help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2006-0523
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
21/6/1394    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reyes-Ibarra, A. P.
Right arrow Articles by Reyes-Cruz, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reyes-Ibarra, A. P.
Right arrow Articles by Reyes-Cruz, G.
Molecular Endocrinology 21 (6): 1394-1407
Copyright © 2007 by The Endocrine Society

Calcium-Sensing Receptor Endocytosis Links Extracellular Calcium Signaling to Parathyroid Hormone-Related Peptide Secretion via a Rab11a-Dependent and AMSH-Sensitive Mechanism

Alma P. Reyes-Ibarra, Alejandro García-Regalado, Iliana Ramírez-Rangel, Ana L. Esparza-Silva, Margarita Valadez-Sánchez, José Vázquez-Prado and Guadalupe Reyes-Cruz

Departments of Cell Biology (A.P.R.-I., A.G.-R., M.V.-S., G.R.-C.) and Pharmacology (I.R.-R., A.L.E.-S., J.V.-P.), Centro de Investigación y de Estudios Avanzados-Instituto Politécnico Nacional, 07000 México D.F., México

Address all correspondence and requests for reprints to: Guadalupe Reyes-Cruz, Ph.D., Centro de Investigación y de Estudios Avanzados-Instituto Politécnico Nacional, Cell Biology Department, Avenida Instituto Politécnico Nacional 2508, Col. San Pedro Zacatenco, 07360 México D.F., México. E-mail: guadaluper{at}cell.cinvestav.mx.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The calcium-sensing receptor (CaR) helps to maintain the homeostasis of extracellular calcium by controlling the secretion of hormones associated with this process. The mechanism of agonist-induced endocytosis and down-regulation of CaR and the influence of this event on the secretion of CaR-regulated hormones is not fully understood. In this study, we show that CaR is constitutively endocytosed and recycled to the plasma membrane by a Rab11a-dependent mechanism; during this process, the level of total cellular CaR is maintained. This trafficking of CaR promotes the secretion of PTH-related peptide (PTHrP), as evidenced by a decrease on PTHrP secretion in the presence of a dominant-negative mutant of Rab11a. Interestingly, this Rab11a dominant-negative mutant does not interfere with CaR-dependent activation of ERK 1/2, suggesting that ERK signaling is not sufficient to promote PTHrP secretion downstream of CaR. In addition, AMSH (associated molecule with the SH3 domain of STAM), a CaR carboxyl-terminal binding protein, redirects CaR from slow recycling to down-regulation, reducing CaR expression and decreasing PTHrP secretion. Our results indicate that endocytosis and trafficking of CaR modulate PTHrP secretion.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE CALCIUM-SENSING RECEPTOR (CaR) is a central regulator of extracellular calcium (Ca2+o) homeostasis by controlling the secretory properties of the parathyroid gland. CaR-modulated PTH secretion leads to a decrease in calcium excretion in kidney and its removal from bone by activated osteoclasts (1, 2). CaR gene mutations are frequently associated with inherited disorders involving calcium homeostasis (3, 4). CaR signaling is mediated by heterotrimeric G proteins, including Gq, Gi, and G12/13, promoting intracellular calcium mobilization, adenylyl cyclase inhibition, and Rho GTPase activation; CaR also transactivates epidermal growth factor receptor (EGFR) signaling and its downstream ERK cascade (3, 5, 6, 7, 8, 9). In addition, CaR mediates G protein-independent signals through interactions of its carboxyl-terminal tail with intracellular proteins, including filamin A and AMSH (associated molecule with the SH3 domain of STAM) to modulate the receptor desensitization and internalization rate (10, 11, 12, 13).

In addition to the parathyroid gland, CaR is expressed in diverse cellular settings in which it regulates PTHrP secretion (14). The mechanism by which CaR regulates the trafficking and secretion of PTH- or PTHrP-containing vesicles is not known but might involve the endocytosis and trafficking of CaR itself. Endocytosis and trafficking of G protein-coupled receptors (GPCRs) are considered late events of their desensitization (15, 16); however, GPCR internalization may promote MAPK cascade activation and release of secretory vesicles (17). In the latter case, an interplay between endocytic vesicles and secretory vesicles has been described. Trafficking of intracellular vesicles is coordinated by a variety of Rab GTPases. Rab11, one of the 40 known Rab GTPases, controls the transport of membrane receptors, including some GPCRs from early endosomes to perinuclear slow-recycling endosomes (18, 19, 20). The potential effect of CaR internalization, trafficking, and down-regulation on hormone secretion that is known to be regulated by this receptor has not been fully elucidated.

To investigate the role of CaR endocytosis in its ability to regulate PTHrP secretion, we studied the effect of mutant Rab GTPases and sorting proteins on CaR trafficking, stability, and ability to control PTHrP secretion. Our results indicate that CaR is constitutively endocytosed and recycled to the plasma membrane via a Rab11a-dependent mechanism that has a positive influence on PTHrP secretion but is not required for the activation of ERK. The protein level of CaR remains constant for up to 4 h of ligand-induced activation; nonetheless, CaR interaction with AMSH modifies the trafficking of this receptor by redirecting it to degradation. The functional impact of CaR degradation is reflected in a decrease of PTHrP secretion. Our studies suggest that CaR-regulated hormonal secretion is influenced by the vesicular trafficking of this receptor. In particular, PTHrP secretion requires CaR constitutive intracellular trafficking, and this process is attenuated by AMSH, a CaR-interacting protein that directs the receptor to degradation.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
CaR Endocytosis and Trafficking Occurs in Endosomes Containing Rab11a
Fluorescent staining with 7F8 anti-CaR in nonstimulated cells was consistent with the presence of CaR on the cell surface and some intracellular vesicles (Fig. 1AGo, CaR + vector, NS). Conversely, in calcium-stimulated cells, CaR was mainly detected in intracellular vesicles (Fig. 1AGo, CaR + vector, 5 and 30 min, respectively). To determine the identity of intracellular vesicles containing endocytosed CaR, we examined CaR localization in cells cotransfected with green fluorescent protein (GFP)-tagged Rab11a, a protein known to be associated to individual slow-recycling endosomes. CaR was observed in Rab11a-positive endosomes after 30 min of stimulation with Ca2+o (Fig. 1BGo); this localization of CaR in pericentriolar recycling endosomes was reduced in cells expressing GFP-tagged dominant-negative Rab11aS25N mutant (Fig. 1CGo). Rab4-positive endosomes, known to be involved in rapid recycling, did not contain CaR (data not shown), indicating that CaR follows a slow-recycling pathway.


Figure 1
View larger version (48K):
[in this window]
[in a new window]

  		Fig. 1. Effect of Ca2+o Calcium and Rab11 on Subcellular Localization of CaR in Transfected HEK-293 Cells

A, Confocal images show the distribution of CaR in nonstimulated cells (NS) or at selected times after stimulation with 4 mM Ca2+o. B and C, The effect of Rab11 on CaR distribution was assessed in cells transiently transfected with CaR and either wild-type GFP-tagged Rab11a (B) or dominant-negative GFP-tagged Rab11aS25N mutant (C) and stimulated with 4 mM Ca2+o for 30 min. CaR distribution in NS is consistent with its presence on the cell surface and in some intracellular vesicles. Stimulation with Ca2+o for 5 or 30 min (A, 5' and 30') promoted CaR internalization, which was detected in aggregates inside the cell. Dominant-negative Rab11 mutant prevented CaR accumulation in intracellular aggregates. CaR was immunostained with anti-CaR 7F8 monoclonal antibody, and Rab11 was detected by the fluorescence of GFP. Scale bars, 8 µm.

 
We next studied the mechanism of CaR internalization by means of a biotin protection assay. In this method, biotinylated cells are stimulated for the indicated time, and this is followed by stripping the biotin that is covalently bound to membrane proteins with a membrane-impermeant reducing agent, thus allowing detection of internalized proteins (Fig. 2AGo). The fraction of internalized CaR was detected by immunoprecipitation, followed by streptavidin-peroxidase blot, whereas the total amount of CaR was detected by Western blot with antibodies recognizing the extracellular domain of the receptor. This approach showed a significant constitutive internalization of CaR in the absence of agonist (Fig. 2Go, B and C, NS). Interestingly, 4 mM Ca2+o for 1 h induced CaR recycling to the plasma membrane. CaR was internalized at 2 h and recycled to the membrane after 4 h of stimulation, as indicated by the removal of the covalently bound biotin from the receptor (Fig. 2Go, B and C). We then used the biotin protection assay to assess the role of Rab GTPases on CaR trafficking. We determined whether Rab4 GTPase (associated with rapid vesicle recycling) or Rab11 GTPases (associated with slow vesicle recycling) regulates CaR trafficking in human embryonic kidney 293 (HEK-293) cells transiently transfected with CaR and dominant-negative Rab4 or Rab11a mutants. The results demonstrated that GFP-tagged dominant-negative Rab11aS25N mutant interfered with CaR trafficking (Fig. 3Go). In contrast, CaR endocytosis was not impaired in cells expressing GFP-tagged dominant-negative Rab4S22N mutant (data not shown). These results indicate that CaR trafficking occurs through Rab11a endosomes.


Figure 2
View larger version (16K):
[in this window]
[in a new window]

  		Fig. 2. Constitutive Trafficking of CaR Is Further Promoted by Ca2+o

A, Biotin protection assay was used to assess CaR internalization in CaR-transfected HEK-293 cells; the assay detects only internalized receptors that remain biotinylated after treating the cells with a membrane-impermeant reducing agent. B, Effect of Ca2+o on the endocytosis of biotinylated CaR. Biotinylated cells were incubated in calcium-free media for 40 min and then stimulated with 4 mM Ca2+o as indicated. CaR was immunoprecipitated and revealed with streptavidin peroxidase (top) or by Western blot (bottom). A representative blot is presented, 100% refers to maximum amount of surface biotinylated receptor, Stripped (St) corresponds to the control, indicating the efficiency of the membrane-impermeant stripping agent (in this case, biotin was removed from cells incubated on ice to avoid receptor internalization), and NS (nonstimulated) corresponds to CaR internalized in the absence of agonist. C, Bars represent mean densitometric values of biotinylated CaR from six independent experiments, such as that shown in B, normalized to that of 100% surface biotinylated CaR; error bars represent the SEM of six independent experiments. *, P < 0.05 vs. stripped; **, P < 0.01 vs. stripped.

 

Figure 3
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 3. Rab11a Modulates CaR Intracellular Trafficking

A, The effect of dominant-negative Rab11aS25N mutant on the internalization of CaR was evaluated in biotinylated HEK-293 cells as described in Fig. 2Go. Cells were transiently transfected with CaR or CaR and GFP-Rab11aS25N. Two days after transfection, cells were biotinylated and stimulated with Ca2+o as indicated. CaR was immunoprecipitated (IP) and revealed with streptavidin peroxidase (top) or by Western blot (WB) using the anti-CaR monoclonal antibody ADD (middle). GFP-Rab11aS25N was detected with anti-GFP antibody in total cell lysates. A representative blot is presented, 100% refers to the maximum amount of surface biotinylated receptor, Stripped (St) corresponds to the control indicating the efficiency of the membrane-impermeant stripping agent (in this case, biotin was removed from cells incubated on ice to avoid receptor internalization), and NS (nonstimulated) corresponds to CaR internalized in the absence of agonist. B, Bars represent mean densitometric values of biotinylated CaR from at least two independent experiments; error bars represent the SEM. Equivalent conditions between groups were compared. *, P <0.01.

 
Effect of Chronic Stimulation with Ca2+o and G Protein-Coupled Receptor-Associated Sorting Protein (GASP) on CaR Stability
Long-term activation of GPCRs frequently results in receptor down-regulation. To determine the effect of Ca2+o on CaR stability at protein level, CaR-transfected HEK-293 cells were stimulated with 4 mM Ca2+o for up to 4 h, followed by CaR detection by Western blotting. Our results showed that CaR protein levels remained constant during this time (Fig. 4Go, A and B), suggesting a possible equilibrium between receptor synthesis and degradation. Under reducing conditions, the ADD antibody recognizing an epitope in the extracellular domain of CaR detected two major bands of approximately 150 and 130 kDa (Fig. 4AGo). Previous studies have shown that the approximately 150 kDa band represents mature receptors modified with N-linked complex carbohydrates, whereas the approximately 130 kDa band represents immature receptors still in the process of posttranslational addition of carbohydrates (21, 22, 23). Because the Western blot detecting CaR did not distinguish between newly synthesized receptors, receptors at the plasma membrane, and receptors in trafficking, we decided to study the effect of Ca2+o on the stability of receptors resident at the plasma membrane. For these experiments, plasma membrane proteins were labeled with a nonhydrolysable analog of biotin, followed by immunoprecipitation of the biotinylated receptors with anti-CaR 7F8 antibody from nonstimulated or calcium-stimulated cells and detection by streptavidin-peroxidase blotting. In these experiments, no proteolysis of biotinylated CaR was observed even after 4 h of stimulation (Fig. 5Go, A, top, and B). Because the intracellular pathway followed by endocytosed receptors can be modified by receptor-interacting proteins (24), we further examined the potential influence of GASP in the stability of CaR. GASP is a GPCR sorting protein involved in the preferential lysosomal sorting of {delta}-opioid and D2 dopamine receptors (25, 26, 27). In these experiments, HEK-293 cells transfected with CaR and GASP were labeled with biotin and left in medium containing 0.5 mM Ca2+o or stimulated with 4 mM Ca2+o for 4 h. The results revealed that the amount of biotinylated CaR immunoprecipitated from GASP-expressing cells remained constant regardless of the chronic presence of Ca2+o (Fig. 5Go, C and D).


Figure 4
View larger version (23K):
[in this window]
[in a new window]

  		Fig. 4. Effect of Ca2+o on CaR Protein Stability in Transfected HEK-293 Cells

A, CaR-transfected cells were incubated in calcium-free media for 40 min, followed by stimulation with either low (0.5 mM) or high (4 mM) Ca2+o for the indicated time period or incubation in calcium-free media (NS, nonstimulated) or PI buffer. CaR expression was detected by Western blot (WB) in total cell lysates, fractionated on 8% SDS-PAGE under reducing conditions (20 µg protein per lane) with the anti-CaR monoclonal antibody ADD. A representative blot is presented. B, Bars represent densitometric values of the blots from three independent experiments plotted as the mean of both 130 and 150 kDa bands. Error bars represent the SEM of three independent experiments. P > 0.05.

 

Figure 5
View larger version (18K):
[in this window]
[in a new window]

  		Fig. 5. CaR Protein Levels Remain Constant during Receptor Trafficking

The effect of Ca2+o on the stability of CaR biotinylated at the plasma membrane was analyzed in HEK-293 cells. In this assay, CaR remains biotinylated unless it is degraded (in contrast to the experiments shown in Figs. 2Go and 3Go, in which a reducing agent was used to recognize only internalized receptors). A, CaR-transfected cells were biotinylated and incubated with 4 mM Ca2+o for the indicated time period or left in calcium-free media (NS, nonstimulated; NT, nontransfected; 100% represents the entire amount of biotinylated CaR). CaR was immunoprecipitated (IP) and detected with streptavidin peroxidase (top) or the anti-CaR 7F8 monoclonal antibody (bottom). WB, Western blot. B, Bars represent mean densitometric values of biotinylated CaR from three independent experiments, and error bars represent SEM. C, Effect of chronic stimulation with Ca2+o and GASP on the stability of CaR biotinylated at the cell surface. HEK-293 cells expressing human CaR in either the presence or absence of GASP were biotinylated and treated with 4 mM Ca2+o as indicated. Immunoprecipitated CaR was detected with streptavidin peroxidase (top) and Western blot (bottom). D, Bars represent the results of densitometric scanning of streptavidin overlays from at least two independent experiments. NS, Nonstimulated cells; NT, nontransfected cells.

 
CaR Endocytosis Links Ca2+o Signaling with PTHrP Secretion via a Rab11a-Dependent and AMSH-Sensitive Pathway
We recently identified AMSH as a novel CaR-interacting protein able to regulate the initial steps of the CaR-elicited signal transduction cascade (10). The possible influence of AMSH on CaR stability and the potential effect of this interaction on PTHrP secretion were evaluated in CaR- and AMSH-1-transfected HEK-293 cells. As shown in Fig. 6Go, CaR expression analyzed by Western blot was reduced in nonstimulated AMSH-transfected cells (Fig. 6Go, NS). An additional decrease in CaR expression occurred when the receptor was activated with 4 mM Ca2+o for 30–60 min (Fig. 6Go, A and B).


Figure 6
View larger version (27K):
[in this window]
[in a new window]

  		Fig. 6. AMSH Promotes CaR Down-Regulation

A, HEK-293 cells transiently transfected with either CaR or CaR and Myc-tagged AMSH-1 were incubated in calcium-free media for 40 min, followed by stimulation with 4 mM Ca2+o as indicated or left in calcium-free media (NS, nonstimulated). CaR expression was detected by immunoblot with the anti-CaR monoclonal antibody ADD in total cell lysates fractionated in 8% SDS-PAGE under reducing conditions (20 µg protein per lane). AMSH was detected with anti-Myc antibody, and anti-actin immunoblot served as a loading control. A representative blot is presented. B, Bars represent mean of densitometric values of the 150 kDa protein band from six independent experiments, and error bars represent SEM. Equivalent conditions between groups were compared. *, P < 0.01; **, P <0.05.

 
We predicted that CaR recycling is involved in PTHrP secretion. To assess this possibility, we evaluated CaR-dependent PTHrP secretion in HEK-293 cells transfected with CaR and either a dominant-negative Rab11aS25N mutant, found to be able to prevent CaR recycling, or a constitutively active Rab11aQ70L mutant. As shown in Fig. 7AGo, CaR promoted PTHrP secretion in HEK-293 cells in a time- and Ca2+o-dependent manner, consistent with previously reported results (28, 29). The ability of CaR to promote PTHrP secretion was prevented by the dominant-negative Rab11aS25N mutant and was slightly increased in constitutively active Rab11aQ70L mutant-expressing cells (Fig. 7AGo).


Figure 7
View larger version (22K):
[in this window]
[in a new window]

  		Fig. 7. CaR Trafficking Promotes PTHrP Secretion via a Rab11a-Dependent and AMSH-Sensitive Mechanism

A, PTHrP secretion was assayed at the indicated times in HEK-293 cells transiently transfected with CaR and either dominant-negative GFP-Rab11aS25N or constitutively active GFP-Rab11aQ70L. Two days after transfection, cells were incubated in calcium-free media for 40 min, followed by stimulation with 4 mM Ca2+o as indicated (NS, nonstimulated cells). Data represent mean ± SEM value (n = 3). *, P < 0.05 vs. GFP-Rab11a S25N at 4 and 6 h, respectively. B, PTHrP secretion was assayed at the indicated times in HEK-293 cells transiently transfected with CaR and either Myc-tagged AMSH-1 or Myc-tagged AMSH-1 and a specific shRNA to knockdown AMSH-1. Two days after transfection, cells were incubated in calcium-free media for 40 min, followed by stimulation with 4 mM Ca2+o as indicated. NS, Nonstimulated cells. Data represent mean ± SEM values (n = 3). *, P < 0.001 vs. CaR + vector at 4 and 6 h, respectively; **, P < 0.001 vs. CaR + AMSH. Inset shows AMSH-1 expression detected by Western blot, and the effect of AMSH-1-shRNA is shown in lanes 3 and 4.

 
Because AMSH-1 attenuated CaR expression, we next explored the functional consequences of this event on the ability of CaR to promote PTHrP secretion. We therefore examined the effect of AMSH-1 on the secretion of PTHrP on CaR stimulation. The ability of CaR to promote the PTHrP secretion was prevented by AMSH-1, and this effect was reversed with an AMSH-specific short hairpin RNA (shRNA) that knocked down AMSH expression (Fig. 7BGo).

To examine whether CaR trafficking, modulated by Rab 11a, affects the ability of this receptor to promote ERK 1/2 activation, we assessed Ca2+o-induced ERK 1/2 activation in HEK-293 cells transfected with CaR and the dominant-negative Rab11aS25N mutant, found able to prevent CaR recycling and PTHrP secretion. As shown in Fig. 8Go, the ability of CaR to activate ERK in a time- and Ca2+o-dependent manner consistent with previously reported results (5, 28, 29) was augmented in Rab11aS25N-expressing cells.


Figure 8
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 8. Effect of Dominant-Negative Rab11aS25N on CaR-Stimulated ERK 1/2 Phosphorylation

A, HEK-293 cells transiently transfected with CaR, CaR, and Rab11aS25N or Rab11aS25N were incubated overnight in serum-free media supplemented with 0.5 mM calcium; the following day, cells were stimulated with 4 mM Ca 2+o or EGF (10 ng/ml) as indicated. ERK activation was detected by Western blot using anti phospho-ERK 1/2 in total cell lysates fractionated in a 10% SDS-PAGE under reducing conditions (20 µg of protein per lane). A representative blot is presented. Middle and bottom show expression of total ERK1/2 and enhanced GFP-Rab11a-S25N, respectively. B, Bars represent mean ± SEM values of densitometric scanning of phospho-ERK immunoblots from three independent experiments normalized to the maximal effect, which was obtained with EGF. Equivalent conditions between groups were compared. *, P < 0.001.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
CaR is endogenously expressed in parathyroid gland, kidney, bone, and intestine, in which it maintains Ca2+o homeostasis by controlling PTH secretion, calcium excretion in kidney, or its removal from bone, thus sustaining constant interplay among these organs that results in tight control of Ca2+o concentration (2, 30). A wide variety of organs not involved in calcium homeostasis also express CaR. In different settings, CaR has been implicated in cell proliferation, differentiation, and control of PTHrP secretion (5, 14). Thus, CaR signaling is associated with hormonal secretion via mechanisms not yet fully elucidated. We hypothesized that endocytosis and intracellular sorting of CaR via the intervention of Rab GTPase and CaR-interacting protein intervention have an effect on CaR stability and on its ability to control PTHrP secretion. In the present work, we show that CaR trafficking occurs via a Rab11a-dependent mechanism critical for PTHrP secretion, as evidenced by the effect of a dominant-negative Rab11a mutant that blocked this event. In addition, the presence of AMSH, a CaR-interacting protein, reduces CaR expression by redirecting it from slow recycling to down-regulation, resulting in a decrease in PTHrP secretion. These results indicate that intracellular trafficking of CaR links CaR signaling with PTHrP secretion.

CaR endocytosis is essential in the transactivation of EGFR that leads to the ERK 1/2 signaling cascade (31). ERK1/2 pathway activation requires direct interaction of the CaR carboxyl terminus with signaling proteins that act by modulating receptor internalization and stability. A recent study shows that filamin binds to CaR and decreases its degradation rate (11) and may also contribute to locate CaR to caveolae (32, 33). Because caveolae are normally immobile plasma membrane domains not involved in constitutive endocytosis (34), other CaR binding proteins might promote CaR constitutive internalization. Here, we show that Rab11a comprises a critical component of the molecular assembly controlling CaR intracellular trafficking. Interestingly, although dominant-negative Rab11 mutant attenuates CaR trafficking and PTHrP secretion, it does not prevent Ca2+o-induced ERK 1/2 activation in CaR-transfected cells, suggesting that ERK signaling is not sufficient to promote PTHrP secretion downstream of CaR. These results raise interesting possibilities regarding the mechanisms by which CaR-transactivated EGFR leads to PTHrP secretion, because it has been reported that EGFR inhibitors possess a stronger inhibiting effect on CaR-induced PTHrP secretion than the effect of PD98059 (2'-amino-3'-methoxyflavone), an MAPK kinase inhibitor that prevents ERK signaling (35). Therefore, the different signal transduction pathways activated by CaR through transactivating the EGFR or EGFR-independent CaR signaling pathways might contribute to PTHrP secretion. Rab11 is a governing factor for both constitutive and agonist-dependent internalization of other GPCRs, including thromboxane A2 (36, 37) and ß-2 adrenergic receptors (38). Constitutive endocytosis of metabotropic glutamate receptor subunit 1a, a representative member of GPCR, family 3, in which CaR is classified, occurs associated with ß-arrestin 2 via clathrin-coated vesicles (39, 40). Interestingly, GPCR kinases and ß-arrestins 2 play key roles in regulating CaR responsiveness in parathyroid gland (12).

A common event in GPCR signaling is receptor down-regulation on chronic stimulation. Interestingly, CaR protein levels did not change regardless of the constant presence of Ca2+o, suggesting a possible equilibrium between receptor synthesis and degradation or a stable association of the receptor at the plasma membrane that protects this from down-regulating mechanisms commonly associated with GPCR internalization. These possibilities were assessed in experiments using biotinylated cells with either reducing agent-sensitive biotin that remains bound to receptors if these are internalized or with noncleavable biotin to assess the fate of internalized receptors. Our results indicate that CaR is subject to constant intracellular trafficking. Our data also indicate that CaR is not degraded after ligand-induced activation. Contrary to our findings, it has been reported that m-calpain participates in CaR degradation in caveolae (41). We evaluated whether intracellular sorting is critical for CaR degradation. We first evaluated the effect of GASP, a well-characterized GPCR sorting protein critical for {delta}-opioid and D2 dopamine receptor degradation (26, 27). GASP shows affinity for a broad variety of GPCRs, including members of the metabotropic glutamate receptor family in which CaR is included (42). Our results indicate that GASP does not promote CaR degradation, suggesting that additional proteins are required to promote CaR down-regulation. In this regard, AMSH, a CaR carboxyl-terminal interacting protein, was able to promote CaR degradation. Interestingly, CaR ubiquitination and degradation are linked with the activity of E3 ubiquitin ligases such as dorfin (43), which might link CaR intracellular sorting with degradation, affecting its role as a controller of hormonal secretion. Together, these findings suggest that AMSH redefines the sorting of endocytosed CaR from slow recycling to degradative pathways, perhaps through an interaction with the multiprotein complex formed by AMSH and RNF11 (ring finger protein 11)-Smurf2 (SMAD-specific E3 ubiquitin protein ligase 2) (44) that may lead CaR to degradation.

Finally, our results showing the effect of the dominant-negative Rab11a mutant that attenuated CaR-dependent PTHrP secretion and the role of AMSH decreasing PTHrP secretion suggest that CaR modulates PTHrP secretion by a mechanism described in the model illustrated in Fig. 9Go. Accordingly, CaR is constitutively subjected to intracellular trafficking via Rab11a-dependent endosomes, which stimulate PTHrP secretion by transmitting a signal that promotes the trafficking of secretory vesicles releasing PTHrP outside the cell (45, 46, 47). This process is further regulated by AMSH, which redirects CaR to degradative pathways. This model, based on results obtained in transfected HEK-293 (which are frequently used as a working model for studies oriented toward defining the molecular basis of CaR signaling because these do not express endogenous CaR) sets forth a working hypothesis to be assessed in cells endogenously expressing this receptor for further defining the physiologic consequences of the findings described herein.


Figure 9
View larger version (19K):
[in this window]
[in a new window]

  		Fig. 9. Model Depicting CaR Trafficking and the Impact of this Event on Ca2+o-Dependent PTHrP Secretion

CaR is constitutively endocytosed via Rab11a-dependent endosomes, which in transit transmit a signal that promotes PTHrP secretion. CaR trafficking is further regulated by AMSH, which redirects the receptor to degradation.

 
In conclusion, our results support a role for CaR endocytosis and recycling via Rab11a-dependent endosomes as a critical step in signal transmission to promote PTHrP secretion. This process is interfered by AMSH, a CaR-interacting protein that redirects CaR from recycling to degradation pathways, thus attenuating its ability to control PTHrP secretion.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
DNA Constructs and Antibodies
Wild-type human CaR cDNA was kindly provided by Dr. Allen Spiegel (National Institute of Diabetes and Digestive and Kidney Diseases/National Institutes of Health, Bethesda, MD). GASP cDNA and full-length human AMSH-1 were obtained from Dr. Mark von Zastrow (University of California, San Francisco, San Francisco, CA) and Dr. Itoh Susumu (Tohoku University of Medicine, Sendai, Japan), respectively. Rab11 and Rab4 constructs were donated by Dr. Tamas Balla (National Institute of Child Health and Human Development/National Institutes of Health, Bethesda, MD). Anti-CaR ADD antibody raised against a synthetic peptide corresponding to residues 214–235 of human CaR and anti-CaR 7F8 monoclonal antibody were donated by Dr. Allen Spiegel (48). shRNA for AMSH-1, which targets the AMSH-1 sequence reported previously (49), was generated based on the following hairpin sequence, TGCTGTTGACAGTGAGCGCGTTACAAATCTGCTGTCATTTTTTAGTGAAGCCACAGATGTAAAATGACAGCAGATTTGTAATTCATGCCTACTGCCTCGGA, and cloned into the pSM2 vector (http://codex.cshl.org/scripts/newdisplayhairpin.cgi?row=4&query_id=24529_no_one_0_0_0_0klokos.cshl.edu).

Cell Culture
HEK-293 cells were routinely cultured in DMEM (Sigma, St. Louis, MO) supplemented with 10% fetal bovine serum, 1% glutamine, penicillin, and streptomycin at 37 C in a 5% CO2 atmosphere.

Transient Transfections
HEK-293 cells were transfected with 4 µg plasmid DNA diluted in DMEM (Sigma) using Lipofectamine reagent according to the instructions of the manufacturer (Invitrogen, Carlsbad, CA). The mixture was incubated at room temperature for 30 min. The DNA-Lipofectamine complex was further diluted in 6 ml of serum-free DMEM and was added to 80% confluent cells plated in 100-mm Petri dishes. After 5 h of incubation, 10 ml DMEM containing 10% fetal bovine serum was added. Twenty-four hours after transfection, cells were split into 60-mm Petri dishes, cultured in completed DMEM, and cultured for another 24 h.

Immunoblot Analysis
Confluent cells in 60-mm plates were placed on ice, rinsed with ice-cold PBS, and scraped with buffer B [20 mM Tris-HCl (pH 7.5), 1 mM EDTA, 150 mM NaCl, 1% Triton X-100, 1 mM sodium vanadate, 1 mM NaF, 10 mM ß-glycerophosphate, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, and 10 µg/ml aprotinin]. The extracts were forced through a 22-gauge needle five to eight times and centrifuged for 15 min at 14,000 rpm at 4 C. The protein concentration was determined by the bicinchoninic acid BCA Protein Assay (Pierce, Rockford, IL), and approximately 30 µg of each sample was separated on 6 or 7.5% SDS-PAGE for CaR or AMSH blots, respectively, and electrotransferred to nitrocellulose membranes. CaR was detected with 0.1 µg/ml ADD anti-CaR antibody, and Myc-tagged AMSH was detected with anti-Myc antibody (MMS-150R; Covance, Berkeley, CA). ERK 1/2 activation was detected by Western blot using a rabbit polyclonal anti-phospho-ERK 1/2 antibody (9101L; Cell Signaling Technology, Beverly, MA), and expression of endogenous ERK 1/2 or enhanced GFP-tagged transfected proteins were detected with a rabbit polyclonal anti-ERK antibody (SC-154; Santa Cruz Biotechnology, Santa Cruz, CA) or a mouse monoclonal anti-GFP antibody (MMS-118R; Covance), respectively. Subsequently, membranes were incubated with horseradish peroxidase-conjugated secondary antibody (GE Healthcare Biosciences, Piscataway, NJ) and revealed with West Pico system (Pierce).

Biochemical Assay of CaR Internalization Using Cleavable Biotin: Biotin Protection
CaR endocytosis was analyzed as described previously (50, 51). Briefly, transfected cells grown on fibronectin-precoated 60-mm plates (20 µg/ml; Calbiochem, La Jolla, CA) were washed with PBS and treated for 30 min at 4 C with 30 µg/ml disulfide-cleavable biotin [sulfo-NHS-SS-(dithio)-biotin; Pierce] in PBS. To remove free biotin, cells were washed with Tris-buffered saline (TBS) and incubated for 15 min at 37 C in prewarmed calcium-free DMEM containing 0.1% fetal bovine serum. Before stimulation, cells were washed with TBS and incubated for 1 h at 37 C in PI buffer [120 mM NaCl, 5 mM KCl, 5.6 mM glucose, 0.4 mM MgCl2, 20 mM LiCl, and 4 mM NaOH in 25 mM 1,4-piperazinediethanesulfonic acid buffer (pH 7.2)]. Cells were stimulated with 4 mM Ca2+o in PI buffer for different time periods. To remove CaR-bound biotin that remained at the plasma membrane, cells were washed with TBS and incubated with glutathione reducing buffer (50 mM glutathione, 75 mM NaCl, 75 mM NaOH, and 1% fetal bovine serum) for 20 min at 4 C. Unreacted glutathione was quenched using iodoacetamide buffer (50 mM iodoacetamide and 1% BSA in PBS); then cells were washed with TBS and lysed in cold buffer B. To assess 100% receptor labeling, control plates (not incubated in reducing buffer) were treated in parallel, and, to assess the effectiveness of the reducing agent for removing the biotin covalently bound to CaR, a plate designated as stripped remained at 4 C throughout the experiment. CaR was immunoprecipitated with anti-CaR 7F8 monoclonal antibody and protein A/G agarose (Santa Cruz Biotechnology). Samples were denatured in SDS sample buffer under nonreducing conditions, resolved by 6% SDS-PAGE, and transferred to nitrocellulose. Biotinylated CaR was visualized using Vectastain ABC immunoperoxidase reagent (Vector Laboratories, Burlingame, CA) and the West Pico system (Pierce).

Biochemical Assay of CaR Degradation Using Noncleavable Biotin
Degradation of surface-biotinylated CaR was analyzed as described previously (50, 52). Briefly, transfected cells grown on fibronectin-precoated 60-mm plates were biotinylated with 100 µg/ml noncleavable sulfo-NHS-biotin (Pierce) for 30 min at 4 C in PBS. Unreacted biotin was quenched and removed by three successive washes with TBS. The plate labeled as 100% was chilled on ice to stop additional membrane trafficking. The plates for Ca2+o stimulation were incubated with PI buffer for 1 h. Nonstimulated cells were then placed on ice. Cells were stimulated with 4 mM Ca2+o in PI buffer for different periods of time. Cells were lysed in cold buffer B, and CaR was immunoprecipitated with 7F8 monoclonal antibody. Immunoprecipitated CaR was denatured in SDS sample buffer under nonreducing conditions, resolved by 6% SDS-PAGE, and transferred to nitrocellulose. Biotinylated CaR was visualized using Vectastain ABC immunoperoxidase reagent (Vector Laboratories). For a set of experiments in which GASP was transfected, the Vectastain ABC immunoperoxidase reagent was diluted at a ratio of at least 1:2 to detect small differences in receptor degradation. CaR degradation was detected by a decrease of biotinylated CaR in the immunoprecipitates.

Immunofluorescence
HEK-293 cells grown on fibronectin-precoated coverslips were transfected with either CaR or CaR and GFP-tagged Rab proteins (800 ng total DNA). After 48 h, cells were washed with PBS and fixed with paraformaldehyde (4%) in PBS for 20 min; then coverslips were permeabilized with methanol (100%) and washed with PBS. Fixed and permeabilized cells were incubated with anti-CaR 7F8 monoclonal antibody for 1 h at 37 C, followed by incubation with a secondary rhodamine-conjugated antimouse IgG antibody (Jackson ImmunoResearch, West Grove, PA) for 45 min at room temperature. After washing, cells were mounted on glass slides using ProLong Antifade (Invitrogen). Images were acquired with a Leica (Nussloch, Germany) DMIRE2 confocal laser microscope.

PTHrP Secretion Immunoassay
To detect secreted PTHrP 1–34, HEK-293 cells in 10-cm dishes were transiently transfected with the indicated cDNAs or shRNA and were distributed the following day into 6-cm dishes. After 24 h, media was replaced with Ca2+-free DMEM supplemented with 0.5 mM CaCl2 and incubated for 16 h at 37 C, followed by stimulation with 4 mM Ca2+o for 4 or 6 h. The medium was recovered and centrifuged for 5 min at 13,000 rpm, and PTHrP was measured by the use of competitive enzyme immunoassay according to the instructions of the manufacturer (Peninsula Laboratories, Belmont, CA).

Statistics
Statistical analyses were performed by one-way ANOVA when appropriate. P < 0.05 was considered significant using GraphPad Prism version 2.0 software (GraphPad Software, San Diego, CA).


   ACKNOWLEDGMENTS
 
We thank Drs. Brent Miller and Alicia Santiago for critical reading of this manuscript and Estanislao Escobar-Islas, Adrian Trejo-Carmona, Oscar Casas-Mejía, and Omar Hernández-García for technical assistance.


   FOOTNOTES
 
This work was supported by Consejo Nacional de Ciencia y Technología (CONACyT) México Grants 45957 (to G.R.-C.) and 43970-Q (to J.V.-P.), The Academy of Sciences for Developing World (TWAS) Grant 03-139 RG/BIO/LA (to G.R.-C.), National Institutes of Health Grant R01TW006664 (to J.V.-P.), and the Fundación Miguel Alemán. A.P.R.-I., A.G.-R., I.R.-R., and A.L.E.-S. are graduate students supported by fellowships from CONACyT México.

Disclosure Statement: The authors have nothing to disclose.

First Published Online April 10, 2007

Abbreviations: ADD, Anti-CaR ADD antibody; Ca2+o, extracellular calcium; CaR, calcium-sensing receptor; EGFR, epidermal growth factor receptor; GASP, G protein-coupled receptor-associated sorting protein; GFP, green fluorescent protein; GPCR, G protein-coupled receptor; HEK-293, human embryonic kidney 293; shRNA, short hairpin RNA.

Received for publication December 5, 2006. Accepted for publication April 6, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Brown EM, Gamba G, Riccardi D, Lombardi M, Butters R, Kifor O, Sun A, Hediger MA, Lytton J, Hebert SC 1993 Cloning and characterization of an extracellular Ca2+-sensing receptor from bovine parathyroid. Nature 366:575–580[CrossRef][Medline]
  2. Tfelt-Hansen J, Brown EM 2005 The calcium-sensing receptor in normal physiology and pathophysiology: a review. Crit Rev Clin Lab Sci 42:35–70[CrossRef][Medline]
  3. Hu J, Spiegel AM 2003 Naturally occurring mutations of the extracellular Ca2+-sensing receptor: implications for its structure and function. Trends Endocrinol Metab 14:282–288[CrossRef][Medline]
  4. Hendy GN, D’Souza-Li L, Yang B, Canaff L, Cole DE 2000 Mutations of the calcium-sensing receptor (CASR) in familial hypocalciuric hypercalcemia, neonatal severe hyperparathyroidism, and autosomal dominant hypocalcemia. Hum Mutat 16:281–296[CrossRef][Medline]
  5. Brown EM, MacLeod RJ 2001 Extracellular calcium sensing and extracellular calcium signaling. Physiol Rev 81:239–297[Abstract/Free Full Text]
  6. Kifor O, Díaz R, Butters R, Brown EM 1997 The Ca2+-sensing receptor (CaR) activates phospholipases C, A2, and D in bovine parathyroid and CaR-transfected, human embryonic kidney (HEK293) cells. J Bone Miner Res 12:715–725[CrossRef][Medline]
  7. Chang W, Pratt S, Chen TH, Bourguignon L, Shoback D 2001 Amino acids in the cytoplasmic C terminus of the parathyroid Ca2+-sensing receptor mediate efficient cell-surface expression and phospholipase C activation. J Biol Chem 276:44129–44136[Abstract/Free Full Text]
  8. Chang W, Chen TH, Pratt S, Shoback D 2000 Amino acids in the second and third intracellular loops of the parathyroid Ca2+-sensing receptor mediate efficient coupling to phospholipase C. J Biol Chem 275:19955–19963[Abstract/Free Full Text]
  9. Ward DT 2004 Calcium receptor-mediated intracellular signalling. Cell Calcium 35:217–228[CrossRef][Medline]
  10. Herrera-Vigenor F, Hernández-García R, Valadez-Sánchez M, Vázquez-Prado J, Reyes-Cruz G 2006 AMSH regulates calcium-sensing receptor signaling through direct interactions. Biochem Biophys Res Commun 347:924–930[CrossRef][Medline]
  11. Zhang M, Breitwieser GE 2005 High affinity interaction with filamin A protects against calcium-sensing receptor degradation. J Biol Chem 280:11140–11146[Abstract/Free Full Text]
  12. Pi M, Oakley RH, Gesty-Palmer D, Cruickshank RD, Spurney RF, Luttrell LM, Quarles LD 2005 ß-Arrestin- and G protein receptor kinase-mediated calcium-sensing receptor desensitization. Mol Endocrinol 19:1078–1087[Abstract/Free Full Text]
  13. Gama L, Breitwieser GE 1998 A carboxyl-terminal domain controls the cooperativity for extracellular Ca2+ activation of the human calcium sensing receptor. A study with receptor-green fluorescent protein fusions. J Biol Chem 273:29712–29718[Abstract/Free Full Text]
  14. Chattopadhyay N 2006 Effects of calcium-sensing receptor on the secretion of parathyroid hormone-related peptide and its impact on humoral hypercalcemia of malignancy. Am J Physiol Endocrinol Metab 290:E761–E770
  15. Ferguson SSG 2001 Evolving concepts in G protein-coupled receptor endocytosis: the role in receptor desensitization and signaling. Pharmacol Rev 53:1–24[Abstract/Free Full Text]
  16. Zastrow V 2003 Mechanisms regulating membrane trafficking of G protein-coupled receptors in the endocytic pathway. Life Sci 74:217–224[CrossRef][Medline]
  17. Lefkowitz RJ, Shenoy SK 2005 Transduction of receptor signals by ß-arrestins. Science 308:512–517[Abstract/Free Full Text]
  18. Miaczynska M, Zerial M 2002 Mosaic organization of the endocytic pathway. Exp Cell Res 272:8–14[CrossRef][Medline]
  19. Seachrist JL, Ferguson S 2003 Regulation of G protein-coupled receptor endocytosis and trafficking by Rab GTPases. Life Sci 74:225–235[CrossRef][Medline]
  20. Rosenfeld JL, Knoll BJ, Moore RH 2002 Regulation of G-protein-coupled receptor activity by rab GTPases. Receptors Channels 8:87–97[CrossRef][Medline]
  21. Ray K, Fan GF, Goldsmith PK, Spiegel AM 1997 The carboxyl terminus of the human calcium receptor. Requirements for cell-surface expression and signal transduction. J Biol Chem 272:31355–31361[Abstract/Free Full Text]
  22. Bai M, Quinn S, Trivedi S, Kifor O, Pearce S H, Pollak MR, Krapcho K, Hebert SC, Brown EM 1996 Expression and characterization of inactivating and activating mutations in the human Ca2+o-sensing receptor. J Biol Chem 271:19537–19545[Abstract/Free Full Text]
  23. Ray K, Clapp P, Goldsmith PK, Spiegel AM 1998 Identification of the sites of N-linked glycosylation on the human calcium receptor and assessment of their role in cell surface expression and signal transduction. J Biol Chem 273:34558–34567[Abstract/Free Full Text]
  24. Bockaert J, Fagni L, Dumuis A, Marin P 2004 GPCR interacting proteins (GIP). Pharmacol Ther 103:203–221[CrossRef][Medline]
  25. Simonin F, Karcher P, Boeuf JJ, Matifas A, Kieffer BL 2004 Identification of a novel family of G protein-coupled receptor associated sorting proteins. J Neurochem 89:766–775[CrossRef][Medline]
  26. Whistler JL, Enquist J, Marley A, Fong J, Gladher F, Tsuruda P, Murray SR, Von Zastrow M 2002 Modulation of postendocytic sorting of G protein-coupled receptors. Science 297:615–620[Abstract/Free Full Text]
  27. Bartlett SE, Enquist J, Hopf FW, Lee JH, Gladher F, Kharazia V, Waldhoer M, Mailliard WS, Armstrong R, Bonci A, Whistler JL 2005 Dopamine responsiveness is regulated by targeted sorting of D2 receptors. Proc Natl Acad Sci USA 102:11521–11526[Abstract/Free Full Text]
  28. MacLeod RJ, Yano S, Chattopadhyay N, Brown EM 2004 Extracellular calcium-sensing receptor transactivates the epidermal growth factor receptor by a triple-membrane-spanning signaling mechanism. Biochem Biophys Res Commun 320:455–460[CrossRef][Medline]
  29. MacLeod RJ, Chattopadhyay N, Brown EM 2003 PTHrP stimulated by the calcium-sensing receptor requires MAP kinase activation. Am J Physiol Endocrinol Metab 284:E435–E442
  30. Chen RA, Goodman WG 2004 Role of the calcium-sensing receptor in parathyroid gland physiology. Am J Physiol Renal Physiol 286:F1005–F1011
  31. Holstein DM, Berg KA, Leeb-Lundberg LM, Olson MS, Saunders C 2004 Calcium-sensing receptor-mediated ERK1/2 activation requires G{alpha}i2 coupling and dynamin-independent receptor internalization. J Biol Chem 279:10060–10069[Abstract/Free Full Text]
  32. Hjalm G, MacLeod RJ, Kifor O, Chattopadhyay N, Brown EM 2001 Filamin-A binds to the carboxyl-terminal tail of the calcium-sensing receptor, an interaction that participates in CaR-mediated activation of mitogen-activated protein kinase. J Biol Chem 276:34880–34887[Abstract/Free Full Text]
  33. Kifor O, Díaz R, Butters R, Kifor I, Brown EM 1998 The calcium-sensing receptor is localized in caveolin-rich plasma membrane domains of bovine parathyroid cells. J Biol Chem 273:21708–21713[Abstract/Free Full Text]
  34. Thomsen P, Roepstorff K, Stahlhut M, van Deurs B 2002 Caveolae are highly immobile plasma membrane microdomains, which are not involved in constitutive endocytic trafficking. Mol Biol Cell 13:238–250[Abstract/Free Full Text]
  35. Yano S, Macleod RJ, Chattopadhyay N, Tfelt-Hansen J, Kifor O, Butters RR, Brown EM 2004 Calcium-sensing receptor activation stimulates parathyroid hormone-related protein secretion in prostate cancer cells: role of epidermal growth factor receptor transactivation. Bone 35:664–672[Medline]
  36. Hamelin E, Theriault C, Laroche G, Parent JL 2005 The intracellular trafficking of the G protein-coupled receptor TPß depends on a direct interaction with Rab11. J Biol Chem 280:36195–36205[Abstract/Free Full Text]
  37. Theriault C, Rochdi MD, Parent JL 2004 Role of the Rab11-associated intracellular pool of receptors formed by constitutive endocytosis of the ß isoform of the thromboxane A2 receptor (TPß). Biochemistry 43:5600–5607[CrossRef][Medline]
  38. Moore RH, Millman EE, Alpizar-Foster E, Dai W, Knoll BJ 2004 Rab11 regulates the recycling and lysosome targeting of ß2-adrenergic receptors. J Cell Sci 117:3107–3117[Abstract/Free Full Text]
  39. Pula G, Mundell SJ, Roberts PJ, Kelly E 2004 Agonist-independent internalization of metabotropic glutamate receptor 1a is arrestin-and clathrin-dependent and is suppressed by receptor inverse agonists. J Neurochem 89:1009–1020[CrossRef][Medline]
  40. Dale LB, Bhattacharya M, Seachrist JL, Anborgh PH, Ferguson SS 2001 Agonist-stimulated and tonic internalization of metabotropic glutamate receptor 1a in human embryonic kidney 293 cells: agonist-stimulated endocytosis is ß-arrestin1 isoform-specific. Mol Pharmacol 60:1243–1253[Abstract/Free Full Text]
  41. Kifor O, Kifor I, Moore Jr FD, Butters Jr RR, Brown EM 2003 m-Calpain colocalizes with the calcium-sensing receptor (CaR) in caveolae in parathyroid cells and participates in degradation of the CaR. J Biol Chem 278:31167–31176[Abstract/Free Full Text]
  42. Heydorn A, Sondergaard BP, Ersboll B, Holst B, Nielsen FC, Haft CR, Whistler J, Schwartz TW 2004 A library of 7TM receptor C-terminal tails. Interactions with the proposed post-endocytic sorting proteins ERM-binding phosphoprotein 50 (EBP50), N-ethylmaleimide-sensitive factor (NSF), sorting nexin 1 (SNX1), and G protein-coupled receptor-associated sorting protein (GASP). J Biol Chem 279:54291–54303[Abstract/Free Full Text]
  43. Huang Y, Niwa J, Sobue G, Breitwieser GE 2006 Calcium-sensing receptor ubiquitination and degradation mediated by the E3 ubiquitin ligase dorfin. J Biol Chem 281:11610–11617[Abstract/Free Full Text]
  44. Li H, Seth A 2004 An RNF11:Smurf2 complex mediates ubiquitination of the AMSH protein. Oncogene 23:1801–1808[CrossRef][Medline]
  45. Kavalali ET 2006 Synaptic vesicle reuse and its implications. Neuroscientist 12:57–66[Abstract/Free Full Text]
  46. Sara Y, Virmani T, Deak F, Liu X, Kavalali ET 2005 An isolated pool of vesicles recycles at rest and drives spontaneous neurotransmission. Neuron 45:563–573[CrossRef][Medline]
  47. Sun JY, Wu XS, Wu LG 2002 Single and multiple vesicle fusion induce different rates of endocytosis at a central synapse. Nature 417:555–559[CrossRef][Medline]
  48. Goldsmith P, Fan GF, Ray K, Shiloach J, McPhie P, Rogers KV, Spiegel AM 1999 Expression, purification, and biochemical characterization of the amino-terminal extracellular domain of the human calcium receptor. J Biol Chem 274:11303–11309[Abstract/Free Full Text]
  49. McCullough J CM, Urbe S 2004 AMSH is an endosome-associated ubiquitin isopeptidase. J Cell Biol 166:487–492[Abstract/Free Full Text]
  50. Whistler JL, Tsao P, von Zastrow M 2001 A phosphorylation-regulated brake mechanism controls the initial endocytosis of opioid receptors but is not required for post-endocytic sorting to lysosomes. J Biol Chem 276:34331–34338[Abstract/Free Full Text]
  51. Kim KA, von Zastrow M 2003 Neurotrophin-regulated sorting of opioid receptors in the biosynthetic pathway of neurosecretory cells. J Neurosci 23:2075–2085[Abstract/Free Full Text]
  52. Vickery RG, von Zastrow M 1999 Distinct dynamin-dependent and -independent mechanisms target structurally homologous dopamine receptors to different endocytic membranes. J Cell Biol 144:31–43[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
21/6/1394    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reyes-Ibarra, A. P.
Right arrow Articles by Reyes-Cruz, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reyes-Ibarra, A. P.
Right arrow Articles by Reyes-Cruz, G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals