help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2007-0103
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
21/7/1581    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Debevec, D.
Right arrow Articles by White, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Debevec, D.
Right arrow Articles by White, R.
Molecular Endocrinology 21 (7): 1581-1592
Copyright © 2007 by The Endocrine Society

Receptor Interacting Protein 140 Regulates Expression of Uncoupling Protein 1 in Adipocytes through Specific Peroxisome Proliferator Activated Receptor Isoforms and Estrogen-Related Receptor {alpha}

Darja Debevec, Mark Christian, Daniel Morganstein, Asha Seth, Birger Herzog, Malcolm Parker and Roger White

Institute of Reproductive and Developmental Biology, Imperial College London, London W12 ONN, United Kingdom

Address all correspondence and requests for reprints to: Roger White, Imperial College London, Institute of Reproductive and Developmental Biology, Hammersmith Campus, Du Cane Road, London W12 0NN, United Kingdom. E-mail: roger.white{at}imperial.ac.uk.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Expression of uncoupling protein 1 (Ucp1) mRNA is elevated in differentiated adipocytes derived from brown or white adipose tissue devoid of the nuclear receptor corepressor receptor interacting protein 140 (RIP140). Increased expression is mediated in part by the recruitment of peroxisome proliferator activated receptors {alpha} and {gamma}, together with estrogen-related receptor {alpha}, which functions through a novel binding site on the Ucp1 enhancer. This demonstrates that regulation of Ucp1 expression in the absence of RIP140 involves derepression of at least three different nuclear receptors. The ability to increase expression of Ucp1 by ß-adrenergic signaling is independent of RIP140, as shown by the action of the ß3-adrenergic agonist CL 316,243 to stimulate expression in both brown and white adipocytes in the presence and absence of the corepressor. Therefore, the expression of this metabolic uncoupling protein in adipose cells is regulated by inhibition as well as activation of distinct signaling pathways.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE MAINTENANCE OF energy homeostasis requires the regulated expression of gene networks that control metabolic functions in response to changing environmental conditions. A number of studies have demonstrated a fundamental role for nuclear receptors (NRs) and their ligands in the regulation of transcription of metabolic genes (1, 2). These include the peroxisome proliferator activated receptors (PPAR) (3), thyroid hormone receptors (4), the retinoid receptors RAR/RXR (5, 6), and the bile acid and oxysterol receptors FXR and LXR (7), and recent studies have identified an important role for the orphan NR estrogen-related receptor {alpha} (ERR{alpha}) (6, 8). The ability of NRs to activate gene transcription depends on the recruitment of cofactors, of which peroxisome proliferator-activated receptor-{gamma} coactivator 1{alpha} (PGC-1{alpha}) and PGC-1ß, initially identified as key coregulators of PPAR{gamma}, seem to be crucial for the activation of many metabolic genes (9, 10).

In addition to activation of gene expression, many of these same metabolic genes and gene networks are subject to repression by NRs. We found that mice devoid of the NR corepressor receptor interacting protein 140 (RIP140) are lean with reduced trigyceride stores in white adipose tissue (WAT) accompanied by an increase in expression of genes involved in several metabolic pathways that include mitochondrial biogenesis, fatty acid oxidation, and oxidative phosphorylation (11, 12, 13). One of these genes, uncoupling protein 1 (Ucp1) is of particular interest because it is normally expressed in brown adipose tissue (BAT) during adaptive thermogenesis and not in WAT and as such has been described as an important factor that defines the function of the adipose cell in terms of its ability to utilize or store energy. Interestingly, in the absence of RIP140, Ucp1 expression is elevated in adipocytes derived from WAT (14).

In BAT, Ucp1 mRNA increases rapidly after cold exposure in response to ß3-adrenergic signaling. A 220-bp enhancer region has been identified in the 5'-flanking sequence of the Ucp1 gene that is conserved between species and contains a number of cis-acting elements that regulate tissue-specific expression and hormonal regulation (15, 16, 17, 18). Activation of the ß3-adrenergic receptor (ß3AR) triggers the p38 MAPK signaling pathway, which results in phosphorylation of transcriptional regulators such as cAMP-responsive element binding protein (CREB) and activating transcription factor 2 (ATF2) that act directly at the Ucp1 promoter (19, 20, 21, 22, 23). Two CREB response elements have also been identified in the Ucp1 enhancer, the most proximal of which has been shown to be important for norepinephrine-dependent stimulation of Ucp1 gene transcription (17). Activation by ß3AR may also be indirect by regulating the expression and activity of transcriptional coregulators, in particular PGC-1{alpha} (19). The 220-bp Ucp1 enhancer is also targeted by a number of NRs, including PPARs, RAR, RXR, and thyroid hormone receptors that bind to well characterized response elements (15, 20, 24, 25, 26, 27, 28). The PPAR response element (PPRE), which is conserved among species, has been shown to be essential for Ucp1 enhancer activity (15, 22), at least in cell culture models. PPAR{alpha} and PPAR{gamma} activate Ucp1 transcription in BAT (15, 29), whereas an activated form of PPAR{delta} stimulates expression in mice (30).

NR cofactors have also been shown to be controlling factors in adipogenesis and the function of the mature adipocyte. The relative expression levels of the p160 family members steroid receptor coactivator-1 and transcriptional intermediary factor-2 regulate the development of WAT and BAT (31), and the potential to store triglycerides in adipocytes is reduced in the absence of transcriptional intermediary factor-2 (31, 32). PGC-1{alpha} is a key transcriptional coactivator and metabolic regulator in BAT (9, 33, 34). Activation or expression of PGC-1{alpha} promotes adaptive thermogenesis in BAT, stimulates mitochondrial biogenesis, and increases oxidative metabolism in several cell types (9, 35, 36, 37). Overexpression of PGC-1{alpha}, together with treatment with ligands for PPAR{gamma}, can promote the occurrence of brown fat features in human white preadipocytes (38), demonstrating the importance of the regulation and integration of hormonal and ligand induced signaling pathways in adipocyte function.

Differential regulation of PPAR{gamma} target genes by corepressors can also selectively control transcription in adipocytes (39). In common with PGC-1{alpha}, RIP140 has been shown to interact in an agonist-dependent manner with most NRs, including all three PPAR isoforms (40, 41, 42). RIP140 null cells, when differentiated into adipocytes in vitro, also show elevated energy expenditure and express high levels of Ucp1, implying an intrinsic role of RIP140 in regulating Ucp1 expression (12, 14). In agreement with these observations, RIP140 has been demonstrated to be recruited directly to the Ucp1 enhancer element, indicating a primary role for RIP140 in the repression of Ucp1 gene transcription (14), but the identification of which receptors may be targets for RIP140 has yet to be determined.

The aims of this study are to investigate the contribution of ß3AR and NR signaling to the upregulated expression of Ucp1 in RIP140 null adipocytes. By analyzing these pathways in primary cultures and cell lines, we have been able to identify specific NRs that are responsible for the activation of Ucp1 expression and that are subject to repression in white adipocytes.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
RIP140 Null Adipocytes Derived from BAT and WAT Express Elevated Levels of Ucp1
Primary cultures of BAT and WAT from both wild-type and RIP140 null mice were treated with a hormonal cocktail in vitro to induce adipogenesis. Mature adipocytes were evident as judged morphologically by the accumulation of cytosolic fat droplets (Fig. 1AGo). This is in agreement with previous reports that adipogenesis is not dependent on the expression of RIP140 (11). Consistent with these morphological changes, the adipocyte marker gene fatty acid-binding protein aP2 was expressed in a similar manner after differentiation in both wild-type and RIP140 null cells (Fig. 1BGo). Ucp1 mRNA levels were quantitated and found to be higher in both BAT and WAT primary cultures after differentiation, but there was a marked additional increase in expression in the absence of RIP140. Thus, basal Ucp1 expression was increased approximately 50-fold in differentiated RIP140 null brown adipocytes compared with wild-type adipocytes, whereas that in RIP140 null white adipocytes was increased 6-fold (Fig. 1CGo).


Figure 1
View larger version (45K):
[in this window]
[in a new window]

  		Fig. 1. Differentiation of Primary RIP140 Null Adipocytes and Expression of Ucp1

A, Images of untreated control (Co) and differentiated (D) primary brown and white adipocytes from wild-type (+/+) and RIP140 null (–/–) mice. B and C, Real-time PCR analysis of aP2 and Ucp1 in untreated control (Co) and differentiated (D) primary brown and white adipocytes. Data are expressed relative to results for untreated RIP140 null white adipocytes.

 
RIP140 Null Adipocytes Retain the Capacity to Respond to ß3-Adrenergic Stimulation
In view of the importance of the ß3-adrenergic signaling pathway in the induction of Ucp1 expression in BAT, we investigated the influence of RIP140 on this pathway in the BAT and WAT primary cultures. After adipocyte differentiation, cells were treated with CL 316,243, a specific ß3AR agonist. Absolute levels of Ucp1 mRNA were markedly higher in brown adipocytes relative to those in white adipocytes as expected, but importantly CL 316,243 administration increased Ucp1 expression in both wild-type and RIP140 null adipocytes. The ability of CL 316,243 to induce Ucp1 expression in RIP140 null adipocytes, which is particularly evident in brown adipocytes, (Fig. 2AGo), indicates that ß3-adrenergic signaling is maintained in the absence of RIP140. Nevertheless, it was conceivable that the up-regulation of Ucp1 in cells devoid of RIP140, in both the presence and absence of CL 316,243, might result from an increase in the activity of the ß3-adrenergic signaling pathway.


Figure 2
View larger version (36K):
[in this window]
[in a new window]

  		Fig. 2. Comparison of ß3AR Activation in Wild-Type and RIP140 Null Adipocytes

A, Real-time PCR analysis of Ucp1 in differentiated brown and white primary adipocytes nonstimulated (NS) or treated with 10 µM CL 316,243 (CL) for 5 h. B, Analysis of p38 MAPK and ATF2 activation in differentiated wild type and RIP140 null brown and white primary adipocytes. Cells were either nonstimulated (NS) or treated with 10 µM CL 316,243 (CL) for 20 min and lysates were analyzed by Western blotting with antibodies against phosphorylated p38 MAPK (p38-P), total (p38-T) p38 MAPK, phosphorylated ATF2 (ATF2-P), and total (ATF2-T) ATF2. C, Real-time PCR analysis of PGC-1{alpha} in differentiated brown and white primary adipocytes that were either nonstimulated (NS) or treated with 10 µM CL 316,243 (CL) for 5 h. D, Real-time PCR analysis of ß3AR in untreated control (Co) and differentiated (D) brown and white primary wild-type and RIP140 null adipocytes. Data are expressed relative to results for untreated RIP140 null white adipocytes.

 
We investigated the influence of RIP140 on ß3-adrenergic signaling by examining the phosphorylation status of p38 MAPK and ATF2 in differentiated adipocytes before and after treatment with CL 316,243. Protein extracts from wild-type and RIP140 null adipocytes were analyzed by Western blotting. The expression of RIP140 had no effect on the phosphorylation of p38 MAPK in response to CL 316,243 administration in either brown or white adipocytes (Fig. 2BGo, top panels). Phosphorylated ATF2 levels were also unaffected by RIP140 expression in white adipocytes (Fig. 2BGo, bottom panels), but total levels of both p38 and ATF2 were slightly elevated in the absence of RIP140. In contrast, in brown adipocytes devoid of RIP140, there was an increase in phosphorylated ATF2, although total ATF2 levels were reduced (Fig. 2BGo, bottom panels). Given that the phosphorylation of p38 MAPK and ATF2 is unchanged in white adipocytes in the absence of RIP140, we conclude that increased expression of Ucp1 in these cells does not result from up-regulation of ß3-adrenergic signaling. In brown adipocytes, however, the increase in phosphorylated ATF2 levels in the absence of RIP140 may contribute to the increased Ucp1 expression. To further investigate the activation of the ß3-adrenergic pathway, we examined the expression of the NR cofactor PGC-1{alpha} and the ß3AR. PGC-1{alpha} expression was increased in both wild-type and RIP140 null adipocytes in response to CL 316,243 treatment, consistent with the maintenance of intact ß-adrenergic signaling in the absence of RIP140. However, both basal and stimulated levels of PGC-1{alpha} were elevated in RIP140 null adipocytes derived from BAT (Fig. 2CGo), and this may contribute to the higher levels of Ucp1 mRNA in these cells. Expression of ß3AR was unaltered in the absence of RIP140 with higher levels in brown adipocytes, as expected (Fig. 2DGo). Therefore, we conclude from these studies that ß3-adrenergic signaling is capable of stimulating Ucp1 gene expression and that this is maintained in the absence of RIP140. However, in brown adipocytes, increased Ucp1 expression may in part result from indirect effects of the repressor acting on the expression of additional transcriptional regulators.

Different PPAR Isoforms Bind to the Ucp1 Enhancer Region and Activate Transcription in the Absence of RIP140
To investigate the function of different PPAR isoforms in the absence of RIP140 repression, the levels of expression of PPAR{alpha}, PPAR{gamma}, and PPAR{delta} were determined in wild-type and RIP140 null adipocytes before and after differentiation. The levels of PPAR{alpha}, which increased during differentiation, were greater in the absence of RIP140, particularly in brown adipocytes, in which its expression increased approximately 20-fold (Fig. 3Go). The expression of PPAR{gamma}, which also increased during adipogenesis, was unaffected by RIP140 expression. PPAR{delta} expression was unchanged during adipocyte differentiation and unaffected by RIP140 expression. Therefore, because PPAR{alpha} is a key activator of Ucp1 expression (29), the elevated basal levels of Ucp1 in the absence of RIP140 may result from the increased expression of this isoform.


Figure 3
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 3. Expression of PPAR{alpha}, PPAR{delta}, and PPAR{gamma} in RIP140 Null Adipocytes

Real-time PCR analysis of PPAR{alpha}, PPAR{gamma}, and PPAR{delta} in untreated control (Co) and differentiated (D) brown and white primary adipocytes. Data are expressed relative to results for untreated RIP140 null white adipocytes.

 
In view of these changes in expression, we exploited a pharmacological approach together with chromatin immunoprecipitation assays to determine which PPAR isoforms may be responsible for the increased Ucp1 gene expression. To perform these experiments, we used an RIP140 null adipocyte cell line (RIPKO-1) that expresses all three PPAR isoforms and expresses Ucp1 after adipocyte differentiation and an immortalized line of wild-type preadipocytes derived from the Immortomouse mouse line (43). RIPKO-1 cells were induced to undergo adipocyte differentiation for 7 d, treated with specific agonists for PPAR{alpha}, PPAR{delta}, or PPAR{gamma} for an additional 3 d, and then levels of Ucp1 mRNA were determined. Addition of specific agonists to PPAR{alpha} (GW7647) and PPAR{gamma} (roziglitazone) induced Ucp1 expression between 4- and 5-fold relative to no agonist treatment (Fig. 4AGo), but a PPAR{delta}-specific agonist (GW1516) had no effect. No increase in expression was observed on treatment with T3 alone (data not shown). Additional experiments were performed in the presence of a pan antagonist that blocks the actions of both PPAR{alpha} and PPAR{gamma} (GW496471) to minimize the contribution of potential endogenous ligands. A concentration of 10–6 M GW496471 was sufficient to prevent the increase in Ucp1 expression observed between d 7 and 10 (Fig. 4Go). In RIP140 null cells, the reduction in Ucp1 expression observed in the presence of the pan antagonist was reversed by treatment with both PPAR{alpha}- and PPAR{gamma}-specific ligands (Fig. 4AGo), confirming that both PPAR{alpha} and PPAR{gamma} are capable of inducing Ucp1 expression in RIPKO-1 cells. To further address the role of RIP140 in the regulation of Ucp1 expression by these receptors and to minimize the affects of altered PPAR{alpha} and PPAR{gamma} expression in the null cell line, differentiated wild-type adipocytes were treated with adenoviral vectors expressing short hairpin (sh) RNA to RIP140 to reduce RIP140 expression (supplemental Fig. 1, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). A decrease in the level of RIP140 in wild-type adipocytes results in a significant agonist dependent up-regulation of Ucp1 expression relative to an sh random control sequence (Fig. 4BGo), whereas the levels of expression of both PPAR{alpha} and PPAR{gamma} are relatively unaltered (supplemental Fig. 2, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). Therefore, a transient decline in RIP140 results in enhanced ligand-dependent activation of both PPAR{alpha} and PPAR{gamma} and increased expression of the Ucp1 target gene.


Figure 4
View larger version (13K):
[in this window]
[in a new window]

  		Fig. 4. PPAR{alpha} and PPAR{gamma} Induce Ucp1 Expression in RIPKO-1 Adipocytes

A, Histogram shows relative levels of Ucp1 expression in differentiated RIPKO-1 cells after addition of selective PPAR agonists: roziglitazone (10 µM), GW7647 (1 µM), and GW501516 (5 nM), in the absence or presence of PPAR antagonist GW496471 (1 µM) for 3 d. Data are expressed relative to expression at d 7. B, Effect of depleting RIP140 using shRNA on the expression of Ucp1 in differentiated adipocytes. Immortalized white adipocytes were differentiated using standard conditions for 7 d before adenoviral infection. Viral infection was performed for a maximum of 6 h, and, after an additional 48 h, the cells were treated with roziglitazone (1 µM) or GW7647 (10 µM) for 48 h.

 
The up-regulation of Ucp1 gene expression by both PPAR{alpha} and PPAR{gamma} in RIP140 null cells is supported by chromatin immunoprecipitation assays. In agreement with the studies in primary white and brown adipocytes both PPAR{alpha} and PPAR{gamma} mRNA levels were induced in a similar manner on differentiation of RIPKO-1 cells (supplemental Fig. 3A, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org), and Western blot analysis showed an induction of PPAR{alpha} and PPAR{gamma} protein (supplemental Fig. 3B). Cross-linked protein-DNA extracts prepared from undifferentiated and differentiated RIPKO-1 adipocytes were immunoprecipitated with antibodies specific for PPAR{alpha} and PPAR{gamma} and analyzed by PCR using primers flanking a PPRE in the perilipin gene promoter, which has been shown to bind both of these receptor isoforms (44), the Ucp1 enhancer element and a negative control region 15 kb upstream of the Ucp1 gene. In undifferentiated RIPKO-1 cells, no enrichment of the perilipin response element or the Ucp1 enhancer element sequences were observed with antibodies specific for PPAR{alpha} and PPAR{gamma} (Fig. 5AGo). Binding of both PPAR isoforms was detected on the perilipin PPRE and the Ucp1 enhancer element in differentiated RIPKO-1 cells but not the negative control region (Fig. 5BGo).


Figure 5
View larger version (60K):
[in this window]
[in a new window]

  		Fig. 5. Recruitment of PPAR{alpha} and PPAR{gamma} to the Ucp1 Enhancer Element in RIPKO-1 Cells

Chromatin immunoprecipitation assays were used to detect the presence of PPAR{alpha} and PPAR{gamma} at the Ucp1 enhancer, upstream control region, or perilipin PPRE element in undifferentiated (A) and differentiated (B) RIPKO-1 cells using a control (IgG), anti-PPAR{alpha}, or anti-PPAR{gamma} antibodies.

 
RIP140 Represses ERR{alpha}/PGC-1 Induced Transcriptional Activation from the Ucp1 Enhancer Element
During the course of analyzing the recruitment of PPARs to the Ucp1 enhancer, we noted potential binding sites for the orphan NR ERR{alpha} (supplemental Fig. 4, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). In addition to PPAR{alpha} and PPAR{gamma}, we therefore analyzed the expression of ERR{alpha} in RIPKO-1 adipocytes and found that mRNA and protein levels were increased during adipocyte differentiation (Fig. 6Go, A and B). In addition, the loss of RIP140 expression results in only a small 1.4-fold increase in ERR{alpha} expression in primary adipocytes (supplemental Fig. 5, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). Chromatin immunoprecipitation assays using a specific ERR{alpha} antibody demonstrated that the Ucp1 enhancer element but not a control region 15 kb upstream of the mouse Ucp1 gene was precipitated from differentiated RIPKO-1 adipocytes, indicating a direct association of ERR{alpha} with the Ucp1 enhancer (Fig. 6CGo). To investigate a functional role for ERR{alpha} on the Ucp1 enhancer, a luciferase reporter gene under the control of the 220-bp enhancer element was stably incorporated into RIPKO-1 adipocytes. The RIP140 null reporter cell line was treated for 10 d with standard differentiation conditions, and, after adipogenesis, the cells were maintained in the presence of increasing concentrations of the ERR{alpha} antagonist XCT790 for 48 h. This resulted in a dose-dependent decrease in expression of the reporter gene, indicating a functional role for ERR{alpha} on the enhancer element (Fig. 6DGo). To further characterize the combined effect of ERR{alpha} and PPARs, RIPKO-1 adipocytes were differentiated as described previously and treated with both the PPAR{alpha}/PPAR{gamma} antagonist as well as the ERR{alpha} antagonist. Antagonist treatment of the differentiated adipocytes resulted in reduction of Ucp1 expression to control levels, indicating that, in these cells lacking RIP140, the elevated expression of Ucp1 is mediated by the combined activity of at least three different NRs (Fig. 6EGo).


Figure 6
View larger version (31K):
[in this window]
[in a new window]

  		Fig. 6. Adipocyte Expression and Recruitment of ERR{alpha} to the Ucp1 Enhancer

A, Real-time PCR analysis of ERR{alpha} expression in RIPKO-1 cells at different times during adipogenesis, starting in preconfluent cells (PC) and during differentiation up to d 10. Data are expressed relative to mRNA expression at d 0. B, Immunoblot for ERR{alpha} and glyceraldehyde-3-phosphate dehydrogenase (loading control) in untreated (Co) and differentiated (D) RIPKO-1 cells. C, Chromatin immunoprecipitation assays were used to detect for the presence of ERR{alpha} on the Ucp1 enhancer or upstream control region in differentiated RIPKO-1 cells using control (IgG) and anti-ERR{alpha} antibodies. D, Expression of a stable integrated Ucp1 (220 bp) enhancer-luciferase reporter gene in RIPKO-1 cells is repressed by treatment with XCT790 for 48 h. E, Combined treatment with GW496471 (1 µM) and XCT790 (10 µM) for 60 h in differentiated RIPKO-1 cells.

 
To locate the specific regions required for binding of ERR{alpha} to the Ucp1 enhancer, Cos-7 cells were transiently transfected with a luciferase reporter gene under the control of either the wild-type 4-kb Ucp1 promoter or a construct with the 220-bp enhancer region deleted (4kb{Delta}Enh) (Fig. 7AGo). Although expression of Ucp1 is restricted to a limited number of cell types and the enhancer is complex in nature and regulated by a number of adipocyte-specific factors, coexpression of ERR{alpha} and PGC-1{alpha} in Cos-7 cells resulted in an 80-fold induction from the wild-type Ucp1 promoter, and this was significantly reduced by deletion of the enhancer element. There was a small increase in promoter activity after expression of ERR{alpha} or PGC-1{alpha} alone, but this was also reduced in the absence of the enhancer. We next tested whether RIP140 was able to repress the transcriptional activity of exogenously expressed ERR{alpha}/PGC-1{alpha}. Cos-7 cells were transiently transfected with a luciferase reporter gene containing 220-bp enhancer element linked to the thymidine kinase promoter from –105 to +50. As with the full-length Ucp1 promoter, the activity of this reporter was not induced in the presence of ERR{alpha} or PGC-1{alpha} alone. Cotransfection of ERR{alpha} and PGC-1{alpha} together induced the activity of the reporter gene by 8-fold, but this was abrogated by coexpression of RIP140 in a dose-dependent manner (Fig. 7BGo). In addition, expression of an RIP140-specific small interference (si) RNA increased the ERR{alpha}/PGC-1{alpha} effect on the Ucp1 reporter gene by more than 2-fold. Therefore, increased expression of RIP140 results in repression, whereas reduction in the levels of RIP140 results in an increase in the transcriptional activation by ERR{alpha}/PGC-1{alpha} from the Ucp1 enhancer.


Figure 7
View larger version (13K):
[in this window]
[in a new window]

  		Fig. 7. RIP140 Represses ERR{alpha}/PGC-1-Induced Transcriptional Activation from the UCP1 Enhancer

A, The effects of ERR{alpha} and PGC-1{alpha} on Ucp1 gene transcription were examined by analyzing the activity of the reporter genes, UCP1–4KB-WT/luc or UCP1–4KB-{Delta}Enh/luc, transiently transfected in Cos-7 cells in the absence or presence of expression vectors for ERR{alpha} and/or PGC-1{alpha}. Luciferase activity was determined after 48 h, and the fold induction was calculated. B, The effect of RIP140 was examined by analyzing the activity of the reporter genes, in which the Ucp1 enhancer was fused to the TK promoter (UCP1–220bp/TKluc), and was transiently transfected in Cos-7 cells in the absence or presence of expression vectors for ERR{alpha} and/or PGC-1{alpha} with increasing amounts of RIP140 (0.2, 2, and 20 ng) or with scrambled siRNA or siRIP expression vectors. Luciferase activity was determined after 48 h, and the fold induction was calculated. C, Transient transfection of Cos-7 cells with reporter constructs pGL3-Basic, UCP1–220bp/TKluc, or UCP1–220bp-ERRE2mut/TKluc in the absence or presence of expression vectors for ERR{alpha} and PGC-1{alpha} or PGC-1ß.

 
Mutational analysis and EMSA were used to identify the role of putative ERR response element (ERRE) binding sites in the Ucp1 enhancer. Potential ERR half-sites were noted at position –2396 and at –2550, overlapping the PPRE/DR1 (direct repeat 1) (supplemental Fig. 3Go), but only mutation of the downstream site abolished DNA binding activity in EMSA (data not shown). To determine whether this ERRE at –2396 was required for Ucp1 promoter activation by ERR{alpha}/PGC-1, Cos-7 cells were transiently transfected with a luciferase reporter gene containing a wild-type enhancer element (UCP1–220bp) or an enhancer element with a mutation in the ERRE site (UCP1–220bp-ERREmut). Expression of ERR{alpha} in the presence of either PGC-1{alpha} or PGC-1ß induced the activity of the wild-type Ucp1 enhancer reporter by 6- to 7-fold, and this induction was abrogated by mutation of the ERRE (Fig. 7DGo), demonstrating that a single ERRE in the Ucp1 enhancer is sufficient for this activation.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
RIP140 plays an essential role in energy homeostasis by repressing metabolic genes that are involved in energy expenditure. We focused on UCP1 expression to investigate the influence of RIP140 on ß3AR and NR signaling pathways in adipocytes. Hormonal control of Ucp1 expression in BAT during adaptive thermogenesis has been well characterized (17, 19, 24, 26, 27), and recent studies have shown that this is a key target gene of RIP140 in adipose cells (11, 14). Analysis of primary cultures indicates that, although the expression levels of Ucp1 are markedly higher in brown adipocytes compared with white adipocytes, the absence of RIP140 leads to a marked increase in expression in both types. Thus, we conclude that RIP140 plays an intrinsic role as a corepressor in both brown and white adipose cells.

We previously demonstrated that the ability of RIP140 to repress Ucp1 transcription is dependent on its recruitment to the upstream enhancer element (12). The enhancer, however, contains a number of binding sites for NRs and members of the ATF/CREB family, but their potential contribution to Ucp1 up-regulation in the absence of RIP140 was not determined. By using a combination of specific ligands and chromatin immunoprecipitation experiments, we propose that the absence of RIP140 leads to the recruitment of PPAR{alpha}, PPAR{gamma}, and ERR{alpha} to the UCP1 enhancer to allow activation of Ucp1 gene transcription. Although an activated version of PPAR{delta} in WAT results in mice with a similar phenotype to that of RIP140 null mice, including the enhanced expression of Ucp1 (30), the inability of a PPAR{delta} ligand to stimulate Ucp1 expression in RIPKO-1 cells suggests that this isoform may not be primarily responsible for the increased levels observed in RIP140 null adipocytes.

In vivo, Ucp1 expression is regulated by ß-adrenergic signaling under the control of the sympathetic nervous system in response to environmental stimuli (19, 24, 45). This is accomplished by activation of the p38 MAPK pathways, which leads to activation of transcription factors such as ATF2 and CREB and increased expression and phosphorylation of the NR cofactor PGC-1{alpha}. We found that RIP140 null adipocytes isolated from both BAT and WAT retain the capacity to respond to ß-adrenergic stimulation as shown by treatment with a specific ß3-adrenergic agonist, which results in activation of p38 MAPK and ATF2 and an increase in Ucp1 mRNA. Nevertheless, there is increased PGC-1{alpha} expression and phosphorylated ATF2 levels observed in brown adipocytes devoid of RIP140, suggesting that the corepressor may play a role in suppressing the ß3-adrenergic signaling pathway. In contrast, given that the absence of RIP140 in white adipocytes does not affect ß3-adrenergic signaling, this pathway does not seem to be involved in the up-regulation of Ucp1 observed in white adipocytes.

ERR{alpha}-mediated gene regulation plays important roles in the control of energy balance by regulating fatty acid oxidation (8, 46). We have shown that full transcriptional activation of Ucp1 promoter by ERR{alpha}/PGC-1{alpha} requires the Ucp1 enhancer element, and, using site-directed mutagenesis, we identified an ERR{alpha} binding site in this element that is required for Ucp1 induction by ERR{alpha}/PGC1{alpha}. The Ucp1 enhancer has been found previously to be a target for repression by RIP140 (14). In this study, we demonstrated that RIP140 is able to repress ERR{alpha}/PGC1{alpha} transcriptional activity, suggesting that both ERR{alpha} and RIP140 are involved in Ucp1 transcriptional regulation. The finding that ERR{alpha}, PPAR{alpha}, and PPAR{gamma} are each recruited directly to this element in differentiated adipocytes together with the previous observation that RIP140 is present on the enhancer element in cells in which Ucp1 mRNA expression is abrogated implies that, in mature adipocytes, RIP140 may regulate Ucp1 transcription by targeting one or more of these receptors. In addition, the demonstration that the increase in Ucp1 expression after differentiation can be almost completely prevented by combined PPAR{alpha}/PPAR{gamma} and ERR{alpha} antagonist treatment indicates a key role for all of these NRs in the regulation of Ucp1 expression in RIP140 null adipocytes in the absence of ß3-adrenergic signaling.

The ability of RIP140 to modulate the action of ERR{alpha} may account in part for the increased UCP1 expression found in WAT in ERR{alpha} null mice (6) in which the potential for repression by cofactors such as RIP140 would be reduced. Recent studies, however, in ERR{alpha} null mice have also demonstrated that this NR is not required for the regulation of Ucp1 expression in the process of adaptive thermogenesis (47). The data described in this study extend these observations by the identification of an ERRE and the finding that the basal expression of a target gene such as Ucp1 may be regulated by repression of different signaling pathways.

In summary, uncoupling proteins such as UCP1 provide an important mechanism for energy dissipation by facilitating the process of thermogenesis as well as a means for maintaining redox balance and reducing the generation of reactive oxygen species. A number of studies have demonstrated that Ucp1 expression is regulated by both NRs and alterations in the levels of intracellular cAMP, with coregulators such as PGC-1{alpha} acting as key factors required for the integration of different signaling pathways. This study identifies an additional mechanism for regulating Ucp1 expression and describes a role for RIP140 in determining the basal level of Ucp1 transcription, which in differentiated adipocytes may be mediated by at least three different NRs, ERR{alpha}, PPAR{alpha}, and PPAR{gamma}. Therefore, alterations in the level of expression of RIP140 or in the recruitment of RIP140 to these specific receptors may provide a mechanism to control processes that determine energy balance in adipose cells.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Animals
The generation of RIP140 null mice has been described previously (48). Mice used in this study were backcrossed six generations to a C57BL/6J background, maintained under standard conditions with controlled light and temperature, and fed a chow diet ad libitum. All experiments were performed according to United Kingdom Home Office guidelines and ethical approval.

Cell Culture
Primary brown and white cultures were prepared from interscapular and inguinal fat depots, respectively, as described previously (14). Brown preadipocytes were induced to differentiate in DMEM-F12 medium supplemented with 33 µM biotin, 17 µM calcium pantothenate, 10% fetal bovine serum, 100 U/ml penicillin,100 µg/ml streptomycin, and 0.25 µg/ml amphotericin B (Invitrogen, Paisley, UK) supplemented with 170 nM insulin, 1 nM T3, 250 nM dexamethasone, 500 µM isobutylmethylxanthine, and 0.125 mM indomethacin for 2 d (Invitrogen). After induction, the cells were fed every 2 d with maintenance medium supplemented with 170 nM insulin and 1 nM T3. White preadipocytes were differentiated as described previously (49). Differentiated white and brown adipocytes were pretreated with 0.1 µM propranolol (5 min), followed by 10 µM CL 316,243 as indicated. Differentiation of RIPKO-1 cells was performed as described previously (49) in the presence of 2.5 µM roziglitazone, unless indicated. In experiments using the PPAR{alpha}/PPAR{gamma} antagonist GW496471, preliminary transient transfection experiments with a PPAR-responsive reporter gene were used to determine the concentrations of PPAR{alpha} and PPAR{gamma} agonists necessary to overcome the inhibitory effects of the pan PPAR{alpha}/PPAR{gamma} antagonist. In the presence of the PPAR{alpha}/PPAR{gamma} antagonist at 10–6 M, treatment with PPAR{gamma} agonist at 10–5 M or a PPAR{alpha} agonist at 10–6 M was sufficient to restore activation (data not shown). The reporter cell line expressing luciferase under the control of the Ucp1 220-bp enhancer was generated by insertion of the reporter and enhancer into the pLenti6 vector (Invitrogen) from which the cytomegalovirus promoter was removed, and the construct was stably introduced by lentiviral infection of RIPKO-1 cells as described previously (14). The immortalized adipocyte cell line was derived from the H-2Kb-tsA58 transgenic mouse using the stromal vascular fraction of WAT and cultured according to published procedures. The sequences used for depletion of RIP140 using adenoviral vectors are as follows: siRIP, GATCCCCAGAAGATCAAGATACCTCATTCAAGAGATGAGGTATCTTGATCTTCTTTTTTA; siRandom (siRAND), GATCCCCGACGTTAGCAATCGAGCTCTTCAAGAGAGAGCTCGATTGCTAACGTCTTTTTA.

In studies using adenoviral infection, immortalized white preadipocytes were differentiated using a standard cocktail for 48 h as described previously and maintained in standard media containing insulin alone for 7 d. Viral infection was performed in serum-free conditions for 6 h, and cells were then maintained in standard conditions with insulin alone for an additional 48 h before the addition of specific ligands.

Expression Analysis
Total RNA was isolated from cell lines, primary cultures, and tissue using TRIzol (Invitrogen) according to the instructions of the manufacturer. cDNA was prepared as described previously (11). RIP140, L19, and Ucp1 gene expression levels were determined using specific primers and TaqMan probes. Expression levels of all other genes were determined with SYBR green reagent by using specific primers. Expression levels for all genes were correlated to that for the L19 ribosomal coding gene. Primer sequences may be obtained on request.

Chromatin Immunoprecipitation Assay
Cells were incubated in 1% formaldehyde in DMEM for 15min at 37 C. Cross-linked cells were lysed, sonicated, and immunoprecipitated with protein A/G PLUS-agarose (SC-2003; Santa Cruz Biotechnology, Santa Cruz, CA) according to the instructions of the manufacturer using rabbit-polyclonal antimouse PPAR{alpha} (SC-9000; Santa Cruz Biotechnology), PPAR{gamma} (SC-7196; Santa Cruz Biotechnology), ERR{alpha} (LS-A5402; Lifespan, Seattle, WA) antibody or control normal rabbit IgG (SC-2027; Santa Cruz Biotechnology). DNA fragments were purified with a QIAquick PCR purification kit (Qiagen, Valencia, CA) and used as templates in PCRs. The primers used for the Ucp1 enhancer were 5'-AGCTTGCTGTCACTCCTCTACA-3' and 5'-TGAGGAAAGGGTTGACCTTG-3', and those for the upstream control region were 5'-GCTTGGGTCCACCTAGAATCAC-3' and 5'-CCTCCAGGTCAAACTGATCTAGACA-3'. Primers for the perilipin promoter were 5'-GAGTGGTCAAGACCTCTGCTC-3' and 5'-GCTCTGCTGACAAACCGGTC-3'. Sequences of all additional oligonucleotides used are available on request.

Western Blotting
Whole-cell lysates were prepared by rinsing cells with cold PBS, followed by addition of 2x Laemmli sample buffer. Equal amounts of proteins were separated on 10% SDS-polyacrylamide gel and transferred to polyvinylidene difluoride membrane (Hybond P; GE Healthcare, Little Chalfont, UK). The levels of phosphorylated (9211S) and total (9212) p38 MAPK and phosphorylated (9225S) and total (9222) ATF2 were detected with a 1:1000 dilution of each specific antisera (New England Biolabs, Beverly, MA). Rabbit polyclonal antimouse PPAR{alpha} (SC-9000) and PPAR{gamma} (SC-7196) antibodies were diluted 1:1000. Immunoreactive bands were visualized using secondary peroxidase-conjugated antibody and enhanced chemiluminescence.

Transient Transfection
Ucp1 promoter reporter constructs were generated as described previously (14). Cos-7 cells were transfected in 96-well plates with 20 ng reporter gene and 5 ng pRL-cytomegalovirus, in the absence or presence of ERR{alpha} (20 ng), PGC-1{alpha} (10 ng), PGC-1ß (10 ng), pSUPER-scrambled (20 ng), or pSUPER-siRIP140 (20 ng) using Fugene6 (Roche, Indianapolis, IN), according to the instructions of the manufacturer. Cells were harvested for luciferase assay 48 h after transfection, and renilla luciferase activity was used to correct for differences in transfection efficiencies.


   FOOTNOTES
 
Disclosure Statement: The authors have nothing to disclose.

First Published Online April 24, 2007

Abbreviations: ß3AR, ß3-Adrenergic receptor; ATF2, activating transcription factor 2; BAT, brown adipose tissue; CREB, cAMP-responsive element binding protein; ERR, estrogen-related receptor; ERRE, estrogen-related receptor response element; NR, nuclear receptor; PGC, peroxisome proliferator-activated receptor-{gamma} coactivator; PPAR, peroxisome proliferator activated receptors; PPRE, PPAR response element; RIP140, receptor interacting protein 140; sh, short hairpin; si, small interfering; Ucp1, uncoupling protein 1; WAT, white adipose tissue.

Received for publication February 23, 2007. Accepted for publication April 16, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Chawla A, Repa JJ, Evans RM, Mangelsdorf DJ 2001 Nuclear receptors and lipid physiology: opening the X-files. Science 294:1866–1870[Abstract/Free Full Text]
  2. Francis GA, Fayard E, Picard F, Auwerx J 2003 Nuclear receptors and the control of metabolism. Annu Rev Physiol 65:261–311[CrossRef][Medline]
  3. Lee CH, Olson P, Evans RM 2003 Minireview: lipid metabolism, metabolic diseases, and peroxisome proliferator-activated receptors. Endocrinology 144:2201–2207[Abstract/Free Full Text]
  4. Yen PM 2001 Physiological and molecular basis of thyroid hormone action. Physiol Rev 81:1097–1142[Abstract/Free Full Text]
  5. Shulman AI, Mangelsdorf DJ 2005 Retinoid x receptor heterodimers in the metabolic syndrome. N Eng J Med 353:604–615[Free Full Text]
  6. Luo J, Sladek R, Carrier J, Bader JA, Richard D, Giguere V 2003 Reduced fat mass in mice lacking orphan nuclear receptor estrogen-related receptor {alpha}. Mol Cell Biol 23:7947–7956[Abstract/Free Full Text]
  7. Kalaany NY, Mangelsdorf DJ 2006 LXRS and FXR: the yin and yang of cholesterol and fat metabolism. Annu Rev Physiol 68:159–191[CrossRef][Medline]
  8. Mootha VK, Handschin C, Arlow D, Xie X, St Pierre J, Sihag S, Yang W, Altshuler D, Puigserver P, Patterson N, Willy PJ, Schulman IG, Heyman RA, Lander ES, Spiegelman BM 2004 Err{alpha} and Gabpa/b specify PGC-1{alpha}-dependent oxidative phosphorylation gene expression that is altered in diabetic muscle. Proc Natl Acad Sci USA 101:6570–6575[Abstract/Free Full Text]
  9. Puigserver P, Spiegelman BM 2003 Peroxisome proliferator-activated receptor-{gamma} coactivator 1 {alpha} (PGC-1 {alpha}): transcriptional coactivator and metabolic regulator. Endocr Rev 24:78–90[Abstract/Free Full Text]
  10. Rosen ED, Spiegelman BM 2006 Adipocytes as regulators of energy balance and glucose homeostasis. Nature 444:847–853[CrossRef][Medline]
  11. Leonardsson G, Steel JH, Christian M, Pocock V, Milligan S, Bell J, So PW, Medina-Gomez G, Vidal-Puig A, White R, Parker MG 2004 Nuclear receptor corepressor RIP140 regulates fat accumulation. Proc Natl Acad Sci USA 101:8437–8442[Abstract/Free Full Text]
  12. Christian M, White R, Parker MG 2006 Metabolic regulation by the nuclear receptor corepressor RIP140. Trends Endocrinol Metab 17:243–250[CrossRef][Medline]
  13. Powelka AM, Seth A, Virbasius JV, Kiskinis E, Nicoloro SM, Guilherme A, Tang X, Straubhaar J, Cherniack AD, Parker MG, Czech MP 2006 Suppression of oxidative metabolism and mitochondrial biogenesis by the transcriptional corepressor RIP140 in mouse adipocytes. J Clin Invest 116:125–136[CrossRef][Medline]
  14. Christian M, Kiskinis E, Debevec D, Leonardsson G, White R, Parker MG 2005 RIP140-targeted repression of gene expression in adipocytes. Mol Cell Biol 25:9383–9391[Abstract/Free Full Text]
  15. Sears IB, MacGinnitie MA, Kovacs LG, Graves RA 1996 Differentiation-dependent expression of the brown adipocyte uncoupling protein gene: regulation by peroxisome proliferator-activated receptor {gamma}. Mol Cell Biol 16:3410–3419[Abstract]
  16. Cassard-Doulcier AM, Gelly C, Fox N, Schrementi J, Raimbault S, Klaus S, Forest C, Bouillaud F, Ricquier D 1993 Tissue-specific and ß-adrenergic regulation of the mitochondrial uncoupling protein gene: control by cis-acting elements in the 5'-flanking region. Mol Endocrinol 7:497–506[Abstract]
  17. Kozak UC, Kopecky J, Teisinger J, Enerback S, Boyer B, Kozak LP 1994 An upstream enhancer regulating brown-fat-specific expression of the mitochondrial uncoupling protein gene. Mol Cell Biol 14:59–67[Abstract/Free Full Text]
  18. Kozak LP, Harper ME 2000 Mitochondrial uncoupling proteins in energy expenditure. Annu Rev Nutr 20:339–363[CrossRef][Medline]
  19. Cao W, Daniel KW, Robidoux J, Puigserver P, Medvedev AV, Bai X, Floering LM, Spiegelman BM, Collins S 2004 p38 mitogen-activated protein kinase is the central regulator of cyclic AMP-dependent transcription of the brown fat uncoupling protein 1 gene. Mol Cell Biol 24:3057–3067[Abstract/Free Full Text]
  20. Alvarez R, de Andres J, Yubero P, Vinas O, Mampel T, Iglesias R, Giralt M, Villarroya F 1995 A novel regulatory pathway of brown fat thermogenesis. Retinoic acid is a transcriptional activator of the mitochondrial uncoupling protein gene. J Biol Chem 270:5666–5673[Abstract/Free Full Text]
  21. del Mar Gonzalez-Barroso M, Pecqueur C, Gelly C, Sanchis D, Alves-Guerra MC, Bouillaud F, Ricquier D, Cassard-Doulcier AM 2000 Transcriptional activation of the human ucp1 gene in a rodent cell line. Synergism of retinoids, isoproterenol, and thiazolidinedione is mediated by a multipartite response element. J Biol Chem 275:31722–31732[Abstract/Free Full Text]
  22. Cao W, Medvedev AV, Daniel KW, Collins S 2001 ß-Adrenergic activation of p38 MAP kinase in adipocytes: cAMP induction of the uncoupling protein 1 (UCP1) gene requires p38 MAP kinase. J Biol Chem 276:27077–27082[Abstract/Free Full Text]
  23. Hernandez A, Obregon MJ 2000 Triiodothyronine amplifies the adrenergic stimulation of uncoupling protein expression in rat brown adipocytes. Am J Physiol 278:E769–E777
  24. Lowell BB, Spiegelman BM 2000 Towards a molecular understanding of adaptive thermogenesis. Nature 404:652–660[Medline]
  25. Cassard-Doulcier AM, Larose M, Matamala JC, Champigny O, Bouillaud F, Ricquier D 1994 In vitro interactions between nuclear proteins and uncoupling protein gene promoter reveal several putative transactivating factors including Ets1, retinoid X receptor, thyroid hormone receptor, and a CACCC box-binding protein. J Biol Chem 269:24335–24342[Abstract/Free Full Text]
  26. Rabelo R, Schifman A, Rubio A, Sheng X, Silva JE 1995 Delineation of thyroid hormone-responsive sequences within a critical enhancer in the rat uncoupling protein gene. Endocrinology 136:1003–1013[Abstract]
  27. Alvarez R, Checa M, Brun S, Vinas O, Mampel T, Iglesias R, Giralt M, Villarroya F 2000 Both retinoic-acid-receptor- and retinoid-X-receptor-dependent signalling pathways mediate the induction of the brown-adipose-tissue-uncoupling-protein-1 gene by retinoids. Biochem J 345:91–97[CrossRef][Medline]
  28. Rabelo R, Reyes C, Schifman A, Silva JE 1996 Interactions among receptors, thyroid hormone response elements, and ligands in the regulation of the rat uncoupling protein gene expression by thyroid hormone. Endocrinology 137:3478–3487[Abstract]
  29. Barbera MJ, Schluter A, Pedraza N, Iglesias R, Villarroya F, Giralt M 2001 Peroxisome proliferator-activated receptor alpha activates transcription of the brown fat uncoupling protein-1 gene. A link between regulation of the thermogenic and lipid oxidation pathways in the brown fat cell. J Biol Chem 276:1486–1493[Abstract/Free Full Text]
  30. Wang YX, Lee CH, Tiep S, Yu RT, Ham J, Kang H, Evans RM 2003 Peroxisome-proliferator-activated receptor {delta} activates fat metabolism to prevent obesity. Cell 113:159–170[CrossRef][Medline]
  31. Picard F, Gehin M, Annicotte J, Rocchi S, Champy MF, O’Malley BW, Chambon P, Auwerx J 2002 SRC-1 and TIF2 control energy balance between white and brown adipose tissues. Cell 111:931–941[CrossRef][Medline]
  32. Meirhaeghe A, Crowley V, Lenaghan C, Lelliott C, Green K, Stewart A, Hart K, Schinner S, Sethi JK, Yeo G, Brand MD, Cortright RN, O’Rahilly S, Montague C, Vidal-Puig AJ 2003 Characterization of the human, mouse and rat PGC1 ß (peroxisome-proliferator-activated receptor-{gamma} co-activator 1 ß) gene in vitro and in vivo. Biochem J 373:155–165[CrossRef][Medline]
  33. Lin J, Wu PH, Tarr PT, Lindenberg KS, St-Pierre J, Zhang CY, Mootha VK, Jager S, Vianna CR, Reznick RM, Cui L, Manieri M, Donovan MX, Wu Z, Cooper MP, Fan MC, Rohas LM, Zavacki AM, Cinti S, Shulman GI, Lowell BB, Krainc D, Spiegelman BM 2004 Defects in adaptive energy metabolism with CNS-linked hyperactivity in PGC-1{alpha} null mice. Cell 119:121–135[CrossRef][Medline]
  34. Leone TC, Lehman JJ, Finck BN, Schaeffer PJ, Wende AR, Boudina S, Courtois M, Wozniak DF, Sambandam N, Bernal-Mizrachi C, Chen Z, Holloszy JO, Medeiros DM, Schmidt RE, Saffitz JE, Abel ED, Semenkovich CF, Kelly DP 2005 PGC-1{alpha} deficiency causes multi-system energy metabolic derangements: muscle dysfunction, abnormal weight control and hepatic steatosis. PLoS Biol 3:e101
  35. Vega RB, Huss JM, Kelly DP 2000 The coactivator PGC-1 cooperates with peroxisome proliferator-activated receptor {alpha} in transcriptional control of nuclear genes encoding mitochondrial fatty acid oxidation enzymes. Mol Cell Biol 20:1868–1876[Abstract/Free Full Text]
  36. Puigserver P, Wu Z, Park CW, Graves R, Wright M, Spiegelman BM 1998 A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92:829–839[CrossRef][Medline]
  37. Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V, Troy A, Cinti S, Lowell B, Scarpulla RC, Spiegelman BM 1999 Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 98:115–124[CrossRef][Medline]
  38. Tiraby C, Tavernier G, Lefort C, Larrouy D, Bouillaud F, Ricquier D, Langin D 2003 Acquirement of brown fat cell features by human white adipocytes. J Biol Chem 278:33370–33376[Abstract/Free Full Text]
  39. Guan HP, Ishizuka T, Chui PC, Lehrke M, Lazar MA 2005 Corepressors selectively control the transcriptional activity of PPAR{gamma} in adipocytes. Genes Dev 19:453–461[Abstract/Free Full Text]
  40. Treuter E, Albrektsen T, Johansson L, Leers J, Gustafsson JA 1998 A regulatory role for RIP140 in nuclear receptor activation. Mol Endocrinol 12:864–881[Abstract/Free Full Text]
  41. L’Horset F, Dauvois S, Heery DM, Cavailles V, Parker MG 1996 RIP-140 interacts with multiple nuclear receptors by means of two distinct sites. Mol Cell Biol 16:6029–6036[Abstract]
  42. Tazawa H, Osman W, Shoji Y, Treuter E, Gustafsson JA, Zilliacus J 2003 Regulation of subnuclear localization is associated with a mechanism for nuclear receptor corepression by RIP140. Mol Cell Biol 23:4187–4198[Abstract/Free Full Text]
  43. Jat PS, Noble MD, Ataliotis P, Tanaka Y, Yannoutsos N, Larsen L, Kioussis D 1991 Direct derivation of conditionally immortal cell lines from an H-2Kb-tsA58 transgenic mouse. Proc Natl Acad Sci USA 88:5096–5100[Abstract/Free Full Text]
  44. Shimizu M, Takeshita A, Tsukamoto T, Gonzalez FJ, Osumi T 2004 Tissue-selective, bidirectional regulation of PEX11 {alpha} and perilipin genes through a common peroxisome proliferator response element. Mol Cell Biol 24:1313–1323[Abstract/Free Full Text]
  45. Cannon B, Nedergaard J 2004 Brown adipose tissue: function and physiological significance. Physiol Rev 84:277–359[Abstract/Free Full Text]
  46. Schreiber SN, Emter R, Hock MB, Knutti D, Cardenas J, Podvinec M, Oakeley EJ, Kralli A 2004 The estrogen-related receptor {alpha} (ERR{alpha}) functions in PPAR{gamma} coactivator 1{alpha} (PGC-1{alpha})-induced mitochondrial biogenesis. Proc Natl Acad Sci USA 101:6472–6477[Abstract/Free Full Text]
  47. Villena JA, Hock MB, Chang WY, Barcas JE, Giguere V, Kralli A 2007 Orphan nuclear receptor estrogen-related receptor {alpha} is essential for adaptive thermogenesis. Proc Natl Acad Sci USA 104:1418–1423[Abstract/Free Full Text]
  48. White R, Leonardsson G, Rosewell I, Ann Jacobs M, Milligan S, Parker M 2000 The nuclear receptor co-repressor nrip1 (RIP140) is essential for female fertility. Nat Med 6:1368–1374[CrossRef][Medline]
  49. Soukas A, Socci ND, Saatkamp BD, Novelli S, Friedman JM 2001 Distinct transcriptional profiles of adipogenesis in vivo and in vitro. J Biol Chem 276:34167–34174[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   PPARα  |  PPARδ  |  PPARγ  |  ERRα
Coregulators:   RIP140  |  PGC-1  |  PGC-1β
Ligands:   GW 7647  |  GW6471  |  XCT790  |  Rosiglitazone



This article has been cited by other articles:


Home page
 Mol. Endocrinol.Home page
N. Kumar, D. Liu, H. Wang, J. Robidoux, and S. Collins
Orphan Nuclear Receptor NOR-1 Enhances 3',5'-Cyclic Adenosine 5'-Monophosphate-Dependent Uncoupling Protein-1 Gene Transcription
Mol. Endocrinol., May 1, 2008; 22(5): 1057 - 1064.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
H. Wang, Y. Zhang, E. Yehuda-Shnaidman, A. V. Medvedev, N. Kumar, K. W. Daniel, J. Robidoux, M. P. Czech, D. J. Mangelsdorf, and S. Collins
Liver X Receptor {alpha} Is a Transcriptional Repressor of the Uncoupling Protein 1 Gene and the Brown Fat Phenotype
Mol. Cell. Biol., April 1, 2008; 28(7): 2187 - 2200.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
D. L. Morganstein, M. Christian, J. J. O. Turner, M. G. Parker, and R. White
Conditionally immortalized white preadipocytes: a novel adipocyte model
J. Lipid Res., March 1, 2008; 49(3): 679 - 685.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
21/7/1581    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services