen during lactation, miR-206 may be one of several factors that inhibit ER
gene expression at the posttranscriptional level, leading to loss of both ER
mRNA and protein (79). Elevated miR-206 levels would also inhibit proliferation directly (e.g. Pola1 expression) and indirectly (e.g. ER
expression). Further characterization of the mechanism by which E2 regulates miR-206 expression, as well as in what endocrine states and in what tissues E2 regulates miR-206 in vivo, will undoubtedly allow for a more complete understanding of the role of miR-206 in mammary function and breast cancer.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Luciferase Constructs
Basic molecular biology-based reagents were obtained from Invitrogen and New England Biolabs (Ipswich, MA). Deoxyoligonucleotides synthesized by Integrated DNA Technology (Coralville, IA) spanned 60 nucleotide (nt) regions of the endogenous ER
3'-UTR sequence containing the putative miR-206 target sites. Each of the forward and reverse deoxyoligonucleotide paired inserts (see Table 1
) were annealed and treated with DNA T4 kinase. The pIS-0 luciferase reporter vector (53), a kind gift from Dr. D. Bartel (Massachusetts Institute of Technology, Cambridge, MA), was cut with SacI/NheI restriction endonucleases, treated with calf intestinal alkaline phosphatase and purified using the QIAquick PCR Purification Kit (QIAGEN,Valencia, CA). The deoxyoligonucleotide inserts, which contained partial SacI and NheI flanking regions (see Table 1
), were ligated into the pIS-0 vector and transformed into DH5
competent cells. Colonies were screened for presence of the insert via colony PCR and standard sequencing. DNA from positive colonies was purified using the QIAGEN Plasmid Midi Kit and titrated onto a 1% agarose gel to determine accurate concentrations of the constructs to be used in the luciferase assays.
|
constructs for 24 h. ß-Gal construct (200 ng), purchased from Promega, was used for normalization. The small synthetic RNAs were transfected using the methods mentioned above. Cells were then treated with trypsin, lysed in 100 µl of Reagent Lysis Buffer per well, and centrifuged at 14,000 rpm for 15 min. The supernatant was assayed for luciferase and ß-gal activity following Promegas protocol. Values were reported as relative light units normalized to ß-gal and standard errors are reported as ± SEM.
Quantitative RT-PCR (qRT-PCR) and Northern Blot Detection of miRNA
The mirVana RNA Isolation Kit, qRT-PCR Detection Kit, and hsa-miR-206/hsa-miR-5s primer sets were purchased though Ambion. This assay was used to monitor levels of mature miR-206 in various cell lines after various treatments mentioned above. Total RNA was isolated, diluted to a 100 ng/µl working dilution, and used in the reverse transcriptase (RT) reaction, using the protocol given by Ambion. In the real- time PCR assay, 0.5 µl of 50x Rox Reference Dye (Invitrogen) was added to the PCR mix as an internal reference, and all samples were run with a minus RT and normalized to 5s ribosomal control. The real-time PCR was performed in triplicates in three independent experiments with SEMs of the mean reported. Some of the samples were assayed by end-point PCR, using the same procedure, but run at 30 cycles and resolved on a 3% low-melt agarose gel.
Northern blots for miRNAs were performed as previously described (80); modifications are mentioned below. Total RNA (20 µg), isolated from MCF-7 cells via Trizol (Invitrogen), was denatured in an equal volume of deionized formamide at 65 C for 10 min and separated on a 15% denaturing urea-PAGE gel for 12 h. The gel was transferred to a nylon membrane (GE Healthcare Life Sciences, Piscataway, NJ) in 0.5x Tris-borate EDTA at 80 V for 1 h, and was UV cross-linked at 120 mJ. DNA for the miR-206 and 5s probes was obtained by isolating the 85-nucleotide (nt) band from an end-point PCR using the qRT-PCR Detection Kit mentioned above. The probe was labeled by a Random Primer DNA Labeling System from Invitrogen and incorporation of
-32P dCTP (3000 Ci/mmol) from PerkinElmer (Boston, MA). Fresh probe was purified over a G-25 microspin column (GE Healthcare Life Sciences) and incubated with the nylon membrane in hybridization buffer (50% formamide, 5x Denhardts solution, 5x sodium chloride sodium phosphate and EDTA (SSPE), 0.1% sodium dodecyl sulfate, and 0.01% ss Salmon Sperm DNA) at 35 C overnight. Consecutive washes were performed with 2x and 0.2x standard sodium citrate buffer, and blot was detected after 46 h exposures on x-ray film from Eastman Kodak Co. (Rochester, NY).
qRT-PCR Detection of mRNA
A standard SYBR Green real-time assay was performed to detect ER
and RPL-19 transcript levels after pre-miR-206 or antagomiR-206 treatments in the MCF-7 and GH3 cell lines. RNA was isolated as mentioned above and diluted to 100 ng/µl stock, and reverse transcribed using the Superscript III enzyme (Invitrogen). Real-time PCR was then performed on cDNA in an iQ SYBR Green Supermix by Bio-Rad Laboratories, Inc. (Hercules, CA) and with primers to either rat ER
(forward, 5'-CATCGATAAGAACCGGAGGA-3'; and reverse, 5'-AAGGTTGGCAG CTCTCATGT-3')]; rat RPL-19 (forward, 5'-CATGGAGCACATCCACAAAC-3'; and reverse, 5'-CCATAGCCTGG CCACTATGT-3'); human ER
(forward, 5'-GCAGGGAGAGGAGTTTGTGT-3'; and reverse, 5'-ATGTGGGAG AGGATGAGGAG-3'); or human RPL-19 (forward, 5'-TCGATGCCGGAAAAACAC-3'; and reverse, 5'-TGAA CACATTCCCCTTCACC-3'). Analysis of data was done using GraphPad Prism 4.0 software (from GraphPad Software, Inc., San Diego, CA) and Microsoft Excel. Experiments were performed in triplicate in three independent experiments. Errors are reported as ± SEM, whereas values are reported as relative fold change as compared with untreated sample.
miR-206 Overexpression Constructs
All the basic molecular biology reagents used to make the miR-206 overexpression construct were obtained from New England Biolabs and Invitrogen. The 86-bp pre-miR-206 sequence along with 38 bp of flanking sequence were found using the UCSC genome browser. Deoxyoligonucleotides were synthesized by Integrated DNA Technology to contain 91 nt from the 5'-end of both forward and reverse templates, which allowed for a 20-bp overlap in sequence at the 3'-end of each template. The sequences of the templates are as follow: forward template (5'-GCTAGCCTCCGGGTGGTACCCTGGGG CCAGCGAGGAGGCACTTGCCGAAACCACACACTTCCTTACATTCCATAGCAAAGTAATCCATATG-3') and the reverse template (5'-TATCGTTTCATTAGGTATACCCCTATATTTCTTCGTACACCGGAGCCCTTCGTCACAGTAGGTCTTCGTCGGGCGTAGAGTCTTCCTCGAG-3'). The deoxyoligonucleotides were mixed at a 1:1 ratio and heat annealed for 30 min. Addition of DNA polymerase I large (Klenow) fragment and dNTPs were used to fill in the 71-bp 5'-overhangs. The 162-bp product was gel purified and treated with Taq polymerase to facilitate cloning into the PCR 2.1 TOPO vector. Positive constructs were then digested with NheI/SacI restriction endonucleases and gel purified to obtain the pre-miR-206 insert. This insert was ligated into a modified pSilencer 4.1-CMV neo vector from Ambion, Inc., and positive clones were identified by PCR screens and sequencing. The miR-206 CMV-driven expression construct (PS-206) was used to determine ER
protein knockdown as described below.
miR-206 Expression Systems in MCF-7 Cells
The miR-206 CMV construct (PS-206) construct along with the PS-neg construct (purchased from Ambion, Inc.) were transfected into MCF-7 cells to knock down ER
expression. Cells were seeded into 100-mm dishes, grown to 90% confluency, transfected with 5, 10, or 20 µg of the constructs for 4872 h using Lipofectamine 2000, and monitored carefully for cell death. Cells were then lysed and analyzed for protein expression (see below). 2'-O-methyl antagomiRs 206, let-7a-1, and 16a, were provided by Dharmacon, and 50 nM amounts were transfected into MCF-7 cells as per normal protocol. Cells were lysed 48 h after transfection to determine ER
protein expression.
Western Blot Analysis
All reagents for Western blot analysis were supplied by Bio-Rad Laboratories, Invitrogen, and GE Healthcare Life Sciences. Protein lysates from MCF-7 and T47D cells treated with the miR-206 overexpression construct were prepared. Cells were washed with cold PBS, lysed in 500 µl RIPA buffer, sonicated, and centrifuged at 20,000 x g for 5 min at 4 C. A standard BCA assay was performed on the resultant supernatant, diluted to a working concentration of 1 µg/µl, and stored at 80 C. Protein (10 µg) was diluted 1:1 with Laemmli sample buffer and resolved on a 10% SDS-PAGE gel. The protein was transferred onto a nitrocellulose membrane, and Ponseau S stain was used to determine transfer efficiency. Blots were blocked in 5% milk in 0.1% Tris-buffered saline-Tween 20 for 0.5 h at room temperature. Probes to ER
(1:500) from Cell Signaling Technology (Danvers, MA), ERß (1:000) from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), GAPDH (1:1000) from Abcam Inc. (Cambridge, MA), E-cadherin (1:500) from Transduction Laboratories, Inc. (Lexington, KY), and ß-actin (1:500) from Abcam Inc. were incubated with the blot overnight at 4 C. Membranes were washed with 0.1% Tris-buffered saline-Tween 20 and incubated with either antimouse or antirat IgG horseradish peroxidase-conjugated secondary antibody, both obtained from Santa Cruz Biotechnology. Protein expression was assessed by enhanced chemiluminescence and exposure to chemiluminescent film from Eastman Kodak Co. Image J software from National Institutes of Health was used to quantify band intensities.
Estrogen Regulation of miR-206 Experiments
MCF-7 cells were cultured in phenol red-free DMEM/F12 media containing dextran-treated charcoal-stripped FBS from Hyclone Laboratories, Inc. (Logan, UT), for 48 h before any experiment. After 48 h, 1 nM E2, 10 nM DPN (ERß-agonist), 10 nM PPT (ER
-agonist), and 1 nM progesterone was added back to media for 24 h. All hormones were purchased from Tocris Bioscience (Ellisville, MO). Cells were lysed for total RNA by the Trizol protocol from Invitrogen, and qRT-PCR was performed, as described above, to measure miR-206 levels after the hormone treatments. Luciferase assays were performed as a functional assay for assessing miR-206 repression. MCF-7 cells were cultured in estrogen-free conditions 48 h before transfection to keep miR-206 levels high. Four hours after transfection of the luciferase constructs pIS-ER
1, pIS-ER
15', pIS-ER
1-SNP, and pIS-0 with Lipofectamine 2000, cells were cultured in media containing 0, 0.1, or 1 nM E2 for 24 h. Cells were then monitored for luciferase activity as mentioned earlier. All experiments were performed three times with SEM reported.
Statistical Analysis
Values reported in all analysis were expressed as the mean ± SEM. However, Western blot quantifications were noted only as averages. Differences between treatments and/or groups were analyzed using an unpaired Students t test. Statistical significance was accepted at P < 0.05.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Disclosure Summary: B.D.A., H.F., and B.A.W. have no conflicts of interest to declare.
First Published Online March 13, 2007
Abbreviations: Ago2, Argonaute2; CMV, cytomegalovirus; DPN, diarylproprionitrile; E2, 17ß-estradiol; ER, estrogen receptor; FBS, fetal bovine serum; ß-gal, ß-galactosidase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; miRNA, micro-RNA; nt, nucleotide; PPT, propyl pyrazole triol; qRT-PCR, quantitative RT-PCR; RT, reverse transcriptase; SNP, single nucleotide polymorphism; UTR, untranslated region.
Received for publication January 15, 2007. Accepted for publication February 15, 2007.
| REFERENCES |
|---|
|
|
|---|
and ß in reproductive tissues. Reproduction 125:143149[Abstract]
expression in breast cancer. Oncologist 11:18
hinge region regulates its transcriptional activity. Mol Endocrinol 19:26712684
expression. Mol Cell Biol 24:46054612
by DNA methyltransferase and histone deacetylase inhibition in human ER-
-negative breast cancer cells. Cancer Res 61:70257029
gene mediates rapid messenger ribonucleic acid turnover. Endocrinology 141:28052813
regulates human granulopoiesis. Cell 123:819831[CrossRef][Medline]
and ERß in primate mammary gland. J Clin Endocrinol Metab 90:435444NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
G. Song, Y. Zhang, and L. Wang MicroRNA-206 Targets notch3, Activates Apoptosis, and Inhibits Tumor Cell Migration and Focus Formation J. Biol. Chem., November 13, 2009; 284(46): 31921 - 31927. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Maillot, M. Lacroix-Triki, S. Pierredon, L. Gratadou, S. Schmidt, V. Benes, H. Roche, F. Dalenc, D. Auboeuf, S. Millevoi, et al. Widespread Estrogen-Dependent Repression of microRNAs Involved in Breast Tumor Cell Growth Cancer Res., November 1, 2009; 69(21): 8332 - 8340. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Saetrom, J. Biesinger, S. M. Li, D. Smith, L. F. Thomas, K. Majzoub, G. E. Rivas, J. Alluin, J. J. Rossi, T. G. Krontiris, et al. A Risk Variant in an miR-125b Binding Site in BMPR1B Is Associated with Breast Cancer Pathogenesis Cancer Res., September 15, 2009; 69(18): 7459 - 7465. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, R. Rathinam, A. Walch, and S. K. Alahari ST14 (Suppression of Tumorigenicity 14) Gene Is a Target for miR-27b, and the Inhibitory Effect of ST14 on Cell Growth Is Independent of miR-27b Regulation J. Biol. Chem., August 21, 2009; 284(34): 23094 - 23106. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sotiropoulou, G. Pampalakis, E. Lianidou, and Z. Mourelatos Emerging roles of microRNAs as molecular switches in the integrated circuit of the cancer cell RNA, August 1, 2009; 15(8): 1443 - 1461. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Adams, D. M. Cowee, and B. A. White The Role of miR-206 in the Epidermal Growth Factor (EGF) Induced Repression of Estrogen Receptor-{alpha} (ER{alpha}) Signaling and a Luminal Phenotype in MCF-7 Breast Cancer Cells Mol. Endocrinol., August 1, 2009; 23(8): 1215 - 1230. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bhat-Nakshatri, G. Wang, N. R. Collins, M. J. Thomson, T. R. Geistlinger, J. S. Carroll, M. Brown, S. Hammond, E. F. Srour, Y. Liu, et al. Estradiol-regulated microRNAs control estradiol response in breast cancer cells Nucleic Acids Res., August 1, 2009; 37(14): 4850 - 4861. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Pandey and D. Picard miR-22 Inhibits Estrogen Signaling by Directly Targeting the Estrogen Receptor {alpha} mRNA Mol. Cell. Biol., July 1, 2009; 29(13): 3783 - 3790. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Wickramasinghe, T. T. Manavalan, S. M. Dougherty, K. A. Riggs, Y. Li, and C. M. Klinge Estradiol downregulates miR-21 expression and increases miR-21 target gene expression in MCF-7 breast cancer cells Nucleic Acids Res., May 1, 2009; 37(8): 2584 - 2595. [Abstract] [Full Text] [PDF] |
||||
![]() |
S M Khoshnaw, A R Green, D G Powe, and I O Ellis MicroRNA involvement in the pathogenesis and management of breast cancer J. Clin. Pathol., May 1, 2009; 62(5): 422 - 428. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Adams, K. P. Claffey, and B. A. White Argonaute-2 Expression Is Regulated by Epidermal Growth Factor Receptor and Mitogen-Activated Protein Kinase Signaling and Correlates with a Transformed Phenotype in Breast Cancer Cells Endocrinology, January 1, 2009; 150(1): 14 - 23. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Toloubeydokhti, Qun Pan, Xiaoping Luo, O. Bukulmez, and N. Chegini The Expression and Ovarian Steroid Regulation of Endometrial Micro-RNAs Reproductive Sciences, December 1, 2008; 15(10): 993 - 1001. [Abstract] [PDF] |
||||
![]() |
K. M. Nelson and G. J. Weiss MicroRNAs and cancer: past, present, and potential future Mol. Cancer Ther., December 1, 2008; 7(12): 3655 - 3660. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Bearfoot, D. Y.H. Choong, K. L. Gorringe, and I. G. Campbell Genetic Analysis of Cancer-Implicated MicroRNA in Ovarian Cancer Clin. Cancer Res., November 15, 2008; 14(22): 7246 - 7250. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-J. Zhao, J. Lin, H. Yang, W. Kong, L. He, X. Ma, D. Coppola, and J. Q. Cheng MicroRNA-221/222 Negatively Regulates Estrogen Receptor{alpha} and Is Associated with Tamoxifen Resistance in Breast Cancer J. Biol. Chem., November 7, 2008; 283(45): 31079 - 31086. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Song and L. Wang Transcriptional mechanism for the paired miR-433 and miR-127 genes by nuclear receptors SHP and ERR{gamma} Nucleic Acids Res., October 1, 2008; 36(18): 5727 - 5735. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Nagaraja, C. Andreu-Vieyra, H. L. Franco, L. Ma, R. Chen, D. Y. Han, H. Zhu, J. E. Agno, P. H. Gunaratne, F. J. DeMayo, et al. Deletion of Dicer in Somatic Cells of the Female Reproductive Tract Causes Sterility Mol. Endocrinol., October 1, 2008; 22(10): 2336 - 2352. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kondo, T. Toyama, H. Sugiura, Y. Fujii, and H. Yamashita miR-206 Expression Is Down-regulated in Estrogen Receptor {alpha}-Positive Human Breast Cancer Cancer Res., July 1, 2008; 68(13): 5004 - 5008. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Kovalchuk, J. Filkowski, J. Meservy, Y. Ilnytskyy, V. P. Tryndyak, V. F. Chekhun, and I. P. Pogribny Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin Mol. Cancer Ther., July 1, 2008; 7(7): 2152 - 2159. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Miller and S. P. Duckles Vascular Actions of Estrogens: Functional Implications Pharmacol. Rev., June 1, 2008; 60(2): 210 - 241. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zhang MicroRNomics: a newly emerging approach for disease biology Physiol Genomics, April 1, 2008; 33(2): 139 - 147. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lopez-Tarruella and R. Schiff The Dynamics of Estrogen Receptor Status in Breast Cancer: Re-shaping the Paradigm Clin. Cancer Res., December 1, 2007; 13(23): 6921 - 6925. [Full Text] [PDF] |
||||
![]() |
Q. Pan, X. Luo, T. Toloubeydokhti, and N. Chegini The expression profile of micro-RNA in endometrium and endometriosis and the influence of ovarian steroids on their expression Mol. Hum. Reprod., November 1, 2007; 13(11): 797 - 806. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Greco and P. Rameshwar MicroRNAs regulate synthesis of the neurotransmitter substance P in human mesenchymal stem cell-derived neuronal cells PNAS, September 25, 2007; 104(39): 15484 - 15489. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |