help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2007-0072
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yan, J.
Right arrow Articles by Ye, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yan, J.
Right arrow Articles by Ye, J.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Compound via MeSH
*Substance via MeSH
Molecular Endocrinology 21 (7): 1630-1641
Copyright © 2007 by The Endocrine Society

Nuclear Corepressor Is Required for Inhibition of Phosphoenolpyruvate Carboxykinase Expression by Tumor Necrosis Factor-{alpha}

Jinhua Yan, Zhanguo Gao, Gang Yu, Qing He, Jianping Weng and Jianping Ye

Department of Endocrinology (J.Ya., J.W.), The First-Affiliated Hospital, Sun Yat-Sen University, Guangzhou 510080, China; and Pennington Biomedical Research Center (Z.G., G.Y., Q.H., J.Ye), Louisiana State University System, Baton Rouge, Louisiana 70808

Address all correspondence and reprint requests to either: J. Weng, Department of Endocrinology, The First-Affiliated Hospital, Sun Yat-Sen University, Guangzhou 510080, China. E-mail: wjianp{at}mail.sysu.edu.cn; or J. Ye, Pennington Biomedical Research Center, 6400 Perkins Road, Baton Rouge, Louisiana 70808. E-mail: yej{at}pbrc.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Inhibition of phosphoenolpyruvate carboxykinase (PEPCK) by TNF-{alpha} contributes to the pathogenesis of hypoglycemia in endotoxin shock. In this study, the molecular mechanism underlying the inhibition was investigated in hepatoma cells (rat H4IIE and human HepG2). PEPCK expression was induced by cAMP, and the induction was reduced by TNF-{alpha} at protein and mRNA levels in H4IIE cells. The inhibition was observed in the PEPCK gene promoter in a PEPCK-luciferase reporter. Activation of nuclear factor {kappa}B (NF-{kappa}B) pathway was required for the transcriptional inhibition of PEPCK gene. Degradation of NF-{kappa}B inhibitor (I{kappa}B) and p65 nuclear translocation were involved in the inhibition. An interaction of histone deacetylase 3 (HDAC3) and silencing mediator for retinoic acid receptor and thyroid hormone receptor (SMRT) with the PEPCK gene promoter was induced by TNF-{alpha} and observed in a chromatin immunoprecipitation assay. The TNF-induced inhibition was blocked by HDAC inhibitor or HDAC3 knockdown. The blocking effect was also observed in knockdown of corepressor SMRT. Point mutation suggests that cAMP response element (CRE) is required for TNF-induced inhibition of the PEPCK gene promoter. Phosphorylation of cAMP response element-binding protein at Ser133 and expression of peroxisome proliferator-activated receptor-{gamma} coactivator 1{alpha} were not changed by TNF-{alpha} in H4IIE cells. The transcriptional activity of CRE-binding protein was inhibited by TNF-{alpha} in a CRE-luciferase reporter. The data suggests that the nuclear corepressor proteins of HDAC3 and SMRT mediate TNF inhibition of PEPCK transcription. The inhibition mechanism is related to activation of NF-{kappa}B and inhibition of CRE-binding protein activity by the corepressor. These data suggest a novel activity of nuclear corepressor in the regulation of PEPCK expression by TNF-{alpha}.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
GLUCONEOGENESIS IS IMPORTANT in mammalians for prevention of hypoglycemia in stress conditions, such as starvation and infection (1, 2). A failure in gluconeogenesis leads to hypoglycemic shock that is often seen in septic (or endotoxin) shock. Liver is the most important organ in gluconeogenesis, and it maintains blood glucose level in fasting condition by production of glucose from amino acids (3). The hepatic gluconeogenesis and glucose production are mainly controlled by two critical enzymes: phosphoenolpyruvate carboxykinase (PEPCK) and glucose 6 phosphatase (G6Pase). The cytosolic form of phosphoenolpyruvate carboxykinase is encoded by a single copy gene that is highly expressed in the liver, kidney cortex, and adipose tissues (both white and brown) (4). In response to various dietary, hormonal, and environmental stimuli, the activity of the cytosolic form of PEPCK is acutely regulated by gene transcription. Knockout of PEPCK gene in mice led to severe hypoglycemia (5). This is associated with an increase in amino acids in the plasma of PEPCK–/– mice. PEPCK is also required for reesterification of free fatty acids into triglycerides (TGs) (6). Expression of PEPCK and G6Pase is inhibited by proinflammation cytokines (1, 2, 7, 8), such as TNF-{alpha} (7), IL-1 (9), and IL-6 (10). The inhibition occurs at transcriptional level for PEPCK and G6pase (7, 8) and contributes to hypoglycemia in conditions including septic shock (1, 2).

PEPCK expression is regulated by many hormones, and the major hormone axis is formed by glucagon and insulin (4, 11). Many transcription factors are involved in the transcriptional regulation of PEPCK by glucagons and insulin (12, 13). These include cAMP response element (CRE)-binding protein (CREB), CCAAT/enhancer-binding protein {alpha} and ß, glucocorticoid receptor, forkhead transcription factor O1, sterol regulatory element-binding protein, hepatocyte nuclear factor-4, peroxisome proliferator-activated receptor {gamma}, activating transcription factor 3, and activator protein 1 (AP1) (Fos/Jun heterodimer). Among these nuclear factors, CREB is required for the up-regulation of PEPCK by glucagons, which activates CREB through protein kinase A-mediated phosphorylation of Ser133 in the CREB protein. For transcriptional initiation, CREB interacts with several coactivators, such as peroxisome proliferator-activated receptor-{gamma} coactivator 1{alpha} (PGC-1) (14), steroid receptor coactivator 1, CREB-binding protein (CBP) (12), and transducer of regulated CREB activity 2 (15, 16, 17). In the PEPCK gene promoter, the coactivator PGC-1 also interacts with forkhead transcription factor O1 and hepatocyte nuclear factor-4 for the transcriptional initiation of PEPCK gene (18). Although the coactivators have been well established, the corepressor for CREB remains to be identified and characterized.

TNF-{alpha} induces variety of pathological changes through activation of inhibitor of NF-{kappa}B (I{kappa}B) kinase (IKK)/nuclear factor-{kappa}B (NF-{kappa}B) and c-Jun N-terminal protein kinase (JNK)/AP1 signaling pathways (19, 20). NF-{kappa}B p65 was shown to inhibit PEPCK transcription induced by glucocorticoid or cAMP (21). p65-CBP interaction was proposed to mediate the PEPCK inhibition by TNF-{alpha}. However, it is not clear whether nuclear corepressor is involved in the PEPCK inhibition by TNF-{alpha}. The nuclear corepressor (corepressor in the following text) contains two major subunits. One is histone deacetylase (HDAC) that catalyzes removal of acetyl group from the substrate proteins, such as histone proteins (22, 23). The other is HDAC activators, such as silencing mediator for retinoic acid receptor and thyroid hormone receptor (SMRT) and nuclear receptor corepressor (N-CoR), whose presence is required for activation of the catalytic activity of HDAC (24).

In the present study, we examined the molecular mechanism of PEPCK inhibition by TNF-{alpha}. We demonstrated that the activation of IKK/NF-{kappa}B was essential for the suppression of PEPCK gene transcription, and the corepressor proteins of HDAC3 and SMRT were involved in the TNF-induced inhibition of PEPCK. Inhibition of the transcriptional activity of CREB by the corepressor was suggested by this study.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
TNF-{alpha} Inhibits cAMP-Mediated PEPCK Expression
It was reported that PEPCK transcription was inhibited in hepatocytes by TNF-{alpha} in vivo and in vitro (2, 7). In this study, the TNF-induced PEPCK inhibition was investigated in H4IIE (rat hepatoma) cells, in which the PEPCK mRNA was induced by cAMP and examined by quantitative (q) RT-PCR. Expression of PEPCK was induced by cAMP in a time-dependent manner in the first 4 h of treatment (Fig. 1AGo). A peak in the mRNA signal was observed at 4 h of cAMP treatment, and the peak was maintained at least for an additional 2 h. In the presence of TNF-{alpha}, the PEPCK expression was significantly decreased (Fig. 1BGo). The inhibition was observed as early as 0.5 h of TNF treatment. Consistently, the PEPCK protein was induced by cAMP and the induction was decreased by TNF-{alpha} (Fig. 1Go, C and D). These data confirm that PEPCK expression is inhibited by TNF-{alpha} in hepatocytes.


Figure 1
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 1. Inhibition of PEPCK Expression by TNF-{alpha} in H4IIE Cells

A, Time-dependent induction of PEPCK mRNA expression by cAMP. The cells were serum starved in DMEM supplemented with 0.25% BSA overnight and treated with cAMP (200 µM) for different times as indicated. The total RNA was extracted and subjected to qRT-PCR analysis for PEPCK mRNA. This induction condition for PEPCK was used in all of the experiments in this study. B, Inhibition of PEPCK mRNA expression by TNF-{alpha}. To inhibit PEPCK expression, TNF-{alpha} (20 ng/ml) was added together with cAMP for different time as indicated. C, Inhibition of PEPCK protein expression by TNF-{alpha}. The cells were treated with cAMP (200 µM) in the presence of TNF-{alpha} (20 ng/ml) for 6 h. The PEPCK protein was determined in the whole-cell lysate in a Western blot with anti-PEPCK antibody. D, Quantification of PEPCK protein in the Western blot. The PEPCK protein signal was determined by densitometry and normalized with actin protein level. In this figure, each bar represents mean ± SEM (n = 3). *, P < 0.05.

 
IKK/NF-{kappa}B Pathway Mediates TNF Activity
Several signaling pathways were activated by TNF-{alpha}, such as IKK/NF-{kappa}B pathway and MAPKs (ERK, JNK, and p38) pathways. To determine which pathway is required for the TNF inhibition of PEPCK, kinase-specific chemical inhibitors were used to evaluate each pathway. These inhibitors include aspirin (NF-{kappa}B), SP600125 (anthra[1,9-cd]pyrazol-6(2H)-one) (JNK), SB203580 [4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)-1H-imidazole] (p38 MAPK kinase), PD98059 [2-(2-amino-3-methyoxyphenyl)-4H-1-benzopyran-4-one] (MEK/ERK), and LY294002 [2-(4-morpholinyl)-8-phenyl-1(4H)-benzopyran-4-one] (phosphatidylinositol 3-kinase). The H4IIE cells were pretreated with the inhibitors before TNF exposure. The inhibitor activity was determined with the PEPCK mRNA. Two inhibitors, aspirin and LY294002, which are known to block NF-{kappa}B activation by TNF-{alpha}, were able to block the PEPCK suppression by TNF-{alpha} (Fig. 2AGo). Phosphatidylinositol 3-kinase activity (blocked by LY294002) is required for TNF induction of IKK/NF-{kappa}B activity (25). The inhibitors for MAPKs were unable to block the TNF activity.


Figure 2
View larger version (25K):
[in this window]
[in a new window]

 
Fig. 2. Inhibition of PEPCK Transcription by TNF-{alpha}

A, Blocking of TNF activity by the NF-{kappa}B inhibitor. The H4IIE cells were pretreated with the pharmacological inhibitors for 60 min before addition of TNF-{alpha} and cAMP. The inhibitors are aspirin (5 mM), SP600125 (SP; 50 µM), SB203580 (SB; 2 µM), PD98059 (PD; 40 µM), and LY294002 (LY; 100 µM). mRNA was determined in the cells 4 h later. B, Inhibition of PEPCK gene promoter. The transcriptional activity of rat PEPCK gene promoter (–490/+100) was analyzed in HepG2 cells in a transient transfection. Expression vector of ssI{kappa}B{alpha} was cotransfected to block NF-{kappa}B activation. At 24 h after transfection, the cells were treated with cAMP and TNF-{alpha} overnight. C, Blocking of TNF activity by ssI{kappa}B{alpha} in HepG2-ssI{kappa}Ba stable cell line. The TNF-{alpha} activity was tested in the HepG2 stable cell line in which ssI{kappa}B{alpha} was consistently expressed. D, Inhibition of p65 nuclear translocation in HepG2-ssI{kappa}Ba cells. The p65 was quantified in the nuclear extract of HepG2-ssI{kappa}Ba cells in a Western blot to confirm the ssI{kappa}B{alpha} activity. In this figure, each bar represents mean ± SEM (n = 3). *, P < 0.05.

 
To confirm the role of NF-{kappa}B pathway, a luciferase reporter driven by the rat PEPCK gene promoter (–490/+73) was used in a transient transfection of HepG2 cells. The reporter activity was increased 3-fold by cAMP (Fig. 2BGo). The induction was reduced more than 50% in the presence of TNF-{alpha}, suggesting that PEPCK inhibition by TNF-{alpha} may happen at the gene transcription level. In this reporter system, the TNF activity was completely blocked by cotransfection of an expression vector of super suppressor I{kappa}B{alpha} (ssI{kappa}B{alpha}) (Fig. 2BGo), suggesting that degradation of I{kappa}B{alpha} is required for the TNF action. ssI{kappa}B{alpha} is a nondegradable mutant of I{kappa}B{alpha} (I{kappa}B{alpha}S32AS36A). In a HepG2 stable cell line in which ssI{kappa}B{alpha} was consistently expressed, induction of the PEPCK reporter by cAMP was normal (Fig. 2CGo). However, the PEPCK expression was no longer inhibited by TNF-{alpha} in this cell line. Inhibition of NF-{kappa}B was confirmed in this cell line because TNF-induced nuclear translocation of NF-{kappa}B p65 was blocked (Fig. 2DGo). These data suggest that IKK/NF-{kappa}B pathway is required by TNF-{alpha} in the inhibition of PEPCK gene transcription.

I{kappa}B{alpha} Controls Nuclear Translocation of HDAC3 in Hepatocytes
HDAC3 is distributed in both cytoplasm and nucleus (26). In the cytoplasm, HDAC3 is associated with I{kappa}B{alpha} in the NF-{kappa}B complex, and degradation of I{kappa}B{alpha} leads to nuclear translocation of HDAC3 in adipocytes (27). To investigate the mechanism of TNF-mediated inhibition of PEPCK transcription, HDAC3 was examined in this study. HDAC3 was quantified in the cytoplasmic and nuclear extract of H4IIE cells in a Western blot. In the cytoplasm, HDAC3 was modestly increased by cAMP, but the increase was blocked by TNF-{alpha} (Fig. 3Go, A and B). The nuclear HDAC3 was increased by TNF-{alpha} (Fig. 3Go, C and D), suggesting nuclear translocation of HDAC3 in response to TNF-{alpha}. In the HepG2-ssI{kappa}B{alpha} cell line, the TNF-induced nuclear translocation of HDAC3 was blocked completely (Fig. 3Go, E and F). The intracellular redistribution was not observed for HDAC3 after TNF treatment of HepG2-ssI{kappa}B{alpha} cells. These data suggest that I{kappa}B{alpha} degradation is required for nuclear translocation of HDAC3. TNF-induced p65 translocation was also blocked in the stable cell line (Fig. 3EGo). These data suggest that, in hepatocytes, the nuclear translocation of HDAC3 is promoted by TNF-{alpha}.


Figure 3
View larger version (28K):
[in this window]
[in a new window]

 
Fig. 3. HDAC3 Translocation to the Nucleus in Response to TNF-{alpha}

The cytoplasmic and nuclear proteins were extracted from H4IIE or HepG2-ssI{kappa}B{alpha} cells after cAMP and TNF-{alpha} treatment. The protein extracts were subjected to immunoblotting analysis for quantification of HDAC3 protein. ß-Actin and SP3 protein were used in the controls for protein loading and extract quality, respectively. A, HDAC3 in the cytoplasmic extract of H4IIE cells. The HDAC3 protein was determined in the cytoplasmic extract. The extract was not contaminated by the nuclear protein because SP3, a transcription factor only existing in the nucleus, was not detected in the blot. B, Quantification of HDAC3 in cytoplasmic extract of H4IIE cells. The relative HDAC3 protein level was determined by densitometry and normalized with actin protein. C, HDAC3 in the nuclear extract of H4IIE cells. In the positive control, NF-{kappa}B p65 was induced in the nucleus by TNF-{alpha}. In the negative control, SP3 protein level was not changed by TNF-{alpha}. The nuclear extract was not contaminated by the cytoplasmic protein because actin protein was not detected in the blot. D, Quantification of HDAC3 in nuclear extract of H4IIE cells. The relative HDAC3 protein level was determined by densitometry and normalized with SP3 protein levels. In C and D, each data point represents mean ± SEM (n =3). E, Cytoplasmic extract of HepG2-ssI{kappa}B{alpha} cells. HDAC3 was not reduced in the cytoplasmic by TNF-{alpha} in the ssI{kappa}B{alpha}-overexpressing cells. F, Nuclear extract of HepG2-ssI{kappa}B{alpha} cells. HDAC3 was not increased in the nucleus by TNF-{alpha} in the ssI{kappa}B{alpha}-overexpressing cells.

 
HDAC3 Is Required for TNF Inhibition of PEPCK Expression
In this study, the PEPCK expression was induced by cAMP through activation of CREB. Although coactivators for CREB have been studied widely (12, 14, 15, 16, 17), there is little information about corepressor of CREB in the literature. The above data suggest that HDAC3 may be involved in the inhibition of CREB activity by TNF-{alpha} as HDAC3 was increased by TNF-{alpha} in the nucleus. To test this possibility, butyrate and trichostatin A (TSA), two chemical inhibitors for HDACs, were used to block HDAC3 activity. In the presence of butyrate or TSA, TNF-{alpha} activity was blocked as indicated by protein and mRNA of PEPCK in H4IIE cells (Fig. 4AGo–C). These data suggest that HDAC activity is required for TNF inhibition of the PEPCK expression.


Figure 4
View larger version (22K):
[in this window]
[in a new window]

 
Fig. 4. Inhibition of TNF-{alpha} Activity by HDAC Inhibitor and HDAC3 RNAi

A, Restoration of reduced PEPCK protein expression by butyrate. The H4IIE cells were pretreated with butyrate (10 mM) before TNF-{alpha}, and the PEPCK protein was examined in the whole-cell lysate in Western blot. B, Restoration of PEPCK protein expression by TSA. The H4IIE cells were pretreated with TSA (50 nM) before TNF-{alpha}. The PEPCK protein was examined in the whole-cell lysate in Western blot. C, Restoration of PEPCK mRNA by butyrate or TSA in the presence of TNF-{alpha}. mRNA was determined using qRT-PCR in H4IIE cells after 4-h treatment with TNF-{alpha}. D, Blocking of TNF-{alpha} activity by HDAC3 RNAi. The PEPCK luciferase reporter system was cotransfected with the expression vectors of HDAC3 RNAi at 1:1 ratio in HepG2 cells. At 24 h after transfection, the cells were treated with cAMP overnight to induce the reporter activity in the presence of TNF-{alpha}. E, Knockdown of HDACs by vector-based RNAi in HepG2 cells. HDACs were examined in the whole-cell lysate after 48-h transfection in a Western blot. In B and C, each bar represents mean ± SEM (n = 3). F, Quantification of HDAC. The relative HDAC protein level was determined by densitometry and normalized with actin protein level. Each bar represents mean ± SEM (n = 3).

 
To study HDAC3 specifically, interference RNA (RNAi) knockdown was used in HepG2 cells. HepG2 cells were used for high efficiency in transfection. A vector-based RNAi for HDAC3 was transiently transfected into HepG2 cells. The PEPCK luciferase reporter was used to monitor the knockdown effect on the PEPCK gene promoter. The endogenous PEPCK gene is not inducible by cAMP in HepG2 cells. With HDAC3 knockdown, the inhibitory activity of TNF-{alpha} was blocked (Fig. 4DGo). In the control, knockdown of either HDAC1 or HDAC2 by RNAi had no effect (Fig. 4DGo). The proteins for HDAC1, HDAC2, and HDAC3 were examined in the cells transfected by the RNAi vector. The knockdown effect was confirmed in a Western blot (Fig. 4Go, E and F). Because HDAC3 is required for the inhibitory activity of TNF-{alpha}, HDAC3 is likely involved in the PEPCK inhibition by TNF-{alpha}.

SMRT Is Required for the PEPCK Inhibition by TNF-{alpha}
The nuclear corepressor usually contains either SMRT or N-CoR in addition to HDACs in the corepressor complex (24). To determine which one is involved in the corepressor activity, SMRT and N-CoR were analyzed with the RNAi strategy. With inhibition of SMRT by RNAi, the PEPCK reporter was no longer inhibited by TNF-{alpha} in HepG2 cells (Fig. 5AGo). However, knockdown of N-CoR did not exhibit any effect (Fig. 5AGo). The efficacy of knockdown was confirmed by the protein levels of SMRT and N-CoR in the whole-cell lysate (Fig. 5Go, B and C). These data suggest that SMRT is required for the corepressor function of HDAC3.


Figure 5
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 5. Inhibition of TNF-{alpha} Activity by SMRT RNAi

The PEPCK luciferase reporter system was cotransfected with SMRT RNAi expression vectors at 1:1 ratio in HepG2 cells. At 24 h after transfection, the cells were treated with cAMP and TNF-{alpha} overnight. A, Luciferase activity of PEPCK reporter. A similar condition to HDAC3 transfection was used in the transfection study of SMRT knockdown. B, Knockdown of SMRT by vector-based RNAi in HepG2 cells. SMRT and N-CoR were examined in the whole-cell lysate in a Western blot. The assay was done after 48-h transfection. C, Quantification of SMRT and N-CoR. The relative protein levels were determined by densitometry and normalized with actin protein levels. In this figure, each bar represents mean ± SEM (n = 3).

 
TNF-{alpha} Induces Association of HDAC3 and SMRT with the PEPCK Gene Promoter
The above data suggest that HDAC3 and SMRT may form a corepressor complex to inhibit the PEPCK transcription by TNF-{alpha}. To test this possibility, the corepressor proteins were investigated in the PEPCK gene promoter using chromatin immunoprecipitation (ChIP) assay in the H4IIE hepatoma cells. In the ChIP assay, the protein-DNA interaction was investigated in the CRE element (CRE, –91/–84). The ChIP signal was quantified in qRT-PCR. In response to cAMP, the CREB binding was increased together with the RNA polymerase II (Pol II) signal in the PEPCK gene promoter (Fig. 6Go, A and B). The increase was associated with an elevation in acetylation of histone 3 (Fig. 6CGo) but a decrease in signals for HDAC3 and SMRT (Fig. 6Go, D and E). The data suggests that CREB recruits Pol II to the PEPCK gene promoter in response to cAMP. Removal of the corepressor proteins of HDAC3 and SMRT may contribute to the increases in histone acetylation and Pol II recruitment to the promoter DNA. Before cAMP treatment, both HDAC3 and SMRT were detected in the PEPCK promoter DNA, although the signals were weak.


Figure 6
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 6. ChIP Assay with qRT-PCR

ChIP assay was conducted as described in Materials and Methods. H4IIE cells were treated with cAMP and TNF-{alpha} for 30 min. After cross-linking, the chromatin DNA was sheared in sonication and immunoprecipitated with specific antibodies to CREB, RNA Pol II, acetyl-histone 3 (Lys14), HDAC3, and SMRT. Rabbit IgG was used in the negative control for antibody. The purified chromatin DNA was quantified by SYBR green qRT-PCR with primers for the rat PEPCK promoter (rat PEPCK forward, CCAAACCGTGCTGACCATG; rat PEPCK reverse, ATACAGAAGGGAGGACAGCC). The specific signal was normalized with IgG signal. The signal change over untreated control was used to represent the ChIP result. A mean value of three tests was presented. A, CREB signal; B, Pol II signal; C, acetyl-histone 3 signal (Lys14); D, HDAC3 signal; E, SMRT signal.

 
In the presence of TNF-{alpha}, the ChIP signals induced by cAMP were completely reversed. A reduction in CREB was induced by TNF-{alpha}, and this was associated with a decrease in Pol II as well as histone acetylation (Fig. 6Go, A–C). These changes were observed together with an increase in HDAC3 and SMRT signals (Fig. 6Go, D and E). The reciprocal changes suggest that an increase in the corepressor activity was induced by TNF-{alpha}, and this increase may lead to the reduction in histone acetylation, which in turn accounts for the reduction in CREB and Pol II activities. The data provide physical evidence that HDAC3 and SMRT interact with the promoter DNA of PEPCK gene in response to TNF-{alpha}. The corepressor may regulate PEPCK transcription through the CRE element.

Transcriptional Activity of CREB Was Inhibited by the Corepressor Proteins of HDAC3 and SMRT
The above data suggest that CREB activity is inhibited by the corepressor proteins of HDAC3 and SMRT. To test the possibility, the transcriptional activity of CREB was examined using a CRE-luciferase reporter. In the HepG2 cells, the reporter activity was induced by cAMP, and the cAMP activity was reduced by TNF-{alpha} (Fig. 7AGo). As expected, the TNF-{alpha} activity was blocked by knockdown of HDAC3 but not influenced by knockdown of HDAC1 or HDAC2. Overexpression of ssI{kappa}B{alpha} also led to reduction in TNF-{alpha} activity. Knockdown of SMRT, but not N-CoR, yielded a similar result, blocking the TNF activity (Fig. 7BGo). This group of data confirms that the corepressor proteins of HDAC3 and SMRT inhibit the transcriptional activity of CREB.


Figure 7
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 7. Inhibition of Transcriptional Activity of CREB by TNF-{alpha}

The transcriptional activity of CREB was determined using a CRE-luciferase reporter that contains 2x CRE elements. The effect of HDAC knockdown was examined in cotransfection with the CRE-luciferase vector (DNA ratio 1:1) in HepG2 cells. A, Restoration of CREB activity by ssI{kappa}B{alpha} and HDAC3 RNAi. B, Restoration of CREB activity by SMRT RNAi. C, Mutation design. The mutation was achieved using a PCR-based strategy to substitute a base in the CREB response element (CRE). The point mutation was incorporated through mutated PCR primers. The DNA sequence of mutated CRE sequence was shown. D, Mutant promoter activity. The promoter activity of mutant was examined in a transient transfection in HepG2 cells. In this figure, each data point represents mean ± SEM (n = 3).

 
CREB Is Required for TNF Inhibition of PEPCK Promoter
The above data suggest that CREB is targeted by TNF-{alpha} in the inhibition of PEPCK transcription. It is not clear whether there are other TNF targets in the PEPCK promoter in addition to CREB. If the answer is yes, TNF-{alpha} should be able to inhibit the promoter in the absence of the CREB binding site. To test this possibility, the classical CRE element (CREB binding site at –91/–84) was mutated in the rat PEPCK promoter through T to G substitution (28) (Fig. 7CGo). The mutation led to no change in the basal promoter activity (Fig. 7DGo). However, cAMP-induced reporter activity was reduced by about 50% in the mutant promoter. The mutant promoter was no longer inhibited by TNF-{alpha}. The data suggest that the CRE at the location –91/–84 is a target of TNF-{alpha} in the PEPCK gene promoter.

HDAC3 and SMRT Are Required for p65 Inhibition of PEPCK Gene Promoter
It was reported that p65 of NF-{kappa}B mediated TNF activity in the inhibition of PEPCK transcription (21). Although a potential NF-{kappa}B binding site was found in the PEPCK gene promoter, the inhibitory activity of p65 was not dependent on its DNA-binding activity. The inhibition was attributed to displacing CBP from the PEPCK gene promoter by p65. To explore the role of corepressor in the p65-mediated inhibition, the PEPCK luciferase reporter was used. Overexpression of p65 led to an inhibition in the PEPCK reporter (Fig. 8AGo). The inhibition was blocked by overexpression of ssI{kappa}B{alpha}, suggesting that nuclear translocation of p65 is required for the inhibition. In the HepG2-ssI{kappa}B{alpha} cell line, p65 was unable to inhibit the PEPCK reporter (Fig. 8BGo). The p65-mediated inhibition was also blocked by HDAC3 knockdown (Fig. 8CGo) or SMRT knockdown (Fig. 8DGo). These data suggest that the p65 activity is dependent on the corepressor proteins of HDAC3 and SMRT in the inhibition of PEPCK.


Figure 8
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 8. Inhibition of PEPCK by p65

The PEPCK-luciferase reporter system was cotransfected with p65 expression vectors at a ratio of 1:0.5 in HepG2 cells to generate the inhibition. At 24 h after transfection, the cells were treated with cAMP overnight to induce the reporter activity. A, Inhibition of PEPCK reporter by p65. B, Reporter assay in HepG2-ssI{kappa}B{alpha} cells. C, HDAC3 knockdown by vector-based RNAi in HepG2 cells. D, SMRT knockdown by vector-based RNAi in HepG2 cells. In this figure, the relative luciferase activity was presented as mean ± SEM (n = 3).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In this study, we demonstrated that nuclear corepressor (HDAC3 and SMRT) was required for the inhibition of PEPCK transcription by TNF-{alpha}. Although the study was done in hepatocytes, this mechanism may be applied to the regulation of PEPCK expression in other type of cells, such as white adipocytes and renal cells (4). In addition to gluconeogenesis, PEPCK also regulates TG synthesis or fatty acid reesterification in adipose tissues (6). PEPCK is required for phosphorylation of glycerol leading to generation of 3-P-glycerol for TG synthesis in liver and fat (6, 13). Inhibition of PEPCK in adipocytes may contribute to less TG biosynthesis and degeneration of adipocytes in response to TNF-{alpha}. TNF-{alpha} is believed to contribute to lipodystrophy in chronic inflammation or advanced cancer that is associated with cachexia (29).

Nuclear translocation of HDAC3 is required for TNF inhibition of PEPCK. In this study, we demonstrated that TNF-{alpha} decreased cAMP-induced activity of PEPCK gene promoter through activation of the nuclear corepressor. In a previous study, we observed that I{kappa}B{alpha} associates with HDAC3 in the cytosol, and I{kappa}B{alpha} degradation leads to nuclear translocation of HDAC3 (27). In the current study, the same mechanism is shown to be responsible for the PEPCK inhibition by TNF-{alpha}.

The CREB activity is inhibited by HDAC3 and SMRT in the PEPCK gene promoter. The corepressor complex, such as HDAC3-N-CoR and HDAC1-SMRT, are known to regulate NF-{kappa}B activity (30, 31, 32). HDAC3 was reported to deacetylate p65 of NF-{kappa}B, leading to nuclear export of p65 (RelA) (30, 33). In this study, our data suggest that the HDAC3 may form a corepressor with SMRT in the inhibition of CREB in the PEPCK promoter. Because phosphorylation of CREB was not influenced by TNF-{alpha} (data not shown), it is unlikely that serine phosphorylation of CREB is involved in the inhibition by TNF-{alpha}. The decrease in the DNA-binding activity of CREB might be a result of chromatin modification by HDAC3. Another possibility is that the association of corepressor with CREB may reduce antibody affinity to CREB, which leads to less CREB signal in the ChIP assay. Histone acetylation was reduced when HDAC3 binding was increased by TNF-{alpha} in the PEPCK gene promoter. Regulation of CREB by HDAC3 and SMRT was supported by the data of CRE reporter. The current study provides the first evidence that CREB is inhibited by corepressor protein HDAC3 and SMRT. Given the limitation of RNAi, we may not completely exclude involvement of other corepressor proteins such as HDAC1, HDAC2, and N-CoR in the inhibition of CREB. PGC-1 is unlikely a direct target of TNF-{alpha} in the inhibition of PEPCK. In our system, the PGC-1 expression was not induced by cAMP (data not shown).

Our data suggest that the HDAC3 and SMRT are required by NF-{kappa}B p65 in the inhibition of PEPCK promoter. It was reported that p65 of NF-{kappa}B was involved in PEPCK inhibition (21). The study was conducted in H4IIE cells, and NF-{kappa}B was activated by phorbol 12-myristate 13-acetate (1 µM) or hydrogen peroxide (1 mM). The inhibition was attributed to displacing CBP from the PEPCK gene promoter by p65. Competition for CBP was proposed as a mechanism of the p65 inhibition of CREB (21). Our data suggest that the corepressor proteins HDAC3 and SMRT are required for p65-mediated inhibition of CREB. Because both p65 and CREB interact with the corepressor complex, the corepressor can be exchanged between NF-{kappa}B and CREB. When NF-{kappa}B is activated by TNF-{alpha}, the corepressor complex may leave NF-{kappa}B for CREB. The association of corepressor with CREB may promote disassociation of CBP from CREB through modification of histone acetylation. Disassociation of the corepressor from p65 leads to activation of the transcriptional activity of p65 by recruiting CBP from other transcription factor, such as CREB. At the same time, the corepressor may inhibit the transcriptional activity of CREB. The knockdown data suggests that, in the absence of corepressor, p65 is not be able to remove CBP from CREB because p65 failed to inhibit CREB. This study extends the molecular mechanism of NF-{kappa}B inhibition of PEPCK transcription, which was proposed in the study by Waltner-Law et al. (21).

In summary, our data support that inhibition of PEPCK by TNF-{alpha} is dependent on the corepressor proteins of HDAC3 and SMRT. We provide evidence that CREB is inhibited by the corepressor proteins of HDAC3 and SMRT. This may be an underlying mechanism by which TNF-{alpha} inhibits PEPCK transcription. The study provides a new line of evidence about nuclear corepressor in the regulation of glucose and fatty acid metabolism by TNF-{alpha}.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cells and Reagents
Hepatoma lines such as rat H4IIE and human HepG2 were purchased from the American Type Culture Collection (Manassas, VA). The cells were maintained in the DMEM culture medium supplemented with 10% fetal calf serum. LY294002 (ST-420) and SP600125 (EI-305) were acquired from Biomol (Plymouth Meeting, PA). PD098059 (p-215), SB203580 (s-8307), pCPT-cAMP (N6,2-O-dibutyryl cAMP; C-3912), TNF-{alpha} (T-6674), insulin (I-9278), butyrate (B-1378, trichostatin A (TSA, T8552), HDAC1 antibody (H 6287), and aspirin (acetylsalicylic acid, A-5376) were purchased from Sigma (St. Louis, MO). Antibodies to I{kappa}B{alpha} (sc-371), CREB (sc-186x), p65 (sc-8008), specificity protein 3 (SP3) (sc-644x), SMRT (sc-1610), and Pol II (sc-9001) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies for ß-actin (catalog no. ab6276), HDAC2 (ab1770), HDAC3 (catalog no. ab2379), and PEPCK (catalog no. ab28455) were obtained from Abcam (Cambridge, UK). Phospho-specific CREB antibody to Ser133 (9198) was from Cell Signaling Technology (Danvers, MA). Antibody to acetyl-histone 3 (Lys14; catalog no. 07-353) was from Upstate Biotechnology (Lake Placid, NY). SMRT and N-CoR RNAi expression vectors were used as reported previously (34). RNAi expression vectors for HDAC1, HDAC2, and HDAC3 have been described previously (35). Rat PEPCK-luciferase reporter plasmid (–490/+73) was made from pA3 luciferase vector by inserting the fragment of rat PEPCK gene promoter (36). The promoter DNA was obtained through PCR amplification of rat genomic DNA. A CRE-luciferase reporter (631911) with 2x CRE elements was from Clontech (Mountain View, CA).

HepG2-ssI{kappa}B{alpha} Stable Cell Line
pBabe retrovirus expression vector for ssI{kappa}B{alpha} was obtained from Dr. Paul J. Chiao (M.D. Anderson Cancer Center, Houston, TX). To make the ssI{kappa}B{alpha} stable cell line, HepG2 was infected with pBabe retrovirus that carries the Flag-ssI{kappa}B{alpha} expression cassette. The positive clone was selected by culturing the infected cells in puromycin-containing medium for 2 d and screened for Flag tag in the whole-cell lysate in an immunoblot. The control cells were made by infection of HepG2 with the empty pBabe retrovirus.

Transfection and Report Assay
Transient transfection was conducted with Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA) according to the instructions of the manufacturer. HepG2 cells were plated in 24-well plates (4 x 105 cells per well) and transfected with the PEPCK-luciferase reporter plasmid (36). In cotransfection, the expression plasmids for ssI{kappa}B{alpha}, HDAC1–HDAC3 RNAi, SMRT RNAi, and N-CoR RNAi were used. Total DNA amount was normalized with empty vectors in the transfection mixture. After transfection (24 h), the cells were cultured in 0.25% BSA DMEM for the treatment by cAMP (200 µM) and TNF-{alpha} (20 ng/ml). The cells were harvested 18 h later for luciferase assay. In all of the transient transfection, the internal control reporter (simian virus 40 renilla luciferase) was at 0.1 µg/well. The luciferase assay was conducted using a 96-well luminometer with the dual luciferase substrate system (Promega, Madison, WI). Relative luciferase activity was normalized to the internal control renilla luciferase activity, and the relative luciferase activity was presented as mean value plus SD of the triplicates. Each experiment was repeated at least three times.

Real-Time qRT-PCR
mRNA was determined using TaqMan real-time RT-PCR. H4IIE cells were plated in a 12-well plate (8.0 x 105 cells per well), and starved in 0.25% BSA-containing DMEM overnight, and then treated with cAMP (200 µM) for induction of PEPCK expression. At the same time, cells were treated with TNF-{alpha} (20 ng/ml) to inhibit PEPCK expression and then cells were harvested for extraction of total RNA in TRIzol solution. For pharmacological inhibitor treatment, H4IIE cells were maintained in 0.25% BSA-containing DMEM overnight and pretreated with LY294002 (100 µM), aspirin (5 mM), PD98059 (40 µM), and SB203580 (2 µM) for 1 h. The total RNA was subjected to real-time RT-PCR analysis for mRNA with TaqMan probe for rat PEPCK (Applied Biosystems, Foster City, CA). The mRNA signal was normalized over 18S ribosomal RNA gene. A mean value of the triplicates was used for relative mRNA level of PEPCK.

Western Blotting
The whole-cell lysate was made in lysis buffer [1% Triton X-100, 50 mM KCl, 25 mM HEPES (pH 7.8), 10 µg/ml leupeptin, 20 µg/ml aprotinin, 125 µM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 1 mM sodium orthovanadate] with sonication to break both cytoplasmic and nuclear membrane. The protein (100 µg) in 50 µl of reducing sample buffer was boiled for 3 min and resolved in 6% SDS-PAGE for 80 min at 100 V. Then, the protein was transferred onto polyvinylidene difluoride membrane (162-0184; Bio-Rad, Hercules, CA) at 50 V for 120 min. The membrane was blotted with first antibody for 1–24 h and secondary antibody for 30 min in milk buffer. The horseradish peroxidase-conjugated secondary antibodies (NA934V or NA931; GE Healthcare, Little Chalfont, UK) were used with chemiluminescence reagent (NEL-105; PerkinElmer, Wellesley, MA) for the signal detection. To detect multiple signals in one membrane, the membrane was treated with a stripping buffer (59 mM Tri-HCl, 2% SDS, and 0.75% 2-mercaptoethanol) for 20 min at 37 C to remove the bound antibodies. All of the experiments were conducted for three or more times. Intensity of the chemiluminescence signal is analyzed quantitatively using the computer program PDQuest 7.1 (Bio-Rad).

Cytoplasmic Protein and Nuclear Protein Extraction
Cytoplasmic protein and nuclear protein extracts were prepared according to a protocol published previously (37). Cells were treated with 500 µl of lysis buffer (50 mM KCl, 0.5% Nonidet P-40, 25 mM HEPES, 1 mM PMSF, 10 µg/ml leupeptin, 20 µg/ml aprotinin, and 100 µM dithiothreitol) on ice for 4min. Nuclei were pelleted by centrifugation at 14,000 rpm for 1 min and were resuspended in 300 µl of nucleus extraction buffer (500 mM KCl, 10% glycerol, 25 mM HEPES, 1 mM PMSF, 1 µl/ml leupeptin, 20 µg/ml aprotinin, and 100 µM dithiothreitol). The supernatant was cytoplasmic protein. After being centrifuged at 14,000 rpm for 5 min, the supernatant was harvested and stored at –80 C. The protein concentration was determined using bicinchoninic acid protein assay reagent (Pierce, Rockford, IL).

ChIP Assay
H4IIE cells were cultured in a 100-mm cell culture plate and treated with cAMP (200 µM) and TNF-{alpha} (20 ng/ml) after overnight serum-free starvation. The cells were treated with formaldehyde and collected for extraction of chromatin. The ChIP assay was used to monitor the NF-{kappa}B-induced recruitment of coactivators and corepressors in the rat PEPCK gene promoter in H4IIE cells. The protocol was described previously (32). The chromatin DNA was broken into 400-1200 bp in length by sonication and immunoprecipitated with ChIP-grade antibody. IgG was used in immunoprecipitate as a control for nonspecific signal. DNA in the immunoprecipitation product was quantified with SYBR green qRT-PCR. The ChIP assay primer sequences are as follows: rat PEPCK forward 2, CCAAACCGTGCTGACCATG-182; and rat PEPCK reverse 2, ATACAGAAGGGAGGACAGCC-283. This pair of primers was designed to cover the CREB binding site (–91/–84) in the rat PEPCK gene promoter. The qRT-PCR reaction was conducted in following condition: 2x iTaqTM SYBR Green supermix with ROX buffer (catalog no. 170-8850; Bio-Rad), 500 nM of each primer, and 5 µl of purified ChIP extract in a 20 µl reaction. 7900 HT Fast real-time PCR System (Applied Biosystems) was used to run the reaction.

Promoter Mutation
Site-directed mutation kit was used in the generation of point mutation in the PEPCK gene promoter to inactivate CRE1. The ExSite PCR-Based Site-Directed Mutagenesis kit was from Stratagene (La Jolla, CA) (catalog no. 200502).

Statistical Analysis
Each experiment was conducted at least three times with consistent results. The representative Western blot, transfection result, and gels are presented in this manuscript. The digital data is presented as a mean value and SEM of triplicates in the reporter assay. The data were analyzed using either Student’s t test or one-way ANOVA with significance at P < 0.05.


    ACKNOWLEDGMENTS
 
We thank Ms. Wei Tseng and Dr. Jun Yin for their excellent technical assistance.


    FOOTNOTES
 
This study is supported by National Institutes of Health Grant DK068036 and American Diabetes Association Research Award 7-04-RA-139 (to J.Ye) and National Natural Science Foundation of China Grant Award C03030206 and 973 Program of China 2006 CB503902 (to J.P.W.).

Disclosure Statement: The authors have nothing to disclose.

First Published Online April 24, 2007

Abbreviations: AP1, Activator protein 1; CBP, CREB-binding protein; ChIP, chromatin immunoprecipitation; CRE, cAMP response element; CREB, cAMP response element-binding protein; G6Pase, glucose 6 phosphatase; HDAC, histone deacetylase; I{kappa}B, inhibitor of NF-{kappa}B; IKK, I{kappa}B kinase; JNK, c-Jun N-terminal protein kinase; N-CoR, nuclear receptor corepressor; NF-{kappa}B, nuclear factor {kappa}B; PEPCK, phosphoenolpyruvate carboxykinase; PGC-1, peroxisome proliferator-activated receptor-{gamma} coactivator 1; PMSF, phenylmethylsulfonyl fluoride; Pol II, polymerase II; q, quantitative; RNAi, interference RNA; SMRT, silencing mediator for retinoic and thyroid hormone receptors; SP3, specificity protein 3; ssI{kappa}B{alpha}, super suppressor I{kappa}B{alpha}; TG, triglyceride; TSA, trichostatin A.

Received for publication February 6, 2007. Accepted for publication April 16, 2007.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Chajek-Shaul T, Barash V, Weidenfeld J, Friedman G, Ziv E, Shohami E, Shiloni E 1990 Lethal hypoglycemia and hypothermia induced by administration of low doses of tumor necrosis factor to adrenalectomized rats. Metabolism 39:242–250[CrossRef][Medline]
  2. Chang CK, Gatan M, Schumer W 1996 Efficacy of anti-tumor necrosis factor polyclonal antibody on phosphoenolpyruvate carboxykinase expression in septic and endotoxemic rats. Shock 6:57–60[Medline]
  3. O’Brien RM, Granner DK 1990 PEPCK gene as model of inhibitory effects of insulin on gene transcription. Diabetes Care 13:327–339[Abstract]
  4. Hanson RW, Reshef L 1997 Regulation of phosphoenolpyruvate carboxykinase (GTP) gene expression. Annu Rev Biochem 66:581–611[CrossRef][Medline]
  5. Hakimi P, Johnson MT, Yang J, Lepage DF, Conlon RA, Kalhan SC, Reshef L, Tilghman SM, Hanson RW 2005 Phosphoenolpyruvate carboxykinase and the critical role of cataplerosis in the control of hepatic metabolism. Nutr Metab (Lond) 2:33[CrossRef][Medline]
  6. Reshef L, Olswang Y, Cassuto H, Blum B, Croniger CM, Kalhan SC, Tilghman SM, Hanson RW 2003 Glyceroneogenesis and the triglyceride/fatty acid cycle. J Biol Chem 278:30413–30416[Free Full Text]
  7. Hill MR, McCallum RE 1992 Identification of tumor necrosis factor as a transcriptional regulator of the phosphoenolpyruvate carboxykinase gene following endotoxin treatment of mice. Infect Immun 60:4040–4050[Abstract/Free Full Text]
  8. Metzger S, Begleibter N, Barash V, Drize O, Peretz T, Shiloni E, Chajek-Shaul T 1997 Tumor necrosis factor inhibits the transcriptional rate of glucose-6-phosphatase in vivo and in vitro. Metabolism 46:579–583[CrossRef][Medline]
  9. Hill MR, Stith RD, McCallum RE 1986 Interleukin 1: a regulatory role in glucocorticoid-regulated hepatic metabolism. J Immunol 137:858–862[Abstract]
  10. Stith RD, McCallum RE, Hill MR 1989 Effect of interleukin-6/interferon-ß 2 on glucocorticoid action in rat hepatoma cells. J Steroid Biochem 34:479–481[CrossRef][Medline]
  11. O’Brien RM, Granner DK 1996 Regulation of gene expression by insulin. Physiol Rev 76:1109–1161[Abstract/Free Full Text]
  12. Hanson RW 2005 Metabolism in the era of molecular biology. J Biol Chem 280:1705–1715[Free Full Text]
  13. Chakravarty K, Cassuto H, Reshef L, Hanson RW 2005 Factors that control the tissue-specific transcription of the gene for phosphoenolpyruvate carboxykinase-C. Crit Rev Biochem Mol Biol 40:129–154[CrossRef][Medline]
  14. Herzig S, Long F, Jhala US, Hedrick S, Quinn R, Bauer A, Rudolph D, Schutz G, Yoon C, Puigserver P, Spiegelman B, Montminy M 2001 CREB regulates hepatic gluconeogenesis through the coactivator PGC-1. Nature 413:179–183[CrossRef][Medline]
  15. Koo SH, Flechner L, Qi L, Zhang X, Screaton RA, Jeffries S, Hedrick S, Xu W, Boussouar F, Brindle P, Takemori H, Montminy M 2005 The CREB coactivator TORC2 is a key regulator of fasting glucose metabolism. Nature 437:1109–1111[CrossRef][Medline]
  16. Canettieri G, Koo SH, Berdeaux R, Heredia J, Hedrick S, Zhang X, Montminy M 2005 Dual role of the coactivator TORC2 in modulating hepatic glucose output and insulin signaling. Cell Metab 2:331–338[CrossRef][Medline]
  17. Screaton RA, Conkright MD, Katoh Y, Best JL, Canettieri G, Jeffries S, Guzman E, Niessen S, Yates III JR, Takemori H, Okamoto M, Montminy M 2004 The CREB coactivator TORC2 functions as a calcium- and cAMP-sensitive coincidence detector. Cell 119:61–74[CrossRef][Medline]
  18. Puigserver P, Spiegelman BM 2003 Peroxisome proliferator-activated receptor-{gamma} coactivator 1{alpha} (PGC-1{alpha}): transcriptional coactivator and metabolic regulator. Endocr Rev 24:78–90[Abstract/Free Full Text]
  19. Chen G, Goeddel DV 2002 TNF-R1 signaling: a beautiful pathway. Science 296:1634–1635[Abstract/Free Full Text]
  20. Baldwin Jr AS 1996 The NF-{kappa}B and I{kappa}B proteins: new discoveries and insights. Annu Rev Immunol 14:649–683.[CrossRef][Medline]
  21. Waltner-Law M, Daniels MC, Sutherland C, Granner DK 2000 NF-{kappa}B inhibits glucocorticoid and cAMP-mediated expression of the phosphoenolpyruvate carboxykinase gene. J Biol Chem 275:31847–31856[Abstract/Free Full Text]
  22. Sengupta N, Seto E 2004 Regulation of histone deacetylase activities. J Cell Biochem 93:57–67[CrossRef][Medline]
  23. de Ruijter AJ, van Gennip AH, Caron HN, Kemp S, van Kuilenburg AB 2003 Histone deacetylases (HDACs): characterization of the classical HDAC family. Biochem J 370:737–749[CrossRef][Medline]
  24. Guenther MG, Barak O, Lazar MA 2001 The SMRT and N-CoR corepressors are activating cofactors for histone deacetylase 3. Mol Cell Biol 21:6091–6101[Abstract/Free Full Text]
  25. Ozes ON, Mayo LD, Gustin JA, Pfeffer SR, Pfeffer LM, Donner DB 1999 NF-{kappa}B activation by tumour necrosis factor requires the Akt serine-threonine kinase. Nature 401:82–85[CrossRef][Medline]
  26. Yang WM, Tsai SC, Wen YD, Fejer G, Seto E 2002 Functional domains of histone deacetylase-3. J Biol Chem 277:9447–9454[Abstract/Free Full Text]
  27. Gao Z, He Q, Peng B, Chiao PJ, Ye J 2006 Regulation of nuclear translocation of HDAC3 by I{kappa}B{alpha} is required for tumor necrosis factor inhibition of peroxisome proliferator-activated receptor {gamma} function. J Biol Chem 281:4540–4547[Abstract/Free Full Text]
  28. Bokar JA, Roesler WJ, Vandenbark GR, Kaetzel DM, Hanson RW, Nilson JH 1988 Characterization of the cAMP responsive elements from the genes for the alpha-subunit of glycoprotein hormones and phosphoenolpyruvate carboxykinase (GTP). Conserved features of nuclear protein binding between tissues and species. J Biol Chem 263:19740–19747[Abstract/Free Full Text]
  29. Argiles JM, Moore-Carrasco R, Fuster G, Busquets S, Lopez-Soriano FJ 2003 Cancer cachexia: the molecular mechanisms. Int J Biochem Cell Biol 35:405–409[CrossRef][Medline]
  30. Chen L, Fischle W, Verdin E, Greene WC 2001 Duration of nuclear NF-{kappa}B action regulated by reversible acetylation. Science 293:1653–1657[Abstract/Free Full Text]
  31. Zhong H, May MJ, Jimi E, Ghosh S 2002 The phosphorylation status of nuclear NF-{kappa}B determines its association with CBP/p300 or HDAC-1. Mol Cell 9:625–636[CrossRef][Medline]
  32. Gao Z, Chiao P, Zhang X, Zhang X, Lazar M, Seto E, Young H, Ye J 2005 Coactivators and corepressors of NF-{kappa}B in I{kappa}B{alpha} gene promoter. J Biol Chem 280:21091–21098.[Abstract/Free Full Text]
  33. Kiernan R, Bres V, Ng RW, Coudart MP, El Messaoudi S, Sardet C, Jin DY, Emiliani S, Benkirane M 2003 Post-activation turn-off of NF-{kappa}B-dependent transcription is regulated by acetylation of p65. J Biol Chem 278:2758–2766[Abstract/Free Full Text]
  34. Ishizuka T, Lazar MA 2003 The N-CoR/histone deacetylase 3 complex is required for repression by thyroid hormone receptor. Mol Cell Biol 23:5122–5131[Abstract/Free Full Text]
  35. Weiss C, Schneider S, Wagner EF, Zhang X, Seto E, Bohmann D 2003 JNK phosphorylation relieves HDAC3-dependent suppression of the transcriptional activity of c-Jun. EMBO J 22:3686–3695.[CrossRef][Medline]
  36. Shao J, Qiao L, Janssen RC, Pagliassotti M, Friedman JE 2005 Chronic hyperglycemia enhances PEPCK gene expression and hepatocellular glucose production via elevated liver activating protein/liver inhibitory protein ratio. Diabetes 54:976–984[Abstract/Free Full Text]
  37. Ye J, Cippitelli M, Dorman L, Ortaldo JR, Young HA 1996 The nuclear factor YY1 suppresses the human {gamma} interferon promoter through two mechanisms: inhibition of AP1 binding and activation of a silencer element. Mol Cell Biol 16:4744–4753[Abstract]

NURSA Molecule Pages Link:

Coregulators:   HDAC3  |  NCOR  |  SMRT



This article has been cited by other articles:


Home page
J. Nutr.Home page
B. J. Bradford, L. K. Mamedova, J. E. Minton, J. S. Drouillard, and B. J. Johnson
Daily Injection of Tumor Necrosis Factor-{alpha} Increases Hepatic Triglycerides and Alters Transcript Abundance of Metabolic Genes in Lactating Dairy Cattle
J. Nutr., August 1, 2009; 139(8): 1451 - 1456.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yan, J.
Right arrow Articles by Ye, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yan, J.
Right arrow Articles by Ye, J.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals