help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2007-0040
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
21/7/1713    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sasaki, N.
Right arrow Articles by Agui, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sasaki, N.
Right arrow Articles by Agui, T.
Molecular Endocrinology 21 (7): 1713-1721
Copyright © 2007 by The Endocrine Society

A Mutation in Tpst2 Encoding Tyrosylprotein Sulfotransferase Causes Dwarfism Associated with Hypothyroidism

Nobuya Sasaki, Yayoi Hosoda, Aogu Nagata, Ming Ding, Ji-Ming Cheng, Tomomi Miyamoto, Shinya Okano, Atsushi Asano, Ichiro Miyoshi and Takashi Agui

Laboratory of Experimental Animal Science (N.S., Y.H., A.N., S.O., A.A., T.A.), Graduate School of Veterinary Medicine, Hokkaido University, Kita-ku, Sapporo 060-0818, Japan; and Center for Experimental Animal Science (M.D., J.-M.C., T.M., I.M.), Nagoya City University Medical School, Mizuho-ku, Nagoya 467-8601, Japan

Address all correspondence and requests for reprints to: Prof. Takashi Agui, Laboratory of Experimental Animal Science, Graduate School of Veterinary Medicine, Hokkaido University, Kita-ku, Sapporo 060-0818, Japan. E-mail: agui{at}vetmed.hokudai.ac.jp.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The growth-retarded (grt) mouse has an autosomal recessive, fetal-onset, severe thyroid hypoplasia related to TSH hyporesponsiveness. Through genetic mapping and complementation experiments, we show that grt is a missense mutation of a highly conserved region of the tyrosylprotein sulfotransferase 2 (Tpst2) gene, encoding one of the two Tpst genes implicated in posttranslational tyrosine O-sulfation. We present evidence that the grt mutation leads to a loss of TPST2 activity, and TPST2 isoform has a high degree of substrate preference for TSH receptor (TSHR). The expression of TPST2 can restore TSH-TSHR-mediated cAMP production in fibroblasts derived from grt mice. Therefore, we propose that the tyrosine sulfation of TSHR by TPST2 is crucial for TSH signaling and resultant thyroid gland function.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
NORMAL THYROID FUNCTION is essential for development, growth, and metabolic homeostasis. Permanent congenital hypothyroidism affects about 1:3000 to 1:4000 newborns and is one of the most common preventable causes of mental retardation. In about 90% of all cases, congenital hypothyroidism is the consequence of thyroid dysgenesis such as a small and sublingual thyroid or no thyroid tissue. Most of these cases appear sporadically, although a few cases of recurring familial thyroid dysgenesis have been described (1). Molecular genetic analyses have identified four thyroid dysgenesis susceptibility genes in humans, TSH receptor (TSHR) (2) and the genes for transcription factors TTF1 (thyroid transcription factor) (3, 4), TTF2 (5), and PAX8 (paired box gene 8) (6) in pathways crucial for the normal development of the thyroid. Studies of the spontaneous mutation and targeted-disruption of Tshr (7), Ttf1 (8), Ttf2 (9), and Pax8 (10) in mice have provided insight into the molecular mechanisms of organogenesis and thereby form the basis for molecular genetic studies in human patients affected by thyroid dysgenesis. However, mutations in these genes are found in only 5% of patients with thyroid dysgenesis. Therefore, the genetic and pathological mechanisms underlying thyroid dysgenesis are still poorly understood.

The growth-retarded (grt) mouse is a spontaneous mutant exhibiting severe primary hypothyroidism and dwarfism controlled by a single recessive locus. The gene responsible for the grt has not yet been cloned, nor has its molecular mode of action been determined. However, homozygous grt mice exhibit low concentrations of serum T3 and T4, and a compensatory elevation in the level of circulating TSH demonstrates a normal pituitary response (11). In fact, measurements of several additional pituitary hormones revealed no significant differences between normal and grt mice. Growth retardation is recovered by the administration of T3, indicating that the grt mutation does not affect anterior pituitary function (12). The thyroid gland of grt mice is defective in TSH responsiveness, particularly in signaling pathway involving TSH, TSHR, G protein, and adenylate cyclase (13). These results suggest that the grt phenotype is attributable to an impairment of thyroid glands in the production of thyroid hormone or a response to TSH. To determine the molecular mechanism of the grt phenotype, we mapped the grt locus responsible for dwarfism in a 59 cM region of mouse chromosome 5 (14). No genes responsible for human and rodent dwarfism or thyroid disease have been mapped to this region. In this report, we narrowed the grt locus to a smaller than 0.1 cM region using 1084 backcross progenies, sequenced candidate genes located in this region, and finally identified a causative mutation in the tyrosylprotein sulfotransferase 2 (Tpst2) gene. Recent papers reported that the posttranslational modification by tyrosine sulfation regulates many important protein-protein interactions and modulates binding affinity and specificity. Mutational analysis has demonstrated that TSHR is sulfated on tyrosines in a motif that is essential for high-affinity binding of TSH and activation of the receptor (15). In this report, we propose that severe thyroid hypogenesis and consequent dwarfism are attributable to an impairment of tyrosine sulfation in TSHR by TPST2.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Identification of Tpst2 Mutation in grt Mutants
To identify the gene underlying the grt mutant phenotype, we created a high-resolution genetic map of the grt locus using 1084 backcross mice and analyzed their phenotypes of homozygotes (grt/grt) or heterozygotes (grt/+) by weighing mice at 5 wk of age. Homozygotes of both sexes were small with shortened limbs and tails and weighed approximately 40–60% less of the heterozygotes or wild-type (WT) mice. None of the phenotypes of 1084 backcross progenies had recombination with a microsatellite marker, D5Mit24, indicating a linkage of less than 0.1 cM (Fig. 1AGo). As shown in Fig. 1BGo, the gene order was from Cryba4 (crystallin, ß A4) to Asphd2 (aspartate ß-hydroxylase domain containing 2) covering the critical region. In this region, the mouse genome database disclosed seven genes: Cryba4, Crybb1 (crystallin, ß B1), Tpst2, Tfip11 (tuftelin interacting protein 11), Srr1 (sensitive to red light reduced), Hps4 (Hermansky-Pudlak syndrome 4), and Asphd2. We examined the expression of these possible candidate genes in multiple tissues, including thyroid with RT-PCR; there was no qualitative difference observed (data not shown). We next compared the nucleotide sequences of these genes between normal and affected mice and identified a distinct mutation in Tpst2. The mutation is a single missense mutation with a transversion of C at nucleotide 798 to G, leading to the replacement of a highly conserved histidine with a glutamine at codon 266 in the sulfotransferase domain (Fig. 1BGo). Sequence alignment of TPST1 and TPST2 reveals that the histidine residue was highly conserved among TPST family proteins of diverse species (Fig. 2AGo). In addition, phenotypically affected mice were homozygous for mutant alleles with PCR restriction fragment length polymorphism (RFLP) genotyping assay, whereas normal mice were homozygous for WT alleles or heterozygous in DW/J mouse colony (Fig. 2BGo). Furthermore, this mutation was not present in 10 other laboratory strains (data not shown). These results suggested that the Tpst2 mutation is responsible for the dwarfism.


Figure 1
View larger version (26K):
[in this window]
[in a new window]

  		Fig. 1. Identification of a Mutation in the Tpst2 Gene

A, Haplotype map of (C57BL/6J x DW/J-grt)F1 x DW/J-grt backcrossed progenies. Three microsatellite markers shown from chromosome 5 are those that have been typed on 1084 backcross DNAs. White squares represent the homozygous for the DW allele; black squares represent the heterozygous for B6 and DW alleles. The asterisks indicate the affected mice. Values at the bottom are the number of progenies. B, Transcript map of the critical region for the grt locus. All genes were screened for mutations. Transcriptional orientations are shown by arrows. Cen, Centromeric; Tel, telomeric. In the genomic structure of the mouse Tpst2 gene, exonic sequences that contribute to coding regions are boxed and shaded in stripes, and untranslated regions are boxed in white. The sulfotransferase domain of TPST2 protein is boxed in gray. A transversion of C to G is observed at position 798 in the affected mice, which causes an amino acid substitution (H266Q).

 

Figure 2
View larger version (46K):
[in this window]
[in a new window]

  		Fig. 2. The grt Mutation and Polymorphism Detection

Multiple alignment of amino acid sequences of TPST1 and TPST2 in various organisms. A, Caenorhabditis elegans and Drosophila melanogaster have only one TPST protein. An arrow indicates highly conserved histidine residue among all proteins in the TPST family. B, The 1115-bp PCR product from genome was digested with restriction endonuclease EcoNI, and genetic polymorphism was detected by PCR-RFLP. The WT fragment was not digested, whereas two fragments of 597 and 518 bp were produced during EcoNI digestion of the grt sequence. The grt/+ heterozygous shows both band patterns.

 
Expression of Tpst2 Transgene Rescues the Mutant Phenotype
To confirm this hypothesis, we attempted to complement the grt phenotype using transgenic (TG) rescue. We produced TG mice carrying Tpst2 cDNA driven by the cytomegalovirus enhancer and chicken actin (CAG) promoter (Fig. 3AGo). Founder mice expressed the Tpst2 gene in several tissues, including thyroid (Fig. 3BGo). Crosses between grt/+ males with the transgene and grt/+ females generated 17 phenotypically affected mice, all of which were negative for the transgene. Twenty normal mice were homozygous for the grt mutation, and all were positive for the transgene, demonstrating phenotypic rescue of the dwarfism (Fig. 3Go, C and D). Tpst2 overexpression had no influence on growth except in grt/grt mice. Two independent founder lines produced similar results. Next, we investigated the rescue of thyroid function, and serum T3, T4, and TSH levels were analyzed in grt/grt mice with or without transgenes. In grt/grt mice, serum levels of TSH were elevated 3- to 5-fold above normal, whereas T3 and T4 levels were less than normal. Rescued mutants demonstrated normal serum levels for T3, T4, and TSH (Fig. 3EGo). Histologically, the mutant thyroid glands showed hypogenesis characterized by poorly developed follicles that were heterogeneous in size with reduced levels of colloid (Fig. 4AGo, middle), and some follicles were unreactive with periodic acid schiff (PAS) staining. Interestingly, the thyroids of rescued mutants revealed no abnormalities in thyroid size, follicular structure, or the morphology of cells (Fig. 4AGo, bottom). The numbers of cells and follicles per square millimeter were in the normal range, and follicle size was not significantly different from that of normal mice (data not shown).


Figure 3
View larger version (25K):
[in this window]
[in a new window]

  		Fig. 3. TG Rescue of grt Phenotypes

The Tpst2 amplicon was inserted downstream of the CAG promoter and its intron and upstream to the simian virus 40 polyadenylation signal. Arrows indicate the location and orientation of two primer pairs used. Primers A and B were used for detection of the expression of transgene with RT-PCR, whereas primers C and D were used for genotyping with genomic PCR. B, Tpst2 transgene is expressed in thyroid (Th), brain (Br), kidney (Ki), ovary (Ov), and testis (Te) but not in liver (Li) and spleen (Sp) of TG mice. C, TG rescue of grt phenotypes. Typical grt/grt animals with (+) or without (–) the CAG-Tpst2 transgene at 5 wk of age. D, Comparison of weights among each genotype at 5 wk of age. 1, grt/grt with TG (n = 20); 2, grt/grt (n = 17); 3, grt/+ with TG (n = 30); 4, grt/+ (n = 30); 5, WT (+/+) with TG (n = 16); 6, WT (+/+) (n = 14). The weight data were presented by combining those of male and female, because no difference was found between them at 5 wk of age. *, P < 0.0001, a significant difference against other groups. E, Serum TSH, T3, and T4 values of WT (+/+) (n = 8), grt/grt (n = 8), and TG grt/grt (TG-grt) mice (n = 8). The values are presented as means ± SEM. They were analyzed for statistical significance with Student’s t test; *, P < 0.005 was considered to be significant.

 

Figure 4
View larger version (100K):
[in this window]
[in a new window]

  		Fig. 4. Histological Analysis and Expression of Thyroid-Specific Genes in Tpst2-TG grt-Mutant Mice

A, Histological analysis. Thyroid glands from 8-wk WT, grt/grt, and TG grt mice were fixed, sectioned, and stained with hematoxylin and eosin (HE) and PAS. The small boxes at x4 magnification indicate thyroid glands of each genotype. The grt/grt thyroid is significantly smaller in size. High-magnification (x40) HE staining showed that the grt/grt thyroid is marked by a reduction in follicular cell number and replacement of some hypoplastic portion by adipose tissue (arrow). In PAS staining of grt/grt thyroid gland at x40 magnification, colloid staining was not present in some lumens, suggesting a decrease in thyroglobulin production and storage. Conversely, hypogenesis of the thyroids was completely rescued in TG grt/grt mice. B, Semiquantitative RT-PCR analysis of the thyroid-specific genes Tgn, Pax8, Nis, Tpo, and Tshr from two WT, grt, and TG grt thyroids each. Actb was used as internal control. Tshr and Nis levels were significantly reduced in grt/grt thyroids.

 
Next, to assess thyroid-specific gene expression in grt/grt mice, we performed a semiquantitative RT-PCR analysis. Thyrotropin-TSHR signaling is essential for the proliferation and maintenance of the differentiated function of the thyroid follicular cells, but it is not required for early organogenesis and migration of the thyroid anlage (16). Thyrotropin-TSHR signaling is essential for the expression of Nis (sodium-iodide symporter, Tpo (thyroperoxidase), and Tshr itself, which are required for thyroid hormone biosynthesis, whereas it is not required for Tgn (thyroglobulin) expression (17). These observations are consistent with our results that the expression of Tshr and Nis is reduced by 3- to 5-fold, although Tgn was normally expressed in grt/grt thyroids compared with normal controls (Fig. 4BGo). Previously, we have shown that much less iodine is accumulated in the grt/grt thyroid than in the control mice, although the incorporation of iodine into thyroglobulin, glycosylation, and the intracellular transportation of thyroglobulin are all normal (18). The reduction in the amount of iodine accumulated in the grt/grt thyroid might be the major cause of the decrease in levels of thyroid hormones. Consistent with the results of histopathology and serum hormone levels, the restoration of Tpst2 rescued the levels of expression of Tshr and Nis in the TG mutant’s thyroids (Fig. 4BGo). Thus, on the basis of chromosomal mapping, nucleotide sequence analysis, and genetic complementation study, we concluded that the dwarf-causing grt mutation was contained in the Tpst2 gene.

Loss of Enzymatic Activity of TPST2 H266Q Mutation
TPST catalyzes the transfer of a sulfuryl group from the universal sulfation substrate, 3'-phosphoadenosine 5'-phosphosulfate (PAPS), to a tyrosyl residue within acidic motifs of proteins that transit the Golgi (Fig. 5AGo). To characterize the enzymatic activity, we prepared a peptide array presenting the 15-mer peptide substrates glycoprotein 1b {alpha} polypeptide (GP1BA) (19), coagulation factor VIII (CF-8) (20), cholecystokinin (CCK) (21), FSH receptor (FSHR), TSHR (15), and P-selectin glycoprotein ligand-1 (PSGL1) (22), which are known acceptors for tyrosine sulfation and detect the incorporation of 35S-labeled sulfate into the substrates. TPST1, TPST2, and TPST2 (H266Q) expression vectors were transfected into HEK293T. Immunoblot analysis indicated that each protein was expressed at similar level in the transfected cells (Fig. 5BGo). Although HEK293T cells expressed both human isozymes, which were detected by RT-PCR, there was no detectable sulfation of all peptide substrates when lysates of mock-transfected cells were used (Fig. 5CGo). Thus, the basal TPST activity was undetectable level for this assay. Figure 5CGo shows that all peptides were sulfated by WT TPST2. In contrast, the enzyme activity of mutant TPST2 (H266Q) was reduced to undetectable levels, although the same amount of protein was present on each reaction. Thus, histidine 266 must be a critical residue for TPST activity. We investigated the subcellular distribution of normal and mutant TPST2 tagged with FLAG (FL) and the effects of mutant TPST2 on the survival of transfected cells, and no changes were found (data not shown). This mutation might affect the affinity of TPST protein for acceptor proteins/PAPS or the enzymatic activity itself. Additional mutagenesis and crystallographic studies will be needed to address this issue.


Figure 5
View larger version (35K):
[in this window]
[in a new window]

  		Fig. 5. The Substrate Preference of TPST1 and TPST2

A, TPST catalyzes the transfer of sulfate from the universal sulfate donor PAPS to the hydroxyl group of a peptidyltyrosine residue to form a tyrosine O-sulfate ester. B, Equal amounts of cell extracts were extracted from HEK293T cells and subjected to Western blot analysis with an FL antibody. The bands of approximately 55 and 50 kDa detected on the blots can be identified as TPST2 (TP2) and TPST1 (TP1), respectively. Actb was used as a loading control. C, Tyrosine sulfation on the peptide array by TPST1 and TBST2. Each spot contains the 15-mer peptide substrates GP1BA, CF-8, CCK, FSHR, TSHR, and PSGL1. The same input of each TPST was used for this assay. The tyrosine sulfation of peptides was revealed by the incorporation of 35S into the substrates by autoradiography. The putative sulfation sites are indicated as gray characters. TSHR (mu) and PSGL1 (mu) are negative control peptides, in which a mutation from tyrosine to phenylalanine was introduced. TP1, TP2, and TP2 (H266Q) indicate TPST1, TPST2, and mutant TPST2 (H266Q), respectively. D, The quantitative evaluation of C. The relative incorporation of 35S into peptides was evaluated.

 
The Tyrosine Sulfation of TSHR by TPST2 Is Crucial for Thyrotropin Signaling
In mammals, tyrosine sulfation of proteins is catalyzed by two isozymes; TPST1 and TPST2. A question arose as to whether the isozyme TPST1 compensates for a deficiency of TPST2, because the mouse TPST1 has 65% homology with TPST2 at the amino acid level. Previously, Northern analyses indicated that both Tpsts were ubiquitously expressed in various tissues and cell lines (23, 24). However, it has not been determined whether the two TPSTs are coexpressed on cells or tissues. To evaluate tissue expression preferences of Tpst isoforms, we examined the expression of the Tpst1 and Tpst2 genes in various mouse tissues, the rat thyrocyte cell line FRTL-5 (Fig. 6AGo), murine primary fibroblasts, and NIH3T3 cells (data not shown). Semiquantitative RT-PCR analysis was performed concomitantly for both genes in the same tube on each sample and revealed that the Tpst isoforms coexpressed in the same tissues and cells including thyrocytes, although there are some differences in tissue preference. Furthermore, RT-PCR analyses showed that the grt mutation did not affect steady-state transcription of Tpst1 or Tpst2 itself in any tissues (data not shown).


Figure 6
View larger version (38K):
[in this window]
[in a new window]

  		Fig. 6. Effect of Restoration of TPST Proteins on TSH-TSHR Signal Transduction Pathway

A, Tpst1 and Tpst2 expression in various mouse tissues. Semiquantitative RT-PCR analysis shows ubiquitous expression of both Tpst1 and Tpst2. Tpst1 (563 bp) and Tpst2 (741 bp) were concomitantly amplified in the same tube of each sample. Thyroid and thyrocyte cell lines expressed both genes. B, Rescue of TSH-mediated cAMP production in grt/grt fibroblasts by TPST2 restoration in response to TSH stimulation. + or – indicates the presence or absence of TSH (10 mU/ml) in the medium. Lentiviruses encoding the TSHR and each TP1, TP2, and TP2 (H266Q) were infected in grt cells, alone or in combination. Each bar represents the mean ± SEM. C, The expression of each gene in grt/grt fibroblasts was confirmed by RT-PCR. The expressions of transgenes increased to approximately 2- to 3-fold more than that of endogenous Tpst mRNAs. D, The expression of TPST proteins in grt/grt fibroblasts were evaluated by Western blotting with FL antibody. Mock indicates the untransfected-grt/grt fibroblasts. Each protein was expressed at similar level in the transfected cells.

 
In vitro studies using synthetic peptide acceptors indicated that the two TPST isoforms differed in substrate preference (24, 25). Inactivation of murine Tpst1 did not result in any abnormality of the thyroid (26). Therefore, we investigated the substrate specificity of TPSTs. As shown in Fig. 5Go, C and D, TPST1 and TPST2 similarly sulfated GP1BA, CF-8, CCK, and PSGL1. In contrast, the preference of TPST2 was 5-fold that of TPST1 for TSHR peptides, implying that TPST1 cannot compensate for the deficiency of TPST2 activity.

In the thyroid, the TSH-bound TSHR induces coupling of the receptor to the G protein and produces intracellular cAMP through the activation of adenylate cyclase (27). The thyroid gland of the grt mutant exhibited a markedly diminished response of TSH both in vitro and in vivo, although cAMP production was increased after stimulation of the thyroid glands with nonspecific adenylate cyclase activators such as forskolin (12, 13). To obtain additional evidence, we performed an in vitro TSH signaling assay with primary fibroblasts obtained from grt/grt mutants. The lentiviruses encoding Tpst1, Tspt2, and mutant Tpst2 (H266Q) with TSHR cDNA were introduced into grt/grt fibroblasts, and TSH-induced production of cAMP was determined. The grt/grt fibroblasts showed an increase in cAMP production when cultured in the presence of forskolin. Stimulation of cells expressing just TSHR (mock) with TSH resulted in a slight increase in cAMP accumulation (Fig. 6BGo). The TSH-dependent cAMP accumulation in the cells expressing TPST1 or mutant TPST2 was very low or similar to that of mock-transfected cells. In contrast, in cells expressing TPST2, cAMP accumulation was approximately 2- to 3-fold higher than that in cells expressing the others. These results strongly suggest that only TPST2 can efficiently mediate the TSH-TSHR signal transduction pathway, whereas TPST1 and TPST2 (H266Q) cannot.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
The present study revealed that grt mice carried a recessive loss-of-function mutation in Tpst2 gene. We demonstrated that TPST2 is required for normal development and function in thyroid. This conclusion is supported by the following evidence: 1) the position of the Tpst2 gene closely locates to the grt locus and the perfect matching between the Tpst2 mutation and the dwarf phenotype is observed in the DW/J mouse colony; 2) H266 is highly conserved in the TPST family among many species; 3) Q266 substitution causes a loss of enzymatic activity; 4) Tpst2 transgene rescues the mutant phenotypes in vitro and in vivo; and 5) TPST2 shows high specificity for the substrate toward TSHR. Previously, site-directed mutagenesis suggested that sulfation of tyrosine 385 of TSHR is required for high-affinity hormone binding and receptor activation by TSH (15). Furthermore, two kinds of Tshr mutant mice, spontaneous and targeted mutants, have been reported (16, 17). Both mutants can produce thyroglobulin, but they show reduced iodine uptake in the thyroid. Similarly, the uptake of iodine is markedly lower in grt mice (18). Combining these observations with our data, we propose that sulfation of tyrosine 385 of TSHR by TPST2 is indispensable for the activation of TSH signaling. Because grt/grt mice are unable to fully respond to TSH, they develop hypothyroidism and dwarfism. The growth of grt/grt mice is virtually normal until 2 wk after birth and is then suppressed in the pubertal period; however, it gradually catches up with those of normal mice after approximately 1 yr. This might be because normal rodent chows provide enough thyroid hormone for survival.

Recently, it has been reported that Tpst2–/– mice on the 129/Sv background were produced by gene targeting (28). Tpst2–/– mice showed growth retardation at 4–5 wk of age in both sexes that resembled that in the grt mutants. However, their report could not defined the molecular mechanism of the growth retardation. In our report, we determined Tpst2 as the gene responsible for the severe thyroid dysgenesis that relates to TSH hyporesponsiveness through positional cloning and TG rescue. Furthermore, we show that TPST2 has high degree of substrate specificity for TSHR and is essential for TSH-TSHR signaling. Therefore, our report has clarified the crucial role of TPST2 for a particular signaling pathway in vivo for the first time. The maximum difference in body weight of Tpst2–/– mice at 5 wk was 20% less compared with normal littermates. In contrast, DW/J-grt mice lost up to 50%. It has been reported that thyroid dysgenesis were displayed in C57BL/6 mice with Pax8+/–/Ttf1+/– and not in 129Sv strain (29). Therefore, Tpst2–/– in the 129 background might be resistant to thyroid dysgenesis. These might represent a spectrum of different degrees of severity of the same underlying molecular defect. In humans, most cases of thyroid dysgenesis are sporadic and most patients do not display a clear Mendelian transmission, suggesting the existence of several genetic factors that could contribute to the disorder (30). Therefore, this strain differences should help us to identify modifier gene(s) involved in morphogenesis, growth, and differentiation of the thyroid. The other explanation of phenotypic differences between Tpst2-null mutants and grt mice could be through the dimerization of TPST proteins, because the many sulfotransferases are homodimer and/or heterodimer in solution (31). The physiological significance of dimerization of cytosolic sulfotransferases is not yet clearly defined. However, it has been reported that both TPST1 and TPST2 form homodimers (23, 32). Therefore, if dimerization is essential for the TPST activity, high expression of TPST2 H266Q mutant may result in a significant decrease in TPST1 activity in a dominant-negative manner. This hypothesis is consistent with the result that the dwarfism of grt mice is more severe than that of Tpst2-null mice.

Hypothyroidism in humans is associated with a marked delay in sexual maturation and development (33). The grt males also demonstrate the severe decrease in testicular weight and the numbers of Leydig cells until 5–8 wk age, although they gradually acquire normal structure and function of the testis and finally become fertile at 3–4 months (our unpublished data). Thus, we could cross F1 females with grt males to obtain backcrossed progenies. Tpst2–/– mutant males are infertile at 10 wk of age, although spermatogenesis and mating are normal (28). This result is in agreement with previous reports showing a decrease in sperm motility in rats with hypothyroidism (34, 35). However, it has not been described whether Tpst2–/– males become fertile after 10 wk or are infertile throughout their life. If Tpst2 knockout is a phenocopy of the grt mutant, male infertility can be caused by dwarfism/hypothyroidism and may also gradually acquire fertility after 10 wk of age.

Tyrosine sulfation was estimated to occur in approximately 1% of all tyrosines of the eukaryotic proteome (36). In mammals, approximately 60 proteins have already been identified (37). The known tyrosine-sulfated proteins include certain adhesion molecules, G protein-coupled receptors, coagulation factors, and extracellular matrixes and hormones. In some of these proteins, tyrosine sulfation has been shown to be required for optimal binding, but, in many, a functional role of tyrosine sulfation still has been unclear. Thus, although many proteins are possible to be the substrates of TPST2, our current study mainly focuses on TSHR. However, the possibility that the grt phenotype reflects a defect in other proteins as the substrate of TPST2 in downstream of the TSHR could not be excluded. Tyrosine sulfation might also affect enzymatic activity, protein transportation, localization, and lifespan, possibly being important for hemostasis, chemotaxis, inflammation, and development, as well as for viral and cancer pathogenesis (38).

In the past several decades, the causative genes of inherited hypothyroidism have been identified in humans and rodents. These genes encode transcription factors, hormones, and their receptors. The posttranslational processing in the thyroid has been considered to have a significant role in their correct function. However, these processes have not been shown to be mainly involved in the pathogenesis of thyroid until our reports. Although a mutation of TPST has not been found in human disease, our data suggest that TPST2 may be one of the causative genes for thyroid dysgenesis of unknown origin. Additional pathological examination of grt, Tpst1–/– and Tpst2–/– mutants and additional biochemical examination to find a variety of acceptor proteins will provide new insights into the biological function of tyrosine O-sulfation.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Pedigree Material and Haplotype Analysis
(C57BL/6J x DW/J-grt)F1 females were mated with DW/J-grt males to obtain backcrossed progenies. Linkage analysis was performed using the microsatellite markers D5Mit314 [Mouse Genome Informatics database (MGI) accession no. 100402], D5Mit240 (MGI accession no. 93321), and D5Mit24 (MGI accession no. 93320) and a single nucleotide polymorphism for Crybb1 (MGI accession no. 104992). Mice were maintained under the control of a 12-h light, 12-h dark cycle. Research was conducted according to the Guidelines for the Care and Use of Laboratory Animals of both Graduate School of Veterinary Medicine of Hokkaido University and Nagoya City University Medical School. The experimental protocol was approved by the Institutional Animal Care and Use Committee of both Graduate School of Veterinary Medicine of Hokkaido University and Nagoya City University Medical School.

Vector Constructions
The murine Tpst2-coding regions (GenBank accession no. NM_009419) were amplified by PCR to include the native translation initiation sequence of Tpst2 with the following primer pair [forward (F) and reverse (R)]: ggctggccatgggcctgtcggtgc and tttcacttatcgtcgtcatccttgtaatccgaacttcctaggtgtggggaggtgc. The Tpst1-coding region (GenBank accession no. NM_013837) was amplified with the following primer pair (F and R): acgtgatatccgttgggaagctgaagcaga and tttcacttatcgtcgtcatccttgtaatcctccacttgctccgtctggg. The sequence coding for the FL peptide YKDDDDK was added to their COOH terminals, and the resultant cDNAs were subcloned in pTriEx 1.1 vector (Novagen, Madison, WI) to generate pTriEx/Tpst1-FL, pTriEx/Tpst2-FL, and pTriEx/Tpst2 (H266Q)-FL.

Genetic Complementation Test Using TG Mice
pTriEx/Tpst2-FL was prepared for microinjection by digestion with SalI and SwaI, followed by electrophoresis and purification of the linearized DNA. TG mice were generated by pronuclear injection of the linear transgene into fertilized zygotes prepared from BDF1 mice. RT-PCR analysis of transgene expression in various tissues was performed using the following primer pair (A and B): tctgactgaccgcgttact and ggccgcatcctccgtgggtt (Fig. 3AGo). The TG hemizygotes on grt/+ were mated to generate the TG grt/grt homozygotes. The following primer pair was used for genotyping TG animals (C and D): cacactcaagtcatccgtcta and cttgcacgtgtatacagctg (Fig. 3AGo), which cannot amplify endogenous Tpst2 locus attributable the long distance between both primers. For genotyping Tpst2 alleles, PCR and subsequent RFLP analysis using EcoNI have been used.

Hormonal Analysis
To test thyroid function of grt/grt mice with or without transgenes, blood was collected into tubes containing 1 mg/ml EDTA at the final concentration and kept on ice, and plasma was obtained by centrifugation. Serum was removed after centrifugation and stored at –20 C until analysis. Serum levels of free T3 and T4 were measured using ACTIVE Free T3 or T4 enzyme immunoassay kits (Diagnostic Systems, Webster, TX). Serum TSH was determined using RAT TSH ELISA kit (Shibayagi, Gunma, Japan) according to the instructions of the manufacturer with minor modifications to optimize the signal intensity. Serum samples from grt mice needed to be diluted 10 times with PBS (pH 7.4). National Institute of Diabetes and Digestive and Kidney Diseases rat TSH RP-3 was used as the standard.

mRNA Detection Methods
For detecting mutations, total RNA from WT and grt tissues were extracted with TRizol and reverse transcribed with an RT-PCR kit according to the instructions of the manufacturer (Invitrogen, Carlsbad, CA). For the quantitation of thyroid-specific gene, each mRNA level of murine Tshr, Nis, Tpo, Tgn, and Pax8 was determined using specific primers as follows: Tshr F and R, acctctcttacccgagccactgc and tccaggcgcatggcgaaggtgat; Nis F and R, cattcccggatcaacctgatggact and tttagagatgaaaaccagcttccg; Tgn F and R, cagaccgtagtggggctgatgtg and gcatagtcgtctgtggagtgct; Tpo F and R, attgggaagcagatgaaggctct and gggtgtgtcagatctgcacact; Pax8 F and R, gaatattctggcaatgcctacag and tgtacaccctcagactcatctc; and Actb (ß-actin) F and R, tgatggtgggaatgggtcag and gaaggctggaaaagagcctc.

For the quantitation of mRNA for Tpst1 and Tpst2, RT-PCR was performed for both genes in the same tube on each sample concomitantly. Primers were designed so that the sense primer was shared for amplification of both Tpst1 and Tpst2 genes. The primers used were as follows: tcacggccatgtcttgtaag (Tpst1 antisense), gtgctgttctggttcacctg (Tpst2 antisense), and tgcaggccttcattctggaggtgat (common sense). To determine the optimum PCR amplification conditions in the linear range, three amounts of cDNA (10, 50, and 100 ng) were tested for each sample. Each reaction tube contained 2 µl of 10 x Ex Taq buffer (TaKaRa, Tokyo, Japan), 2 µl of 2.5 mM dNTP mixture, 0.1 µl of Ex Taq polymerase (TaKaRa), 1 µl (4 µM) of each antisense primer, and 2 µl (4 µM) of common sense primer. The total reaction volume was 20 µl. PCR consisted of denaturation at 94 C for 3 min, 25 cycles of denaturation at 94 C for 30 sec, annealing at 55 C for 30 sec and extension at 72 C for 30 sec, and a final extension at 72 C for 5 min. The PCR products were electrophoresed on 1.5% agarose gel. All assays were performed in duplicate.

Cell Culture, Plasmids, and Expression of Transgenes
Tpst1-FL, Tpst2 (H266Q)-FL, Tpst1-FL, and TSHR cDNA were expressed by the ViraPower Lentivirus expression system (Invitrogen). The primary skin-derived fibroblasts from grt mice were grown in DMEM supplemented with 10% fetal bovine serum and penicillin/streptomycin at 37 C. The expression of these genes were detected with semiquantitative RT-PCR.

In Vitro Sulfation of Peptide Arrays
pTriEx1.1-Tpst1-FL, Tpst2-FL, and mutant Tpst2-FL plasmids were transfected into 1 x 107 HEK293T cells using Lipofectamine 2000 (Invitrogen). After 48 h, each cell was homogenized in 500 µl of ice-cold 10 mM Tris-HCl (pH 7.5) containing 100 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1 mM phenylmethylsulfonyl fluoride, 1 mg/ml pepstatin, 2 mg/ml aprotinin, and 2 mg/ml leupeptin. Expression of each TPST protein in cell lysates (20 µg) was detected by Western blot analysis using a FL antibody (Sigma, St. Louis, MO). TPST activity was determined by measuring the transfer of [35S]sulfate from [35S]PAPS to Fmoc-based membrane-immobilized 15-mer peptides (39). Peptide arrays, [35S]PAPS, and 50 ml of TPST lysate were accomplished by incubating 50 µl of the buffer [50 mM piperazine-1,4-bis(2-ethanesulfonic acid) (pH 6.9), 0.4 mM EDTA, 1 mM Mg-acetate, 200 mM NaCl, 1 mg/ml BSA, and 10 mM dithiothreitol] for 1 h at 37 C. After incubation, peptide arrays were washed with 0.1 M Tris-HCl (pH 8.0) twice. The relative amounts of incorporated radioactivity were visualized and quantified with a BAS2500 Bio-Imaging analyzer (Fujifilm, Tokyo, Japan). All assays were performed in duplicate.

Measurement of cAMP
Amount of cAMP was determined according to the instruction manual of the cAMP enzyme immunoassay kit (Cayman Chemicals, Ann Arbor, MI). In brief, 2 x 105 cells of each clone were seeded in a six-well tissue culture dish. The cells were starved of serum for 18 h, and then serum-free medium and bovine TSH (10 mU/ml) was added and incubated for 60 min. To assess the value for nonspecific stimulation of intracellular cAMP levels, cells were incubated with 10 mM forskolin and 0.2 mM 3-isobutyl-1-methylxanthine (Sigma). Each experiment was repeated two times.


   ACKNOWLEDGMENTS
 
We greatly thank Dr. Y. Nagayama (Nagasaki University, Nagasaki, Japan) for human TSHR cDNA. We also acknowledge laboratory members for helpful discussions, especially A. Y. Simon for comments on this manuscript.


   FOOTNOTES
 
Present address for M.D.: Department of Pharmacology, Southern Illinois University School of Medicine, Springfield, Illinois 62794.

Present address for J.-M.C.: Division of Hematology and Oncology, Department of Internal Medicine, Southern Illinois University School of Medicine, Springfield, Illinois 62794.

Present address for S.O.: Institute for Animal Experimentation, Tohoku University Graduate School of Medicine, Aoba-ku, Sendai 980-8575, Japan.

Present address for A.A.: Laboratory of Veterinary Biochemistry, School of Veterinary Medicine, Faculty of Agriculture, Tottori University, Tottori 680-8553, Japan.

Disclosure Summary: The authors have nothing to disclose.

First Published Online April 24, 2007

Abbreviations: CCK, Cholecystokinin; CF-8, coagulation factor VIII; FSHR, FSH receptor; F, forward; FL, FLAG; GP1BA, glycoprotein 1b {alpha} polypeptide; grt, growth-retarded; PAPS, 3'-phosphoadenosine 5'-phosphosulfate; PAS, periodic acid schiff; PSGL1, P-selectin glycoprotein ligand-1; R, reverse; RFLP, restriction fragment length polymorphism; TG, transgenic; TPST, tyrosylprotein sulfotransferases; TSHR, TSH receptor; WT, wild type.

Received for publication January 22, 2007. Accepted for publication April 3, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Kopp P 2002 Perspective: genetic defects in the etiology of congenital hypothyroidism. Endocrinology 143:2019–2024[Abstract/Free Full Text]
  2. Refetoff S 2003 Resistance to TSH. J Endocrinol Invest 26:770–779[Medline]
  3. Lafferty A, Schwarz S, DeFelice M, von Deimling A, van Landeghem F, DiLauro R, Gruters A 2002 Choreoathetosis, hypothyroidism, and pulmonary alterations due to human NKX2–1 haploinsufficiency. J Clin Invest 109:475–480[CrossRef][Medline]
  4. Pohlenz J, Dumitrescu A, Zundel D, Martine U, Schonberger W, Koo E, Weiss RE, Cohen RN, Kimura S, Refetoff S 2002 Partial deficiency of thyroid transcription factor 1 produces predominantly neurological defects in humans and mice. J Clin Invest 109:469–473[CrossRef][Medline]
  5. Clifton-Bligh RJ, Wentworth JM, Heinz P, Crisp MS, John R, Lazarus JH, Ludgate M, Chatterjee VK 1998 Mutation of the gene encoding human TTF-2 associated with thyroid agenesis, cleft palate and choanal atresia. Nat Genet 19:399–401[CrossRef][Medline]
  6. Macchia PE, Lapi P, Krude H, Pirro MT, Missero C, Chiovato L, Souabni A, Baserga M, Tassi V, Pinchera A, Fenzi G, Gruters A, Busslinger M, Di Lauro R 1998 PAX8 mutations associated with congenital hypothyroidism caused by thyroid dysgenesis. Nat Genet 19:83–86[CrossRef][Medline]
  7. Stein SA, Oates EL, Hall CR, Grumbles RM, Fernandez LM, Taylor NA, Puett D, Jin S 1994 Identification of a point mutation in the TSH receptor of the hyt/hyt hypothyroid mouse. Mol Endocrinol 8:129–138[Abstract]
  8. Kimura S, Hara Y, Pineau T, Fernandez-Salguero P, Fox CH, Ward JM, Gonzalez FJ 1996 The T/ebp null mouse: thyroid-specific enhancer-binding protein is essential for the organogenesis of the thyroid, lung, ventral forebrain, and pituitary. Genes Dev 10:60–69[Abstract/Free Full Text]
  9. De Felice M, Ovitt C, Biffali E, Rodriguez-Mallon A, Arra C, Anastassiadis K, Macchia PE, Mattei MG, Mariano A, Scholer H, Macchia V, Di Lauro R 1998 A mouse model for hereditary thyroid dysgenesis and cleft palate. Nat Genet 19:395–398[CrossRef][Medline]
  10. Mansouri A, Chowdhury K, Gruss P 1998 Follicular cells of the thyroid gland require Pax8 gene function. Nat Genet 19:87–90[CrossRef][Medline]
  11. Yoshida T, Yamanaka K, Atsumi S, Tsumura H, Sasaki R, Tomita K, Ishikawa E, Ozawa H, Watanabe K, Totsuka T 1994 A novel hypothyroid "growth-retarded" mouse derived from Snell’s dwarf mouse. J Endocrinol 142:435–446[Abstract]
  12. Tomita K, Yoshida T, Morita J, Atsumi S, Totsuka T 1995 In vivo responsiveness of thyroid glands to TSH in normal and novel "growth-retarded" mice: transient elevation in normal mice and impairment in "growth-retarded" mice. J Endocrinol 144:209–214[Abstract]
  13. Kobayashi K, Yamamoto H, Kobayashi T, Machida T 2001 Responses of the thyroid gland to TSH and other thyroid stimulators in the growth retarded (grt) mouse. Zool Sci 18:955–961[CrossRef]
  14. Agui T, Miyamoto T, Tsumura H, Yoshida T 1997 Mapping of the grt locus to mouse chromosome 5. Mamm Genome 8:944[Medline]
  15. Costagliola S, Panneels V, Bonomi M, Koch J, Many MC, Smits G, Vassart G 2002 Tyrosine sulfation is required for agonist recognition by glycoprotein hormone receptors. EMBO J 21:504–513[CrossRef][Medline]
  16. Postiglione MP, Parlato R, Rodriguez-Mallon A, Rosica A, Mithbaokar P, Maresca M, Marians RC, Davies TF, Zannini MS, De Felice M, Di Lauro R 2002 Role of the thyroid-stimulating hormone receptor signaling in development and differentiation of the thyroid gland. Proc Natl Acad Sci USA 99:15462–15467[Abstract/Free Full Text]
  17. Marians RC, Ng L, Blair HC, Unger P, Graves PN, Davies TF 2002 Defining TSH-dependent and -independent steps of thyroid hormone synthesis by using TSH receptor-null mice. Proc Natl Acad Sci USA 99:15776–15781[Abstract/Free Full Text]
  18. Cheng JM, Ding M, Miyamoto T, Fujimori O, Agui T 2002 Investigation of post-transcriptional events of the thyroglobulin in the thyroid gland of the hypothyroid growth-retarded mouse DW/J-grt. Nagoya Med J 45:133–143
  19. Dong JF, Li CQ, Lopez JA 1994 Tyrosine sulfation of the glycoprotein Ib-IX complex: identification of sulfated residues and effect on ligand binding. Biochemistry 33:13946–13953[CrossRef][Medline]
  20. Leyte A, van Schijndel HB, Niehrs C, Huttner WB, Verbeet MP, Mertens K, van Mourik JA 1991 Sulfation of Tyr1680 of human blood coagulation factor VIII is essential for the interaction of factor VIII with von Willebrand factor. J Biol Chem 266:740–746[Abstract/Free Full Text]
  21. Vargas F, Frerot O, Tuong MD, Zuzel K, Rose C, Schwartz JC 1985 Sulfation and desulfation of cerebral cholecystokinin. Ann NY Acad Sci 448:110–120[Abstract]
  22. Pouyani T, Seed B 1995 PSGL-1 recognition of P-selectin is controlled by a tyrosine sulfation consensus at the PSGL-1 amino terminus. Cell 83:333–343[CrossRef][Medline]
  23. Ouyang Y, Lane WS, Moore KL 1998 Tyrosylprotein sulfotransferase: purification and molecular cloning of an enzyme that catalyzes tyrosine O-sulfation, a common posttranslational modification of eukaryotic proteins. Proc Natl Acad Sci USA 95:2896–2901[Abstract/Free Full Text]
  24. Ouyang YB, Moore KL 1998 Molecular cloning and expression of human and mouse tyrosylprotein sulfotransferase-2 and a tyrosylprotein sulfotransferase homologue in Caenorhabditis elegans. J Biol Chem 273:24770–24774[Abstract/Free Full Text]
  25. Seibert C, Cadene M, Sanfiz A, Chait BT, Sakmar TP 2002 Tyrosine sulfation of CCR5 N-terminal peptide by tyrosylprotein sulfotransferases 1 and 2 follows a discrete pattern and temporal sequence. Proc Natl Acad Sci USA 99:11031–11036[Abstract/Free Full Text]
  26. Ouyang YB, Crawley JT, Aston CE, Moore KL 2002 Reduced body weight and increased postimplantation fetal death in tyrosylprotein sulfotransferase-1-deficient mice. J Biol Chem 277:23781–23787[Abstract/Free Full Text]
  27. Dumont JE, Vassart G 1995 Thyroid regulation. In: DeGroot LJ, ed. Endocrinology. Philadelphia: W.B. Sanders; 543–559
  28. Borghei A, Ouyang YB, Westmuckett AD, Marcello MR, Landel CP, Evans JP, Moore KL 2006 Targeted disruption of tyrosylprotein sulfotransferase-2, an enzyme that catalyzes post-translational protein tyrosine O-sulfation, causes male infertility. J Biol Chem 281:9423–9431[Abstract/Free Full Text]
  29. Amendola E, De Luca P, Macchia PE, Terracciano D, Rosica A, Chiappetta G, Kimura S, Mansouri A, Affuso A, Arra C, Macchia V, Di Lauro R, De Felice M 2005 A mouse model demonstrates a multigenic origin of congenital hypothyroidism. Endocrinology 146:5038–5047[Abstract/Free Full Text]
  30. Castanet M, Lyonnet S, Bonaiti-Pellie C, Polak M, Czernichow P, Leger J 2000 Familial forms of thyroid dysgenesis among infants with congenital hypothyroidism. N Engl J Med 343:441–442[Free Full Text]
  31. Strott CA 2000 Sulfonation and molecular action. Endocr Rev 27:703–732
  32. Beisswanger R, Corbeil D, Vannier C, Thiele C, Dohrmann U, Kellner R, Ashman K, Niehrs C, Huttner WB 1998 Existence of distinct tyrosylprotein sulfotransferase genes: molecular characterization of tyrosylprotein sulfotransferase-2. Proc Natl Acad Sci USA 95:11134–11139[Abstract/Free Full Text]
  33. Jannini EA, Ulisse S, D’Armiento M 1995 Thyroid hormone and male gonadal function. Endocr Rev 16:443–459[CrossRef][Medline]
  34. Kumar PN, Aruldhas MM, Juneja SC 1994 Influence of hypothyroidism induced at prepuberty on epididymal lipids and the number and motility of spermatozoa in rats. Int J Androl 17:262–270[Medline]
  35. Chandrasekhar Y, Holland MK, D’Occhio MJ, Setchell BP 1985 Spermatogenesis, seminal characteristics and reproductive hormone levels in mature rams with induced hypothyroidism and hyperthyroidism. J Endocrinol 105:39–46[Abstract]
  36. Kehoe JW, Bertozzi CR 2000 Tyrosine sulfation: a modulator of extracellular protein-protein interactions. Chem Biol 7:R57–R61
  37. Moore KL 2003 The biology and enzymology of protein tyrosine O-sulfation. J Biol Chem 278:24243–24246[Free Full Text]
  38. Huttner WB 1988 Tyrosine sulfation and the secretory pathway. Annu Rev Physiol 50:363–376[CrossRef][Medline]
  39. Reineke U, Volkmer-Engert R, Schneider-Mergener J 2001 Applications of peptide arrays prepared by the SPOT-technology. Curr Opin Biotechnol 12:59–64[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
21/7/1713    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sasaki, N.
Right arrow Articles by Agui, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sasaki, N.
Right arrow Articles by Agui, T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals