help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2007-0085
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
21/7/1593    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Johnson, K. R.
Right arrow Articles by Donahue, L. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johnson, K. R.
Right arrow Articles by Donahue, L. R.
Molecular Endocrinology 21 (7): 1593-1602
Copyright © 2007 by The Endocrine Society

Congenital Hypothyroidism, Dwarfism, and Hearing Impairment Caused by a Missense Mutation in the Mouse Dual Oxidase 2 Gene, Duox2

Kenneth R. Johnson, Coleen C. Marden, Patricia Ward-Bailey, Leona H. Gagnon, Roderick T. Bronson and Leah Rae Donahue

The Jackson Laboratory, Bar Harbor, Maine 04609

Address all correspondence and requests for reprints to: Kenneth R. Johnson, The Jackson Laboratory, 600 Main Street, Bar Harbor, Maine 04609. E-mail: ken.johnson{at}jax.org.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Dual oxidases generate the hydrogen peroxide needed by thyroid peroxidase for the incorporation of iodine into thyroglobulin, an essential step in thyroid hormone synthesis. Mutations in the human dual oxidase 2 gene, DUOX2, have been shown to underlie several cases of congenital hypothyroidism. We report here the first mouse Duox2 mutation, which provides a new genetic model for studying the specific function of DUOX2 in the thyroid gland and in other organ systems where it is hypothesized to play a role. We mapped the new spontaneous mouse mutation to chromosome 2 and identified it as a T>G base pair change in exon 16 of Duox2. The mutation changes a highly conserved valine to glycine at amino acid position 674 (V674G) and was named "thyroid dyshormonogenesis" (symbol thyd) to signify a defect in thyroid hormone synthesis. Thyroid glands of mutant mice are goitrous and contain few normal follicles, and anterior pituitaries are dysplastic. Serum T4 in homozygotes is about one-tenth the level of controls and is accompanied by a more than 100-fold increase in TSH. The weight of adult mutant mice is approximately half that of littermate controls, and serum IGF-I is reduced. The cochleae of mutant mice exhibit abnormalities characteristic of hypothyroidism, including a delayed formation of the inner sulcus and tunnel of Corti and an abnormally thickened tectorial membrane. Hearing thresholds of adult mutant mice are on average 50–60 decibels (dB) above those of controls.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
SPORADIC AND HERITABLE cases of hypothyroidism make up the most common class of congenital endocrine disorders. Widespread neonatal screening programs enable the detection of hypothyroidism, and thyroid hormone treatment during the critical postnatal period is an effective means for preventing or lessening the cognitive, motor, and hearing impairments that can result from thyroid hormone deficiencies. Congenital hypothyroidism can be classified into two major types according to where the abnormality resides. Primary (or thyroidal) hypothyroidism is caused by defective thyroid glands, and secondary (or central) hypothyroidism is caused by a lack of thyroid gland stimulation because of hypothalamus or pituitary gland dysfunction. Resistance to thyroid hormone, caused by defects in thyroid hormone receptors or reduced intracellular availability of activated thyroid hormone in peripheral tissues, can produce phenotypes similar to those caused by thyroid hormone deficiencies.

Most cases of congenital hypothyroidism are associated with abnormal differentiation, migration, or growth (dysgenesis) of the thyroid gland and occur sporadically. In 10–20% of cases, hypothyroidism is caused by heritable disorders of thyroid hormone synthesis (dyshormonogenesis) with associated goiter formation (1). Thyroid dyshormonogenesis has been shown to result from mutations in a number of different genes (2, 3), including thyroid stimulating hormone receptor (TSHR), sodium iodide symporter (SLC5A5 or NIS), thyroglobulin (TG), thyroid peroxidase (TPO), solute carrier family 26, member 4 (SLC26A4), and dual oxidase 2 (DUOX2). Mouse mutations have been reported in most of the orthologous genes, including Tshr (4, 5, 6), Tg (7, 8), Slc26a4 (9), and Tpo (10). Here, we report the first mouse mutation of the Duox2 gene.

The mouse Duox1 and Duox2 genes, like the orthologous human DUOX1 and DUOX2 genes (also known as thyroid oxidases, symbols THOX1 and THOX2), are highly expressed in the thyroid gland and encode cell surface glycoproteins that function as reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidases. They generate hydrogen peroxide (H202) at the apical membrane of thyroid follicular cells, which is required by thyroid peroxidase for the incorporation of iodine into thyroglobulin (iodide organification), an essential step in the synthesis of thyroid hormone (11, 12). Deactivating mutations of one of these genes, DUOX2, in human patients with congenital hypothyroidism have established its essential role in thyroid hormonogenesis (13, 14).

The mouse Duox2 mutation reported here occurred spontaneously at The Jackson Laboratory and was named "thyroid dyshormonogenesis," symbol thyd, to signify the characteristic defect of thyroid hormone synthesis. Mutant mice are congenitally hypothyroid with an associated dwarfing and hearing impairment. Thyroid hormone regulates many processes in mammalian development including body growth (15) and central nervous system maturation (16). Auditory function is particularly sensitive to the effects of thyroid hormone, which is required for the complex morphogenetic development of the cochlea (17, 18). The Duox2thyd mutant mice provide a new genetic model for studying the underlying molecular mechanisms and pathophysiology of congenital hypothyroidism.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Phenotype of thyd Mutant Mice
Mice homozygous for the recessive mutation thyd are proportionately smaller than their litter mates, and thus can be classified as ateliotic dwarfs (Fig. 1AGo). X-ray imaging confirmed that all bones of the skeleton are proportionately shorter in mutant mice than in controls (Fig. 1BGo). The growth plates appear normal, but the whole skeleton appears under-mineralized with thin bones and narrow cortex. At 8 wk of age, total body areal bone mineral density (aBMD), as assessed by dual-energy x-ray absorptiometry (DEXA) (PIXImus, GE Lunar, Madison, WI), is significantly reduced in mutants (0.0376 ± 0.0010 g/cm2, n = 11) compared with controls (0.0414 ± 0.0007 g/cm2, n = 8), with no sex difference in either genotype (Table 1Go). At 4 wk of age and older, the weight of mutant mice is about half that of age-matched control mice (Fig. 1CGo). The percent body fat at 8 wk of age assessed by DEXA is significantly less in mutants (13.9%, n = 11) than in controls (16.7%, n = 8), and no sex differences in either genotype were detected (Table 1Go). Concomitant with small size and low aBMD, circulating levels of IGF-I are lower in mutant mice than in controls. At 8 wk of age the average serum IGF-I level in mutant mice is 142.5 ± 6.5 ng/ml compared with 261.9 ± 31.7 ng/ml for controls; gender differences were not detected for either genotype (Table 1Go).


Figure 1
View larger version (90K):
[in this window]
[in a new window]

 
Fig. 1. The Dwarf Phenotype of Duox2thyd Mutant Mice

A, An 8-wk-old mutant mouse (thyd/thyd, shown on left) compared with its littermate control (+/thyd, shown on right). B, X-ray images of the mutant and control mice shown in panel A. C, Growth curve of male mutant mice (circles represent individual mice and solid line shows best fit) compared with that of male control mice (triangles represent individual mice and dotted line shows best fit).

 

View this table:
[in this window]
[in a new window]

 
Table 1. Whole Body aBMD, Percent Body Fat, and Serum IGF-I Is Reduced in Homozygous thyd Mutants Compared with Age- and Sex-Matched Controls at 8 wk of Age

 
Mutant mice have abnormal thyroid and pituitary glands. Thyroid glands of mutant mice are goitrous and contain few normal follicles (Fig. 2EGo). They have many highly proliferating epithelial cells, which give rise to bilateral thyroid adenomas or goiters (Fig. 2DGo). The posterior and intermediate lobes of the pituitary glands of mutant mice appear normal; however, the anterior pituitary is dysplastic, containing many large, abnormal cells (Fig. 2FGo). At 8 wk of age, serum T4 in mutant mice does not differ between sexes (females, 0.54 ± 0.06 µg/dl; males, 0.50 ± 0.08 µg/dl; n = 10 both sexes), but is approximately 10-fold lower than in controls (females, 5.98 ± 0.38 µg/dl; males, 4.69 ± 0.38 µg/dl; n = 10 each sex; Table 2Go). TSH levels in 8-wk-old thyd/thyd mutants do not differ between sexes (females, 32.72 ± 2.19 ng/ml, n = 10; males, 34.68 ± 2.05 ng/ml, n = 9), but are from 100- to 1000-fold higher than in sex-matched control mice (females, 0.019 ± 0.003 ng/ml, n = 12; males, 0.168 ± 0.054 ng/ml, n = 17; Table 2Go).


Figure 2
View larger version (90K):
[in this window]
[in a new window]

 
Fig. 2. Histopathology of Thyroid Glands and Anterior Pituitaries

Cross-sections of thyroid glands stained with H&E (A, B, D, and E) and anterior pituitary glands stained with periodic acid Schiff (C and F) from 8-wk-old +/thyd heterozygous controls (A–C) and thyd/thyd mutants (D–F). Thyroid glands of mutant mice (D and E) are highly dysplastic with few normal follicles and highly proliferating epithelial cells, which give rise to bilateral thyroid adenomas (goiters). Anterior pituitary glands of mutant mice (F) have many large, abnormal cells, some with multiple nuclei.

 

View this table:
[in this window]
[in a new window]

 
Table 2. Components of the Thyroid Hormone Pathway, Serum T4, and TSH Are Dramatically Different in Homozygous thyd Mutants Compared with Heterozygous Controls at 8 wk of Age, but Do Not Differ between Sexes within Genotypes

 
Mutant mice are hearing impaired. Auditory-evoked brainstem response (ABR) thresholds of mutant mice were on average 50–60 dB above those of controls for all auditory test stimuli (Fig. 3Go). The ABR thresholds of 14 mutant mice tested from 28–87 d of age did not vary significantly and so were combined for comparisons with nine normal hearing heterozygous controls. Cochleae of mutant mice appear to exhibit a delayed maturation. In the mutant cochlea at postnatal d 7 (P7) the epithelial cells that will form the inner sulcus of the organ of Corti are in a less developed columnar form and are still attached to a thickened tectorial membrane (Fig. 4BGo), compared with the smaller cuboidal epithelial cells of age-matched controls, which already have detached from the thinner tectorial membrane and formed the inner sulcus (Fig. 4AGo). At P14, the organ of Corti of control mice (Fig. 4CGo) has further differentiated and formed a distinct tunnel of Corti and space of Nuel, whereas its developmental stage in age-matched mutants (Fig. 4DGo) appears retarded and resembles that of control mice at P7. In 8-wk-old mutants (data not shown), many of the delayed developmental features have progressed to resemble the control organ of Corti; however, the tectorial membrane remains variably thickened.


Figure 3
View larger version (23K):
[in this window]
[in a new window]

 
Fig. 3. Hearing Impairment of Duox2thyd Mutant Mice

Average ABR thresholds (and SE bars) for broadband clicks and 8, 16, and 32 kHz pure tone stimuli in 14 thyd/thyd mutant mice tested at 28–87 d of age (dark bars) compared with normal ABR thresholds of nine age-matched +/thyd heterozygous control mice (light bars).

 

Figure 4
View larger version (102K):
[in this window]
[in a new window]

 
Fig. 4. Cochlear Pathology

Midmodiolar cross-sections through the basal turn of the cochlea showing the organ of Corti in +/thyd heterozygous control mice (A and C) and thyd/thyd mutants (B and D) at postnatal ages P7 (A and B) and P14 (C and D). In P7 mutants (B), the inner sulcus (IS) has not yet formed, and the inner sulcus epithelia (ISE) are still attached to a thickened tectorial membrane (TM). The developmental stage of the organ of Corti of mutants at P14 (D) resembles that of controls at P7 (A): epithelial cells have shortened and detached from the tectorial membrane forming the inner sulcus. At P14, the tunnel of Corti (TC), the fluid-filled space between inner and outer pillar cells (PC), and the space of Neul (SN), the space between the outer pillar cell and the first outer hair cell (OHC), are fully formed in controls (C) but only beginning to form in age-matched mutants (D). All scale bars, 50 µm.

 
Genetic Mapping and Candidate Gene Analyses
A linkage intercross was used to map the thyd mutation. F1 hybrids produced from matings of host females carrying transplanted mutant (thyd/thyd) ovaries with CAST/EiJ males were intercrossed, and 98 mutant F2 progeny (196 meioses) were analyzed for segregation of chromosomal markers and their associations with the dwarf phenotype. The thyd mutation showed linkage with chromosome 2 markers and mapped between D2Mit445 and D2Mit16 [National Center for Biotechnology Information (NCBI) build 36 positions 121.0 and 124.4 Mb, respectively; Fig. 5AGo). Two likely candidate genes were identified within this interval: dual oxidase 1 (Duox1 at 122.01–122.04 Mb position) and dual oxidase 2 (Duox2 at 121.97–122.0 Mb position). These genes are arranged head to head and transcribed on opposite strands of DNA (19); in the mouse they are separated by only 17.5 kb. The two genes both encode cell surface glycoproteins that are highly expressed in thyroid tissue and that probably function as NADPH oxidases to generate hydrogen peroxide, which is required by thyroperoxidase in the synthesis of thyroid hormone. Because of the coincident map positions and the functional link with hypothyroidism, we undertook a molecular analysis of the Duox1 and Duox2 genes.


Figure 5
View larger version (36K):
[in this window]
[in a new window]

 
Fig. 5. Mapping and Characterization of the thyd Mutation of Duox2

A, Genetic map of Chr 2 indicating Mb positions (NCBI m36) of genetic markers and the percent recombination between markers and the thyd mutation, as estimated from intercross linkage analysis of 98 mutant (dwarf) F2 mice. The mutation was mapped to a 3 Mb region on Chr 2, between markers D2Mit445 and D2Mit16. This interval contains the candidate genes Duox1 and Duox2. B, Diagram of the mouse Duox2 gene, which comprises 32 exons according to the most updated VEGA annotation (Release 22). The thyd mutation was found in exon 16. C, Sequence chromatographs of the Duox2 exon 16 region in DNA from mutant (thyd/thyd) and control (+/+) mice. A single base pair change from T to G was detected in all mutant chromosomes. D, Genotypes of thyd/thyd (lane 1), +/+ (lane 2), and +/thyd (lane 3) mice as determined by PCR amplification of genomic DNA and subsequent digestion with restriction enzyme HaeIII. E, The DUOX2 protein includes an N-terminal peroxidase region (blue), an intracellular loop containing two calcium EF-hand binding motifs, and a C-terminal NADPH oxidase region (purple) with six transmembrane domains. The exon16 T>G mutation changes a highly conserved valine to glycine at amino acid position 674 (V674G) in the intracellular loop, immediately following the first transmembrane helix.

 
For gene structure analyses we used the Vertebrate Genome Annotation (VEGA) database (http://vega.sanger.ac.uk/index.html), which is a central repository for high quality, frequently updated, manual annotation of vertebrate finished genome sequence. According to the most recent release (version 23), the mouse Duox1 gene (OTTMUSG00000015570) spans about 32 kb and comprises 33 exons that encode a 5267-bp transcript and a 1551-residue protein. The Duox2 gene (OTTMUSG00000015565) spans about 19 kb and comprises 32 exons that encode a 5744-bp transcript and a 1517-residue protein. We designed primers corresponding to intron sequences immediately flanking each of the exons of both genes (supplemental Table 1 published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). We first screened the individual PCR products for mutations by temperature gradient capillary electrophoresis. Mutant and control samples were combined for heteroduplex analysis and compared with the control samples. This analysis found no evidence for mutations in any of the 33 exons of Duox1 DNA that were examined, but did detect a putative mutation in the PCR-amplified product corresponding to exon 16 of Duox2, but not in any of the other 31 exons of this gene (Fig. 5BGo). We sequenced this PCR product in five homozygous mutants, five heterozygotes, and two wild-type controls and consistently found a single base pair change from T to G in all mutant chromosomes (Fig. 5CGo). The T>G change is a missense mutation, changing a highly conserved valine to a glycine at amino acid position 674 (V674G).

We developed a simple genotyping method to detect the thyd mutation of Duox2 (details described in Materials and Methods). PCR amplification of genomic DNA using primers designed to flank exon 16 produces a 303-bp PCR product in both wild-type and mutant DNA. This product is then digested with the restriction endonuclease HaeIII, which recognizes the 4-bp sequence GGCC. HaeIII digestion of the wild-type PCR product produces a fragment size of 226 bp (plus additional fragments smaller than 100 bp). Because the T>G thyd mutation creates a new GGCC cleavage site, HaeIII digestion of the mutant PCR product cleaves the 226-bp fragment into two unique fragments of 166 and 60 bp (Fig. 5DGo).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Our genetic mapping results narrowed the candidate region for the new mouse thyd mutation to less than 3.4 Mb, a region containing only two known genes with a predicted relationship to hypothyroidism. We eliminated one of these, Duox1, by mutation screening and identified a mutation in the other, Duox2. A biallelic T>G change in exon 16 of Duox2 was seen in all five mutant mice examined but not in seven nonmutant littermates. Because the thyd mutation arose spontaneously on a genetically homogeneous inbred strain background, any DNA sequence difference detected between mutant mice and their coisogenic littermate controls must be the result of an actual mutation event rather than a strain polymorphism. To further confirm causality of the Duox2 T>G mutation (thyd), we examined 50 additional mice by PCR genotyping (Fig. 5DGo) and found a perfect concordance of their phenotypes with their Duox2 genotypes (all 24 dwarf mice had thyd/thyd genotypes and all 26 normal mice were +/thyd).

The thyd mutation of Duox2 changes a valine to a glycine at position 674 (V674G) of the protein. Valine is a highly hydrophobic amino acid with a branched arrangement of three methyl groups as its side chain, whereas glycine is slightly polar with a single hydrogen atom as its side chain. A valine to glycine substitution can have a highly disruptive effect on protein function as demonstrated by the phenotype of mice with a V217G mutation of GATA-4, which die of cardiac defects during embryogenesis (20). The valine altered by the V674G mutation of mouse Duox2 is conserved across multiple mammalian species (Fig. 6Go), including rat (NP_077055), human (NP_054799), dog (AAF73924), and pig (NP_999164), and it is also conserved in the chicken (XP_425053). This high degree of amino acid conservation occurs presumably because of functional constraints on protein evolution. Comparative sequence analysis has been shown to be a robust method for predicting the degree of impairment of protein function by missense variants (21).


Figure 6
View larger version (31K):
[in this window]
[in a new window]

 
Fig. 6. Evolutionary Conservation of Mutated Valine Residue

Comparisons of the partial amino acid sequences of DUOX proteins from multiple species, showing evolutionary conservation of the valine residue (indicated by arrow) that is changed to glycine (V674G) by the mouse thyd mutation of Duox2. The species, protein, NCBI reference number (with beginning and ending amino acid positions in parentheses) are given for each sequence. The same alignments were obtained with both MultAlin (http://bioinfo.genopole-toulouse.prd.fr/multalin/) and ClustalW (http://www.ebi.ac.uk/clustalw/) programs. The valine residue of DUOX2 and the corresponding valine of the paralogous DUOX1 protein are highly conserved in diverse mammalian taxa, including mouse, rat, pig, dog, and human. The valine also is conserved in the orthologous DUOX gene of chicken.

 
The V674G mutation lies between the peroxidase and NADPH oxidase domains of the DUOX2 protein, in the cytoplasmic portion of the protein that follows the first transmembrane helix (Fig. 5EGo). There is some evidence that this region may be involved in endoplasmic reticulum (ER) retention and release (22). It is possible that the mutation alters an important recognition site for interaction with the DUOXA2 protein that recently was shown to be an ER-resident protein needed for DUOX2 maturation and translocation to the plasma membrane (23). A similar type of protein trafficking defect caused by a single amino acid change was shown to underlie the mouse congenital goiter (cog) mutation, which disrupts ER export of thyroglobulin (8). Further experiments are needed to precisely define the effect of the V674G mutation on DUOX2 function.

The phenotype of the thyd mouse mutation confirms the important role of DUOX2 in thyroid hormonogenesis. The dwarf size, thyroid gland pathology, and T4 and TSH hormone levels of Duox2thyd mutant mice are very similar to those reported for dwarf mice with a Tpo gene mutation (10). These phenotypic similarities suggest that DUOX2 is the primary generator of H202 needed by TPO in the synthesis of thyroid hormone, and that any compensatory contribution by DUOX1 is minimal. Human cases of congenital hypothyroidism have been associated only with inactivating mutations of DUOX2 and not of DUOX1 (13, 14), further supporting a primary role for DUOX2. Although both genes are expressed most highly in thyroid tissue, the mRNA abundance of DUOX2 is about 5 times greater than that of DUOX1, as determined by serial analysis of gene expression (24) and by Northern blot analysis (19).

Although they encode very similar proteins, the two DUOX genes have different promoters that initiate transcription on opposite strands of DNA (19). Thus, their differentially regulated expression could result in functionally distinct roles, not only in the thyroid but also in other tissues such as respiratory tract epithelium (25). The NADPH-oxidase (NOX) family of proteins, which includes DUOX1and DUOX2, appear to serve a variety of functions related to the production of reactive oxygen species (26). In addition to their role as peroxide generators for thyroid hormonogenesis, the dual oxidases have been proposed to function as part of the host defense response in salivary excretory ducts and rectal glands and on mucosal surfaces of tracheal and bronchial epithelial cells (27, 28).

The morphological abnormalities of the thyroid and pituitary glands and the abnormal circulating hormone levels (low T4, high TSH) of Duox2thyd mutant mice are characteristics of primary hypothyroidism caused by thyroid dyshormonogenesis. The lack of T4 feedback to the pituitary causes it to increase production of TSH, which consequently exerts a trophic effect on the thyroid glands of mutant mice causing them to increase in size (goiter formation). Thyroid hormones (both T3 and T4) participate in regulation of skeletal development, long bone growth, and accretion of bone mineral density (29). These effects are mediated, in part, by nuclear hormone receptors for thyroid hormone, but also by the GH/IGF-I axis (30). GH stimulates production of IGF-I that supports long bone growth and has anabolic effects on bone density. Because the GH gene has a thyroid hormone response element, this support for skeletal maturation is impaired in the absence of thyroid hormone (31). Thus, the small body size and low aBMD of thyd mutants is consistent with lack of thyroid hormone support.

The cochlear abnormalities we observed in Duox2thyd mutant mice, i.e. hearing impairment, delayed formation of the inner sulcus and tunnel of Corti, and abnormally thickened tectorial membrane, have been reported in other genetic models of congenital hypothyroidism or resistance to thyroid hormone, including mice with mutations in the TSH receptor gene Tshr (32, 33), the thyroid hormone receptor genes Thra and Thrb (34, 35), the deiodinase gene Dio2 (36), which is important for boosting levels of biologically active thyroid hormone in the cochlea, and the Pax8 transcription factor (37), which is critical for thyroid gland development. The degree of hearing impairment observed in Duox2thyd mutant mice (a threshold shift of ~ 55 dB) is similar to the hearing loss exhibited by mutant mice lacking outer hair cell electromotility (38). Outer hair cells amplify auditory stimuli by electromechanical feedback and appear to be the cochlear structures most susceptible to the effects of hypothyroidism (33). Thyroid hormone has been shown to regulate the expression of genes important to outer hair cell function, including Tectb, the gene encoding an important structural component of the tectorial membrane in which the stereocilia of outer hair cells are embedded (39), Slc26a5, the gene encoding the outer hair cell motor protein prestin (40), and Kcnq4, the gene encoding an outer hair cell potassium channel protein (41).

The Duox2thyd mutation provides a new heritable mouse model for studies of primary congenital hypothyroidism. It does not require the use of potentially toxic drugs as do chemically induced models of hypothyroidism, and it can be manipulated by thyroid hormone replacement, which is not possible with models that are resistant to thyroid hormone (such as Thra, Thrb, and Dio2 mutations). Duox2thyd mutant mice will be valuable for investigating the underlying molecular mechanisms and pathophysiologies of organ systems affected by thyroid hormone deficiency and for discerning the specific functions of DUOX2 and DUOX1 in the thyroid gland and in other tissues where they are hypothesized to play important roles in the regulated production of hydrogen peroxide.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Experimental Animals
All animal experimentation described in this manuscript was conducted in accord with accepted standards of humane animal care. All mice were obtained from the Jackson Laboratory, and all procedures involving their use were approved by the Institutional Animal Care and Use Committee.

Mice and Genetic Mapping
The new, recessive thyd mutation arose spontaneously in a B6.129-Tnfrsf1atm1Mak/J congenic strain of mice (Jackson Laboratory Stock no. 002818). The Tnfrsf1atm1Ma mutation was subsequently removed from the colony, and the thyd mutation is now maintained on an essentially pure C57BL/6J background, hence the new strain designation is B6(129)-Duox2thyd/J (Jackson Laboratory Stock no. 005543). Mutant mice do not breed, and the strain originally was maintained by thyd/thyd ovary transplants and matings with C57BL/6J males to produce obligate heterozygotes, which then were interbred to produce new mutant mice. Molecular genotyping (Fig. 5DGo) now allows direct identification of heterozygotes for simplified colony maintenance.

To map the new mutation, we transferred ovaries from homozygous mutant females to host females and mated these with CAST/EiJ males. The resulting F1 hybrids were intercrossed, and 98 mutant (dwarf) F2 progeny were analyzed (196 meioses) for linkage by their associations with microsatellite DNA markers typed by PCR. PCRs comprised 75 ng genomic DNA in 25 µl containing 500 mM KCl, 100 MM Tris-HCl (pH 8.3 at 25 C), and 0.01% Tritin-X-100, 15 mM Mg(OAc)2, 100 nM of each primer (forward and reverse), 0.2 mM of each of four deoxyribonucleoside triphosphates, and 0.5 U of Taq DNA polymerase (MasterTaq Kit from Eppendorf, catalog no. 954140091; QIAGEN, Valencia, CA). PCR was run in an MJ Research Peltier Thermal Cycler (Bio-Rad Laboratories, Hercules, CA). Amplification consisted of one cycle of denaturation at 97 C for 30 sec followed by 40 cycles, each consisting of 94 C for 30 sec (denaturation), 58 C for 30 sec (annealing), and 72 C for 30+1 sec (extension). After the 40 cycles, the final product was extended for 10 min at 72 C. PCR products were visualized on 2.5% NuSieve gels.

Mutation Screening and DNA Sequencing
PCR for comparative DNA analysis between mutant (thyd/thyd) and control (+/+) mice was performed in the same manner as described above for microsatellite DNA typing. Genomic PCR products were purified using the MinElute PCR purification kit (QIAGEN; catalog no. 28004). The PCR-amplified products of mutant and control DNA samples were combined for heteroduplex analysis and compared with the control samples. We used the Reveal Mutation Detection System (SpectruMedix, State College, PA) to screen for mutations by temperature gradient capillary electrophoresis. DNA sequencing of PCR products was performed using the same primers used for DNA amplification, and then run on an 3700 DNA sequencer (Applied Biosystems, Foster City, CA) with an optimized Big Dye Terminator Cycle Sequencing method.

Genotyping Mice for the Duox2 Mutation
PCR primers flanking exon 16, which includes the thyd mutation, were used to amplify a 303-bp product from genomic DNA, using the previously described PCR method with forward primer (5'-3') GAATCACATGGGCTCAAAGG and reverse primer (5'-3') ATGAAAACAGCCCACAGAGG. The PCR products were then digested from 4 h to overnight at 37 C with 0.8 µl of HaeIII restriction enzyme (New England Biolabs, Beverly, MA). After a 20-min incubation at 80 C to inactivate HaeIII, the digested PCR products were electrophoresed on a 2.5% NuSieve gel (Cambrex Bio Science, Rockland, ME).

Blood Chemistry: T4, TSH, and IGF-I Levels
T4 was measured on a Beckman SYNCHRON CX5 DELTA photometric chemistry analyzer (Beckman Coulter, Inc., Brea, CA) with the SYNCHRON CX System, the associated T4 reagent (T4 Kit, Beckman Coulter, Inc.), and the SYNCHRON T4 Calibrator. This system allows automated measurements of T4. TSH was measured in the laboratory of Dr. Roy E. Weiss using a RIA developed and previously described by them (42).

Serum IGF-I was measured by an RIA (ALPCO, Windham, NH). IGF binding proteins, were first removed from IGF-I by an acid dissociation step. This was followed by the addition of a neutralization buffer containing excess recombinant human IGF-II, allowing the IGF-II to bind to the IGF binding proteins before immunoassay with a human anti-IGF-I polyclonal antibody. The sensitivity of the assay was 10 ng/ml IGF-I; the interassay coefficient of variation based on normal standards and pooled serum of C3H/HeJ and C57BL/6J was approximately 6%. There was no cross-reactivity with IGF-II. Standards were run in each assay as well as normal pools from both progenitors.

For serum preparation, trunk blood was collected from mutant and control mice by decapitation, whole blood was chilled on ice for 30 min and then spun at 10,000 rpm for 10 min in a benchtop centrifuge. Values are reported as mean ± SEM.

X-Ray Imaging
Images were obtained using a Faxitron MX20 cabinet x-ray apparatus (Faxitron X-Ray Corp., Wheeling, IL) with x1–5 magnification capabilities. Kodak Min-R 2000 mammography film (Eastman Kodak Co., Windsor, CO) was used for maximum resolution. X-ray films were scanned at 800 pixels/inch to produce high-resolution digital images.

DEXAs of aBMD and Percent Body Fat
Data were collected using the PIXImus small animal DEXA system (GE Lunar), software version 1.43.036.008. The PIXImus has been reconfigured with lower x-ray energy than in human DEXA machines to achieve contrast in small specimens. The resolution of the PIXImus is 0.18 x 0.18 mm pixels with a usable scanning area of 80 x 65 mm, allowing for measurement of single whole mice and collections of isolated specimens. The PIXImus has been calibrated with a phantom utilizing known values, and a quality assessment is performed daily with this same phantom. Assessment of accuracy for the PIXImus was done with a set of hydroxyapatite standards (0–2000 mg), yielding a correlation of 0.999 between standards and PIXImus measurement of mineral. The precision for aBMD is excellent, less than 1% for whole body, and approximately 1.5% for specialized regions. Correlation with peripheral quantitative computerized tomography values for 614 isolated spinal vertebrae is significant (P < 0.001; r = 0.704). These data were acquired from euthanized mice.

Histology
Histological sections were prepared in the following manner. Mice were anesthetized and perfused through the left ventricle of the heart with PBS, followed by Bouin’s fixative. Thyroid and pituitary glands were dissected out of the body, fixed in Bouin’s for 7 d, and embedded in paraffin. Sections were cut (6 µm thick) and mounted on glass slides. Thyroid tissue was counterstained with hematoxylin and eosin (H&E), and pituitary tissue was counterstained with periodic acid-Schiff. Cross-sections of cochleae were obtained in a similar manner. After the perfusion, inner ears were dissected out of the skull, immersed in Bouin’s fixative for 7 d (P7–P14) or 14 d (adult), and embedded in paraffin. Serial, midmodiolar cross-sections were cut 4 µm thick, mounted on glass slides, and counterstained with H&E. All slides were examined on an Olympus Optical (Tokyo, Japan) BX40 light microscope, and digital images were captured with the Olympus Optical DP70 camera.

Assessment of Hearing
Mutant and age-matched control mice were assessed for hearing by auditory-evoked brainstem response (ABR) thresholds with equipment from Intelligent Hearing Systems (IHS, Miami, FL) using previously described methods and equipment (43). Briefly, subdermal needle electrodes are inserted at the vertex and ventrolaterally to both ears of anesthetized mice. Specific auditory stimuli (clicks, and 8-, 16-, and 32-kHz tone-bursts) from high-frequency transducers are channeled through plastic tubes into the ear canals. Evoked brainstem responses are amplified and averaged and their wave patterns displayed on a computer screen. Auditory thresholds are obtained for each stimulus by varying the sound pressure level to identify the lowest level at which an ABR pattern can be recognized.


    ACKNOWLEDGMENTS
 
We thank the following colleagues at The Jackson Laboratory: Wesley Beamer, Gregory Cox, and James Willott for providing helpful comments on the manuscript; Heping Yu and Chantal Longo-Guess for performing ABR measurements on mutant and control mice; Sandra Gray for mouse ear dissections; Melanie Atherton for the initial discovery of the mutant mice; and Susan Grindle, who operates the Clinical Chemistry Laboratory, for providing T4 values. We express sincere thanks to Dr. Roy Weiss and his laboratory at the University of Chicago for measuring TSH in thyd mutants and controls and for providing data for this paper.


    FOOTNOTES
 
This work was supported by National Institutes of Health Grants RR01183, DC04301, and CA34196.

Disclosure Statement: The authors have nothing to disclose.

First Published Online April 17, 2007

Abbreviations: aBMD, Areal bone mineral density; ABR, auditory-evoked brainstem response; DEXA, dual-energy x-ray absorptiometry; ER, endoplasmic reticulum; H&E, hematoxylin and eosin; NADPH, reduced nicotinamide adenine dinucleotide phosphate.

Received for publication February 15, 2007. Accepted for publication April 10, 2007.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Van Vliet G 2003 Development of the thyroid gland: lessons from congenitally hypothyroid mice and men. Clin Genet 63:445–455[CrossRef][Medline]
  2. Moreno JC, de Vijlder JJ, Vulsma T, Ris-Stalpers C 2003 Genetic basis of hypothyroidism: recent advances, gaps and strategies for future research. Trends Endocrinol Metab 14:318–326[CrossRef][Medline]
  3. Park SM, Chatterjee VK 2005 Genetics of congenital hypothyroidism. J Med Genet 42:379–389[Abstract/Free Full Text]
  4. Beamer WJ, Eicher EM, Maltais LJ, Southard JL 1981 Inherited primary hypothyroidism in mice. Science 212:61–63[Abstract/Free Full Text]
  5. Stein SA, Oates EL, Hall CR, Grumbles RM, Fernandez LM, Taylor NA, Puett D, Jin S 1994 Identification of a point mutation in the thyrotropin receptor of the hyt/hyt hypothyroid mouse. Mol Endocrinol 8:129–138[Abstract]
  6. Marians RC, Ng L, Blair HC, Unger P, Graves PN, Davies TF 2002 Defining thyrotropin-dependent and -independent steps of thyroid hormone synthesis by using thyrotropin receptor-null mice. Proc Natl Acad Sci USA 99:15776–15781[Abstract/Free Full Text]
  7. Beamer WG, Maltais LJ, DeBaets MH, Eicher EM 1987 Inherited congenital goiter in mice. Endocrinology 120:838–840[Abstract]
  8. Kim PS, Hossain SA, Park YN, Lee I, Yoo SE, Arvan P 1998 A single amino acid change in the acetylcholinesterase-like domain of thyroglobulin causes congenital goiter with hypothyroidism in the cog/cog mouse: a model of human endoplasmic reticulum storage diseases. Proc Natl Acad Sci USA 95:9909–9913[Abstract/Free Full Text]
  9. Everett LA, Belyantseva IA, Noben-Trauth K, Cantos R, Chen A, Thakkar SI, Hoogstraten-Miller SL, Kachar B, Wu DK, Green ED 2001 Targeted disruption of mouse Pds provides insight about the inner-ear defects encountered in Pendred syndrome. Hum Mol Genet 10:153–161[Abstract/Free Full Text]
  10. Takabayashi S, Umeki K, Yamamoto E, Suzuki T, Okayama A, Katoh H 2006 A novel hypothyroid dwarfism due to the missense mutation Arg479Cys of the thyroid peroxidase gene in the mouse. Mol Endocrinol 20:2584–2590[Abstract/Free Full Text]
  11. Dupuy C, Ohayon R, Valent A, Noel-Hudson MS, Deme D, Virion A 1999 Purification of a novel flavoprotein involved in the thyroid NADPH oxidase. Cloning of the porcine and human cDNAs. J Biol Chem 274:37265–37269[Abstract/Free Full Text]
  12. De Deken X, Wang D, Many MC, Costagliola S, Libert F, Vassart G, Dumont JE, Miot F 2000 Cloning of two human thyroid cDNAs encoding new members of the NADPH oxidase family. J Biol Chem 275:23227–23233[Abstract/Free Full Text]
  13. Moreno JC, Bikker H, Kempers MJ, van Trotsenburg AS, Baas F, de Vijlder JJ, Vulsma T, Ris-Stalpers C 2002 Inactivating mutations in the gene for thyroid oxidase 2 (THOX2) and congenital hypothyroidism. N Engl J Med 347:95–102[Abstract/Free Full Text]
  14. Vigone MC, Fugazzola L, Zamproni I, Passoni A, Di Candia S, Chiumello G, Persani L, Weber G 2005 Persistent mild hypothyroidism associated with novel sequence variants of the DUOX2 gene in two siblings. Hum Mutat 26:395[Medline]
  15. Cabello G, Wrutniak C 1989 Thyroid hormone and growth: relationships with growth hormone effects and regulation. Reprod Nutr Dev 29:387–402[Medline]
  16. Bernal J 2005 Thyroid hormones and brain development. Vitam Horm 71:95–122[CrossRef][Medline]
  17. Deol MS 1973 Congenital deafness and hypothyroidism. Lancet 2:105–106[Medline]
  18. Uziel A 1986 Periods of sensitivity to thyroid hormone during the development of the organ of Corti. Acta Otolaryngol Suppl 429:23–27[Medline]
  19. Pachucki J, Wang D, Christophe D, Miot F 2004 Structural and functional characterization of the two human ThOX/Duox genes and their 5'-flanking regions. Mol Cell Endocrinol 214:53–62[CrossRef][Medline]
  20. Crispino JD, Lodish MB, Thurberg BL, Litovsky SH, Collins T, Molkentin JD, Orkin SH 2001 Proper coronary vascular development and heart morphogenesis depend on interaction of GATA-4 with FOG cofactors. Genes Dev 15:839–844[Abstract/Free Full Text]
  21. Stone EA, Sidow A 2005 Physicochemical constraint violation by missense substitutions mediates impairment of protein function and disease severity. Genome Res 15:978–986[Abstract/Free Full Text]
  22. Morand S, Agnandji D, Noel-Hudson MS, Nicolas V, Buisson S, Macon-Lemaitre L, Gnidehou S, Kaniewski J, Ohayon R, Virion A, Dupuy C 2004 Targeting of the dual oxidase 2 N-terminal region to the plasma membrane. J Biol Chem 279:30244–30251[Abstract/Free Full Text]
  23. Grasberger H, Refetoff S 2006 Identification of the maturation factor for dual oxidase. Evolution of an eukaryotic operon equivalent. J Biol Chem 281:18269–18272[Abstract/Free Full Text]
  24. Moreno JC, Pauws E, van Kampen AH, Jedlickova M, de Vijlder JJ, Ris-Stalpers C 2001 Cloning of tissue-specific genes using serial analysis of gene expression and a novel computational substraction approach. Genomics 75:70–76[CrossRef][Medline]
  25. Harper RW, Xu C, Eiserich JP, Chen Y, Kao CY, Thai P, Setiadi H, Wu R 2005 Differential regulation of dual NADPH oxidases/peroxidases, Duox1 and Duox2, by Th1 and Th2 cytokines in respiratory tract epithelium. FEBS Lett 579:4911–4917[CrossRef][Medline]
  26. Bedard K, Krause KH 2007 The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiol Rev 87:245–313[Abstract/Free Full Text]
  27. Geiszt M, Witta J, Baffi J, Lekstrom K, Leto TL 2003 Dual oxidases represent novel hydrogen peroxide sources supporting mucosal surface host defense. FASEB J 17:1502–1504[Abstract/Free Full Text]
  28. Leto TL, Geiszt M 2006 Role of Nox family NADPH oxidases in host defense. Antioxid Redox Signal 8:1549–1561[CrossRef][Medline]
  29. Rivkees SA, Bode HH, Crawford JD 1988 Long-term growth in juvenile acquired hypothyroidism: the failure to achieve normal adult stature. N Engl J Med 318:599–602[Abstract]
  30. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  31. Sap J, de Magistris L, Stunnenberg H, Vennstrom B 1990 A major thyroid hormone response element in the third intron of the rat growth hormone gene. EMBO J 9:887–896[Medline]
  32. O’Malley Jr BW, Li D, Turner DS 1995 Hearing loss and cochlear abnormalities in the congenital hypothyroid (hyt/hyt) mouse. Hear Res 88:181–189[CrossRef][Medline]
  33. Li D, Henley CM, O’Malley Jr BW 1999 Distortion product otoacoustic emissions and outer hair cell defects in the hyt/hyt mutant mouse. Hear Res 138:65–72[CrossRef][Medline]
  34. Griffith AJ, Szymko YM, Kaneshige M, Quinonez RE, Kaneshige K, Heintz KA, Mastroianni MA, Kelley MW, Cheng SY 2002 Knock-in mouse model for resistance to thyroid hormone (RTH): an RTH mutation in the thyroid hormone receptor beta gene disrupts cochlear morphogenesis. J Assoc Res Otolaryngol 3:279–288[CrossRef][Medline]
  35. Rusch A, Ng L, Goodyear R, Oliver D, Lisoukov I, Vennstrom B, Richardson G, Kelley MW, Forrest D 2001 Retardation of cochlear maturation and impaired hair cell function caused by deletion of all known thyroid hormone receptors. J Neurosci 21:9792–9800[Abstract/Free Full Text]
  36. Ng L, Goodyear RJ, Woods CA, Schneider MJ, Diamond E, Richardson GP, Kelley MW, Germain DL, Galton VA, Forrest D 2004 Hearing loss and retarded cochlear development in mice lacking type 2 iodothyronine deiodinase. Proc Natl Acad Sci USA 101:3474–3479[Abstract/Free Full Text]
  37. Christ S, Biebel UW, Hoidis S, Friedrichsen S, Bauer K, Smolders JW 2004 Hearing loss in athyroid pax8 knockout mice and effects of thyroxine substitution. Audiol Neurootol 9:88–106[CrossRef][Medline]
  38. Liberman MC, Gao J, He DZ, Wu X, Jia S, Zuo J 2002 Prestin is required for electromotility of the outer hair cell and for the cochlear amplifier. Nature 419:300–304[CrossRef][Medline]
  39. Knipper M, Richardson G, Mack A, Muller M, Goodyear R, Limberger A, Rohbock K, Kopschall I, Zenner HP, Zimmermann U 2001 Thyroid hormone-deficient period prior to the onset of hearing is associated with reduced levels of ß-tectorin protein in the tectorial membrane. Implication for hearing loss. J Biol Chem 276:39046–39052[Abstract/Free Full Text]
  40. Weber T, Zimmermann U, Winter H, Mack A, Kopschall I, Rohbock K, Zenner HP, Knipper M 2002 Thyroid hormone is a critical determinant for the regulation of the cochlear motor protein prestin. Proc Natl Acad Sci USA 99:2901–2906[Abstract/Free Full Text]
  41. Winter H, Braig C, Zimmermann U, Geisler HS, Franzer JT, Weber T, Ley M, Engel J, Knirsch M, Bauer K, Christ S, Walsh EJ, McGee J, Kopschall I, Rohbock K, Knipper M 2006 Thyroid hormone receptors TR{alpha}1 and TRß differentially regulate gene expression of Kcnq4 and prestin during final differentiation of outer hair cells. J Cell Sci 119:2975–2984[Abstract/Free Full Text]
  42. Weiss RE, Forrest D, Pohlenz J, Cua K, Curran T, Refetoff S 1997 Thyrotropin regulation by thyroid hormone in thyroid hormone receptor ß-deficient mice. Endocrinology 138:3624–3629[Abstract/Free Full Text]
  43. Zheng QY, Johnson KR, Erway LC 1999 Assessment of hearing in 80 inbred strains of mice by ABR threshold analyses. Hear Res 130:94–107[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
I. Zamproni, H. Grasberger, F. Cortinovis, M. C. Vigone, G. Chiumello, S. Mora, K. Onigata, L. Fugazzola, S. Refetoff, L. Persani, et al.
Biallelic Inactivation of the Dual Oxidase Maturation Factor 2 (DUOXA2) Gene as a Novel Cause of Congenital Hypothyroidism
J. Clin. Endocrinol. Metab., February 1, 2008; 93(2): 605 - 610.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
21/7/1593    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Johnson, K. R.
Right arrow Articles by Donahue, L. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johnson, K. R.
Right arrow Articles by Donahue, L. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals