Molecular Endocrinology, doi:10.1210/me.2006-0101
Molecular Endocrinology 21 (8): 1861-1876
Copyright © 2007 by The Endocrine Society
The HER4 Cytoplasmic Domain, But Not Its C Terminus, Inhibits Mammary Cell Proliferation
Shu-Mang Feng,
Carolyn I. Sartor,
Debra Hunter,
Hong Zhou,
Xihui Yang,
Laura S. Caskey,
Ruth Dy,
Rebecca S. Muraoka-Cook and
H. Shelton Earp, III
University of North Carolina Lineberger Comprehensive Cancer Center (S.-M.F., C.I.S., D.H., H.Z., X.Y., L.S.C., R.D., R.S.M.-C., H.S.E.), Department of Radiation Oncology (C.I.S.), Department of Genetics (R.S.M.-C.), and Department of Medicine and Pharmacology (H.S.E.), University of North Carolina at Chapel Hill, School of Medicine, Chapel Hill, North Carolina 27599
Address all correspondence and requests for reprints to: H. Shelton Earp, III, Lineberger Comprehensive Cancer Center, University of North Carolina Chapel Hill, 102 Mason Farm Road, Chapel Hill, North Carolina 27599. E-mail: hse{at}med.unc.edu.
 |
ABSTRACT
|
|---|
Unlike the proliferative action of other epidermal growth factor (EGF) receptor family members, HER4/ErbB4 is often associated with growth-inhibitory and differentiation signaling. These actions may involve HER4 two-step proteolytic processing by intramembraneous
-secretase, releasing the soluble, intracellular 80-kDa HER4 cytoplasmic domain, s80HER4. We demonstrate that pharmacological inhibition of either
-secretase activity or HER4 tyrosine kinase activity blocked heregulin-dependent growth inhibition of SUM44 breast cancer cells. We next generated breast cell lines stably expressing GFP-s80HER4 [green fluorescent protein (GFP) fused to the N terminus of the HER4 cytoplasmic domain, residues 676-1308], GFP-CTHER4 (GFP fused to N terminus of the HER4 C-terminus distal to the tyrosine kinase domain, residues 989-1308), or GFP alone. Both GFP-s80HER4 and GFP-CTHER4 were found in the nucleus, but GFP-s80HER4 accumulated to a greater extent and sustained its nuclear localization. s80HER4 was constitutively tyrosine phosphorylated, and treatment of cells with a specific HER family tyrosine kinase inhibitor 1) blocked tyrosine phosphorylation; 2) markedly diminished GFP-s80HER4 nuclear localization; and 3) reduced signal transducer and activator of transcription (STAT)5A tyrosine phosphorylation and nuclear localization as well as GFP-s80HER4:STAT5A interaction. Multiple normal mammary and breast cancer cell lines, stably expressing GFP-s80HER4 (SUM44, MDA-MB-453, MCF10A, SUM102, and HC11) were growth inhibited compared with the same cell line expressing GFP-CTHER4 or GFP alone. The s80HER4-induced cell number reduction was due to slower growth because rates of apoptosis were equivalent in GFP-, GFP-CTHER4-, and GFP-s80HER4-expressing cells. Lastly, GFP-s80HER4 enhanced differentiation signaling as indicated by increased basal and prolactin-dependent ß-casein expression. These results indicate that surface HER4 tyrosine phosphorylation and ligand-dependent release of s80HER4 are necessary, and s80HER4 signaling is sufficient for HER4-dependent growth inhibition.
 |
INTRODUCTION
|
|---|
DROSOPHILIA AND Caenorhabitis elegans genomesencode a single epidermal growth factor (EGF) receptor-like molecule. Depending upon the cellular context and the expression of ligand or other accessory molecules, the single epidermal growth factor receptor (EGFR) enhances cell proliferation or inhibits growth and stimulates differentiation (1). Mammalian genomes contain four members of this receptor tyrosine kinase family: EGFR/HER1/ErbB1, HER2/ErbB2, HER3/ErbB3, and HER4/ErbB4. These four members, together with at least 10 ligands from two ligand families [the epidermal growth factor (EGF) and heregulin/neuregulin families], regulate numerous cellular functions, the most studied of which is proliferation but also include cell survival, motility, adhesion, differentiation, and cell cycle inhibition (2, 3, 4, 5, 6). This complexity is due, in part, to the multiple ligands, which bind to receptors to produce receptor homodimers or heterodimers, with virtually all potential combinations of the four receptors. These activated receptor complexes stimulate well-known signaling cascades, including the Ras-Raf MAPK pathway and the phosphatidylinositol 3-kinase pathway (2, 3, 4, 5, 6). However, multiple other signaling pathways must be involved to achieve the diversity of biological outcomes.
All four family members are expressed in breast epithelium and in many breast cancers. The EGFR, HER2 and HER3, appear, in general, to be involved in breast epithelial cell proliferation (3). In the mouse EGFR, HER2 and HER3 regulate mammary epithelial cell proliferation during puberty, whereas HER4 is activated during late pregnancy and lactation and signals for differentiation (7, 8, 9). EGFR and HER2 have been studied extensively in experimental breast cancer models, as well as in human breast cancer samples. HER2 and EGFR overexpression or activation is associated with poor prognosis breast cancer, and molecular therapies targeting EGFR or HER2 have gained attention and, in some instances, success for the treatment of human breast cancer (3, 4, 5, 10).
HER4 was the last member of the family identified (11), and its relationship to breast cancer prognosis is still being defined (12). Most studies correlate HER4 expression with estrogen receptor positivity, lower tumor grade, and a better prognosis (13, 14, 15, 16), but some studies report a poorer prognosis in subsets of HER4-positive breast cancers (17, 18). Newer findings regarding HER4 isoforms and their unique signaling and cellular processing may eventually explain these discrepancies in clinical correlation. HER4 RNA is alternatively spliced to yield four isoforms that may vary in signaling capability (19, 20, 21). Just proximal to the transmembrane region, an alternative splice creates the JM-a or JM-b isoform. JM-a, but not JM-b, is susceptible to proteolytic cleavage by TNF
-converting enzyme (TACE) (22, 23). Several groups have shown that cleavage by TACE releases the extracellular domain and leads to a stochastic, second intramembrane cleavage event, performed by a
-secretase-like molecule of the presenilin family (24, 25). This type of cleavage is characteristic of Notch, another transmembrane protein involved in growth and differentiation signaling (24). TACE leaves a membrane-associated m80 kDaHER4, whereas the second,
-secretase intramembraneous cleavage, releases the 80-kDa domain into the cytoplasm. Once released, three canonical nuclear localization sequences (NLS) and three nuclear export sequences (NES) can result in appearance of s80HER4 in the nucleus of tested cells (25).
Our group and others have shown that, in many HER4-expressing breast cells, heregulin treatment inhibits cell growth and can induce differentiation (26, 27, 28, 29, 30, 31). Data from genetically engineered mice also suggest that HER4 is involved in mammary cell differentiation (9, 32) because mammary-specific HER4 gene deletion or inhibition by dominant-negative HER4 expression retards mammary gland development and function. In contrast to studies demonstrating HER4-dependent growth inhibition, some reports show that HER4 activation can stimulate growth and cell survival (33, 34, 35), although several of these reports used other HER4 isoforms that may have distinct properties. How HER4 proteolytic processing impacts growth inhibition, differentiation, or proliferation signaling, and how it may relate to tumor suppression progression or prognosis remains to be fully elucidated. Immunostaining, using C-terminal HER4 antibodies, reveals HER4 (presumably s80HER4) in the nucleus of normal human and mouse mammary cells, and nuclear HER4 has been detected by immunohistochemistry in breast cancer samples. In most, but not all, studies, nuclear HER4 staining correlates with a better prognosis (16, 36, 37).
The initial reports describing the sequential cleavage of HER4 by TACE and
-secretase demonstrated its importance for growth inhibition of T47D breast cancer cells. But TACE and
-secretase have also been reported to involve the cleavage of a number of other proteins including Notch (24), E-cadherin (38), CD44 (39), nectin-1
(40), and syndecan 3 (41), which may also influence mammary cells. Evidence of growth inhibition by the s80HER4 Cyt1 isoform across a range of normal and neoplastic breast cells is still lacking. In addition, several reports examining gene transactivation indicated that the HER4 C terminus (beyond the tyrosine kinase domain) (25, 42) and the C terminus of the EGFR (43) or HER2 (44), when fused to GAL4 DNA binding domain, are capable of stimulating GAL4 transactivation. This leaves open the possibility that the distal C terminus may be the active moiety in nuclear HER4 signaling.
To further study the biological signaling capabilities of the intracellular HER4 fragments, we have stably introduced GFP-tagged s80HER4 or the GFP-tagged HER4 C terminus (the last 320 amino acids) into multiple normal mammary epithelial cells and breast cancer cells. We report that s80HER4 is constitutively tyrosine phosphorylated. In addition, the full cytoplasmic domain, s80HER4, which is kinase active, but not the HER4 C terminus, inhibited cell proliferation, transactivated the promoter for the mammary specific gene, ß-casein, and increased basal and prolactin-dependent ß-casein mRNA expression. s80HER4-dependent growth inhibition was due to slower growth rather than apoptosis. s80HER4 accumulated in the nucleus to a greater extent than CTHER4, and inhibition of s80HER4 kinase activity diminished its nuclear localization and interaction with STAT5A, as well as tyrosine phosphorylation and nuclear localization of STAT5A.
 |
RESULTS
|
|---|
-Secretase Inhibition Abolishes Heregulin-Dependent SUM44 Cell Growth Inhibition
We previously showed that both heregulin and heparin-binding EGF (HB-EGF) inhibited the growth of SUM44 and other HER4-expressing breast cancer cells (31). Because SUM44 cells do not express EGFR and selective loss of HER2, HER3 tyrosine phosphorylation does not block the growth-inhibitory action of ligand, HER4 is responsible for transmitting this signal (31, 45). However, because a unique cellular processing scheme for certain HER4 isoforms has been described, the role of HER4 processing needs to be examined. This ligand-dependent, two-step proteolytic process releases the 80-kDa HER4 intracellular domain (s80HER4) into the cytoplasm. The cleavable isoform, JM-a, is expressed in SUM44 and could be subject to the extracellular domain cleavage performed by a TACE-like activity (22, 23, 46), followed by a second intramembranous cleavage, performed by a
-secretase-like intramembraneous enzyme (25, 47). To determine whether surface HER4 or intracellularly released s80HER4 is responsible for growth inhibition, we assessed whether HER4 cleavage and s80HER4 formation were required for this heregulin-dependent action. We first preincubated SUM44 with 100 nM hydroxyethylene dihydropeptide isostere (HEDI), a commercially available
-secretase inhibitor, for 1 h before adding heregulin (10 ng/ml). Heregulin treatment diminished the increase of SUM44 cell number over a 6-d culture period by approximately 50%; however, incubation with the
-secretase inhibitor abolished this antiproliferative effect (Fig. 1
). Similar results were obtained by Carpenter and co-workers (25), using the
-secretase inhibitor compound E in T47D breast cancer cells. Thus,
-secretase activity is necessary for heregulin-dependent growth inhibition, but it remained formally possible that the
-secretase activity blockade inhibited another signaling pathway (e.g. Notch, E-cadherin, or syndecan 3 cleavage) and not the HER4 cytoplasmic domain release.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 1. Inhibition of -Secretase Blocks Heregulin-Induced Growth Inhibition
SUM44 cells grown in fully complemented medium were treated with heregulin (10 ng/ml) or not in the presence or absence of HEDI at the concentrations shown for 6 d and then counted. Mean ± SD of triplicates are shown, representative of three independent experiments. Students t test was used for statistical analysis. ***, P < 0.001 vs. control.
|
|
Inhibition of HER4 Tyrosine Phosphorylation Blocks the Heregulin-Dependent Antiproliferative Effect
The process by which s80HER4 formation is regulated by ligand is not fully elucidated. Treatment of several cell lines with the phorbol ester, tetradecaonylphorbol-13-acetate, induces TACE-dependent HER4 extracellular domain cleavage, leaving the transmembrane anchor and a membrane-bound 80-kDa HER4 (m80HER4) (22, 48). This species, at some rate, is released as s80HER4 by
-secretase cleavage at a valine residue just inside the cytoplasmic membrane surface (25, 47). Presumably, ligand-dependent (heregulin, HB-EGF, etc.) release of s80HER4 also requires TACE activation, followed by
-secretase cleavage. The ligand-dependent cleavage process is either inefficient or subject to other control mechanisms, because ligand-dependent HER4 activation leaves the majority of HER4 at the cell surface as 180-kDa holoenzyme for 4 or more hours (data not shown). Thus, inhibition of HER4 tyrosine kinase activation could block heregulin-dependent antiproliferative effects, either by preventing ligand-dependent s80HER4 release or by inhibiting a necessary, sustained tyrosine kinase-dependent HER4 action at the cell surface, or both.
We investigated the necessity of HER4 tyrosine kinase activation in growth inhibition by incubating SUM44 cells for 60 min with the pan-EGFR family inhibitor, GW572016 (lapatinib), before addition of heregulin. In SUM44 cells (which do not express the EGFR), incubation with increasing doses of GW572016 resulted in inhibition of heregulin-dependent tyrosine phosphorylation of HER2, HER3, and HER4, all at similar doses, with near-maximal inhibition at 1.0 µM (Fig. 2A
). This dose was used in SUM44 growth studies, and experiments demonstrated that 1.0 µM GW572016, incubated with cells for 6 d, nearly abolished heregulin-dependent growth inhibition (Fig. 2B
). Taken with previous findings that HER4 homodimers mediate heregulin-induced growth inhibition, these results suggest that HER4 tyrosine phosphorylation is necessary for the growth-inhibitory effects of HER4. Therefore, both tyrosine phosphorylation of HER4 and a
-secretase-sensitive step appear necessary for HER4 growth inhibition.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 2. Inhibition of HER4 Tyrosine Phosphorylation Blocks Heregulin-Induced Growth Inhibition
A, SUM44 cells were cultured for 6 d, treated with different doses of GW572016 for 1 h, and then with or without heregulin (10 ng/ml) for 15 min. The cells were lysed and the lysates were immunoprecipitated with anti-HER2, anti-HER3, or anti-HER4 antibody and blotted with antiphosphotyrosine antibody. B, SUM44 cells were grown with or without heregulin (10 ng/ml) in the presence or absence of GW572016 (1 µM) for 6 d, at which time the number of cells was counted. Mean ± SD of triplicates are shown, representative of three experiments. ***, P < 0.001 vs. control. IB, Immunoblotting; IP, immunoprecipitation; pY, phosphotyrosine.
|
|
Ectopic Expression of GFP-s80HER4 and GFP-CTHER4
Because
-secretase mediates release of s80HER4, and because inhibition of
-secretase impaired heregulin-mediated growth inhibition, we studied whether s80HER4 could transduce the HER4 antiproliferative effects in experiments that used the following constructs: 1) GFP-CTHER4, which consists of GFP fused at the N terminus of the HER4 carboxy terminus (residues 989-1308); 2) GFP-s80HER4, GFP fused at the N terminus of the entire HER4 cytoplasmic domain (residues 676-1308); and 3) GFP alone (Fig. 3A
, schematic). We chose to place GFP at the N terminus to avoid fusion to the HER4 C-terminal postsynaptic density-95/discs large/ZO-1 homology domain binding motif, which may play a role in HER4 action. Note that GFP-CTHER4 lacks the kinase domain. These three constructs were cloned into pMSCV vector and packaged as retroviruses with vesicular stomatitis virus glycoprotein (VSVG) coat proteins to enhance infectivity of epithelial cells. After infection and selection of pooled clones of stably transduced cells with puromycin, the level of expression was determined by immunoblotting SUM44 cell lysates with GFP antibody (Fig. 3B
). GFP was expressed at high levels; GFP-CTHER4 and GFP-s80HER4 were expressed at lower but similar levels. Immunoprecipitation of HER4 with a polyclonal antibody directed at the HER4 C-terminus, followed by immunoblotting with antiphosphotyrosine antibody, demonstrated that GFP-s80HER4 was constitutively tyrosine phosphorylated, whereas GFP-CTHER4 was not (Fig. 3C
). Carpenter and co-workers (49) have also recently reported that s80HER4 is constitutively tyrosine phosphorylated, and can homodimerize.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3. Ectopic Expression of GFP-s80HER4 and GFP-CTHER4
A, Schematic representation of full-length HER4, GFP, GFP-CTHER4, and GFP-s80HER4. B, Western analysis using anti-GFP antibody of lysates from SUM44 cells infected with retrovirus encoding GFP, GFP-CTHER4, or GFP-s80HER4. C, SUM44 cells stably expressing GFP, GFP-CTHER4, or GFP-s80HER4 were treated with or without heregulin (10 ng/ml) for 15 min and lysed. The lysates were immunoprecipitated with anti-HER2, anti-HER3, or anti-HER4 antibody and blotted with anti-HER2, anti-HER3, or anti-HER4 antibody, respectively, or with antiphosphotyrosine antibody. D, HC11 cells stably expressing GFP, GFP-CTHER4, or GFP-s80HER4 were treated ± increasing concentrations of GW572016 for 1 h (top panel), or treated with different concentrations of GW572016 for 1 h, and then ± heregulin (10 ng/ml) for 15 min (bottom panel), and lysed. The lysates were immunoprecipitated with anti-HER4 antibody and blotted with antiphosphotyrosine antibody. E, COS-7 cells were transfected with full-length HER4 or GFP-s80HER4. Twenty-four hours after transfection, the cells were treated ± increasing concentrations of GW572016 for 1 h, lysed, and analyzed for the level of tyrosine phosphorylation of HER4 or GFP-s80HER4 by using antiphosphotyrosine antibody, and analyzed for the level of HER4 or GFP-s80HER4 by using anti-HER4 antibody. Densitometry is shown in arbitrary units. IB, Immunoblotting; IP, immunoprecipitation; pY, phosphotyrosine; TM, transmembrane.
|
|
Next, we determined whether expression of the three constructs altered the ligand-independent or ligand-dependent phosphorylation of HER2, HER3, and HER4. In the absence of heregulin, there was little to no basal tyrosine phosphorylation of the three endogenous full-length receptors. Addition of heregulin induced tyrosine phosphorylation of full-length HER2, HER3, and HER4 in cells expressing GFP-s80HER4, GFP-CTHER4, or GFP (Fig. 3C
). Thus, the phosphorylation level of the cell surface, transmembrane HER4 is not altered by expression of either the constitutively tyrosine phosphorylated, presumably dimeric, kinase-active GFP-s80HER4 or GFP-CTHER4, which lacks the kinase domain. Figure 3C
shows that membrane HER2, HER3, and HER4 were expressed and ligand-dependent tyrosine phosphorylated at approximately similar levels. The protein levels of s80HER4 and GFP-CTHER4 were somewhat greater than that of endogenous HER4. CT was not phosphorylated, but s80HER4 was constitutively tyrosine phosphorylated at levels slightly less than that of ligand activated endogenous 180-kDa HER4. This indicates that the s80HER4 kinase is less active or less efficiently dimerized in this cellular contest. More importantly, Fig. 3
demonstrates that in these stably transfected cell lines, s80HER4 was not functionally overexpressed and that the biological effects described below do not result from substantial overexpression of exogenous s80HER4 kinase.
We made five distinct breast cell lines stably expressing GFP-CTHER4 or GFP-s80HER4 to test the ability of s80HER4 and the HER4 C terminus (without kinase) to alter growth. Having demonstrated that GW572016 can inhibit HER4 in SUM44, we used the mouse mammary immortalized but nonneoplastic cell line, HC11, to determine whether GW572016 could inhibit heregulin-dependent, full-length HER4 tyrosine phosphorylation and s80HER4 constitutive tyrosine phosphorylation. GW572016 inhibited both full-length HER4 and s80HER4 tyrosine phosphorylation in a similar dose-dependent manner (Fig. 3D
). To confirm this, we expressed both HER4 and s80HER4 at a similar level by transient expression in COS-7 cells and examined the relative inhibition by GW572016. The results showed that full-length HER4 and s80HER4 were similarly inhibited by this pan-EGFR family inhibitor (Fig. 3E
).
Subcellular Localization of GFP, GFP-CTHER4, and GFP-s80HER4
The localization of GFP, GFP-CTHER4, and GFP-s80HER4 was examined using both live cell (GFP) and fixed cell analysis. Using live cell microscopy (Fig. 4A
), it was observed that GFP and GFP-CTHER4 were distributed in cytoplasm and nuclei of HC11 cells, whereas GFP-s80HER4 was more concentrated in nuclei. Confocal microscopy (Fig. 4B
) confirmed that GFP-s80HER4 was strongly localized to nuclei whereas GFP and GFP-CTHER4 were distributed between the cytoplasm and nuclei. Addition of leptomycin B, an antibiotic that slows nuclear export, enhanced GFP-CTHER4 nuclear localization; GFP-s80HER4 was principally nuclear in the presence or absence of leptomycin B in HC11 cells.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 4. Localization of GFP, GFP-CTHER4, and GFP-s80HER4 in HC11 Cells
A, Live cell microscopy showing the localization of GFP fluorescence in HC11 cells stably expressing GFP, GFP-CTHER4, or GFP-s80HER4. Phase contrast is shown in lower panels. Bar, 100 µm, applies to each image. B, HC11 cells stably expressing GFP (a–c, j–l), GFP-CTHER4 (d–f, m–o), or GFP-s80HER4 (g–i, p–r), were treated without (a–i), or with (j–r) 20 ng/ml of leptomycin B for 24 h and then analyzed for GFP fluorescence by confocal microscopy. Subcellular distribution of GFP (a and j), GFP-CT (d and m), GFP-s80 (g and p), and DAPI (b, e, h, k, n, and q) were visualized and captured. The merged pictures were also shown (c, f, i, l, o, and r). Bar, 30 µm, applies to each image.
|
|
We performed similar analyses in GFP, GFP-CTHER4, and GFP-s80HER4 expressing SUM44 cells. Live cell microscopy of SUM44 cells expressing these constructs demonstrated that both GFP and GFP-CTHER4 appeared to be nearly equally distributed between the nucleus and cytoplasm. In contrast, GFP-s80HER4 accumulated to a greater degree in SUM44 cell nuclei (supplemental Fig. 1A, published as supplemental data on The Endocrine Societys Journals Online web site at http://mend.endojournals.org). Live cells show the variability of expression levels in the cell populations, especially in the GFP-CTHER4 and GFP-s80HER4 cell lines, even though all cells are maintained in puromycin to continue selective pressure. Examination of fixed SUM44 cells, using confocal microscopy (supplemental Fig. 1B), showed again that GFP and GFP-CTHER4 were diffusely distributed in the cytoplasmic and nuclear compartments, whereas GFP-s80HER4 was more intensely localized in nuclei. With the addition of leptomycin B, GFP-CTHER4 was more concentrated in SUM44 nuclei, whereas GFP-s80HER4 was again maintained in nuclei (supplemental Fig. 1B).
The results in HC11 and SUM44 cells indicate that GFP-s80HER4 is more often found in the nucleus than GFP or GFP-CTHER4, either by increased nuclear import or decreased nuclear export. It is clear that GFP-s80HER4 is not always nuclear, indicating that there are other processes that regulate this transport. In this study, we observed that overexpression of s80HER4 caused a change in cell shape in monolayer cultures of both SUM44 and HC11 cells; the mechanism for this change is unknown. In a previous study, we demonstrated that in three-dimensional matrigel culture, s80HER4 has profound effects on shape and lumen formation, presumably by sending differentiation signals (50).
Effects of s80HER4 Kinase Activity to Nuclear Localization and STAT5A Activity
To determine whether the s80HER4 tyrosine kinase activity affects nuclear-cytoplasmic shuttling of s80HER4, we incubated HC11 GFP-s80HER4 cells without or with 0.5 µM GW572016, a dose that does not abolish s80HER4 tyrosine phosphorylation, or with 5 µM GW572016, a dose sufficient to substantially reduce s80HER4 tyrosine phosphorylation (see Fig. 3
, D and E). As shown in Fig. 5A
, 0.5 µM GW572016 did not affect the localization of GFP-s80HER4, but 5 µM GW572016 dramatically reduced the nuclear accumulation of GFP-s80HER4, resulting in cytoplasmic accumulation. To test the specificity of GW572016 inhibition of nuclear localization, COS-7 cells were transfected with GFP-s80HER4, p53-GFP, or GFP-histone, and then treated without or with 10 µM GW572016 for 24 h. Again, as shown in Fig. 5B
, 10 µM GW572016 greatly reduced the nuclear localization of GFP-s80HER4, but had no effect on the nuclear localization of p53-GFP or GFP-histone (0.5 µM GW572016 did not affect the nuclear localization of GFP-s80HER4 in COS-7 cells, data not shown). Whether GW572016 has additional effects (other than HER4 tyrosine kinase inhibition) that regulate nuclear localization cannot be ruled out, but recent analyses showed that GW572016 is highly specific for the ErbB family (51) and the doses used do not alter the nuclear localization of p53 or histone.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 5. Effect of GW572016 on the Localization of GFP-s80HER4
A, HC11 cells stably expressing GFP-s80HER4 were treated without or with 0.5 µM or 5 µM GW572016 for 24 h. Cells on the coverslip were fixed, stained with DAPI, and then analyzed for GFP and DAPI fluorescence. The merged pictures were also shown. Bar, 30 µm, applies to each image. B, COS-7 cells were transfected with GFP-s80HER4, p53-GFP, or GFP-histone, and treated without or with 10 µM GW572016 for 24 h. Then, the cells were fixed, stained with DAPI, and analyzed for GFP and DAPI fluorescence. The merged pictures were also shown. Bar, 30 µm, applies to each image.
|
|
It has been reported that: 1) HER4 and STAT5A are essential for breast development and lactation (9, 32); 2) HER4 and STAT5A coimmunoprecipitate (52); and 3) s80HER4 and STAT5A colocalize in nuclei (50, 53). We determined whether GW572016 inhibition affected the coimmunoprecipitation of GFP-s80HER4 and STAT5A in cotransfected cells, and whether GW572016 affected STAT5A tyrosine phosphorylation and nuclear localization. Figure 6A
shows that GFP-CTHER4 did not associate with STAT5A, whereas GFP-s80HER4 did. GW572016 (5 µM and 10 µM) greatly decreased the tyrosine phosphorylation of GFP-s80HER4 and resulted in the decrease of the coimmunoprecipitation of GFP-s80HER4 and STAT5A. Furthermore, 5 µM and 10 µM GW572016 decreased s80HER4 and STAT5A tyrosine phosphorylation (Fig. 6B
), whereas 0.5 µM GW572016 did not. Lastly, 5 µM GW572016 decreased nuclear localization of STAT5A in HC11 s80HER4-expressing cells (0.5 µM GW572016 did not alter nuclear STAT5A localization; data not shown). These results indicate that s80HER4 kinase activity can regulate STAT5A localization. As can be seen in Fig. 3E
, 5 µM GW572016 decreases GFP-s80HER4 expression minimally, but the decrement in tyrosine phosphorylation, and thus STAT5A nuclear localization, is much greater. When 10 µM GW572016 was used, s80HER4 expression was suppressed by approximately 25%, but tyrosine phosphorylation was almost totally abolished. Thus, GW572016 at high doses may have off-target effects, but the kinase inhibition and STAT5A changes were seen at doses below this.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 6. Effect of GW572016 on STAT5A and GFP-s80HER4 Coimmunoprecipitation, STAT5A Tyrosine Phosphorylation, and STAT5A Nuclear Localization
A, COS-7 cells were cotransfected with STAT5A and GFP-CTHER4 or STAT5A and GFP-s80HER4, and treated without or with increasing concentrations of GW572016 for 40 h. Cells were lysed with regular lysis buffer (137 mM NaCl), and lysates were immunoprecipitated with anti-HER4 or anti-STAT5 antibody. Immunoprecipitates were subject to gel electrophoresis and transferred and blotted with anti-HER4, anti-STAT5, or antiphosphotyrosine antibody as indicated. B, COS-7 cells were co-transfected with GFP-s80HER4 and STAT5A, and treated without or with different concentrations of GW572016 for 40 h. Cells were lysed in high-salt (500 mM NaCl) lysis buffer, and the lysates were immunoprecipitated with anti-HER4 or anti-STAT5 antibody, electrophoresed, transferred, and blotted with antiphosphotyrosine, anti-STAT5, or anti-HER4 antibody. C, HC11 cells stably expressing GFP-s80HER4 were treated without or with GW572016 (5 µM) for 24 h. Cells were fixed and visualized for GFP or rhodamine (using a rhodamine-labeled second antibody after the first antibody-anti-STAT5). The merged pictures are also shown. Bar, 30 µm, applies to each image. IB, Immunoblotting; IP, immunoprecipitation.
|
|
Biological Action of GFP-s80HER4: Growth Inhibition of Multiple Breast Cell Lines
The majority of our studies have been performed in the SUM44 cell line, which exhibits a higher HER4 expression level than most breast cancer lines. In our previously published survey, SUM44 had the most robust heregulin-dependent growth inhibition of human breast cell lines tested (31). Having shown in Figs. 1
and 2
that pharmacological inhibition of
-secretase and HER4 tyrosine kinase activity abrogated heregulin-dependent growth inhibition, we determined whether constitutive expression of s80HER4 would result in ligand-independent growth inhibition. First, a time course of cell growth using SUM44 cells stably expressing GFP, GFP-CTHER4, and GFP-s80HER4 showed slower growth of SUM44 s80HER4 cells at 7 d (Fig. 7A
). Multiple replicates of this experiment demonstrated that constitutive GFP-s80HER4 expression resulted in a statistically significant 50% decrease in growth rate, compared with cells expressing GFP and GFP-CTHER4 (Fig. 7B
). The extent of growth inhibition was similar to that seen with the addition of heregulin to parental SUM44 cells (Fig. 1
and Ref. 31). To determine whether this effect was limited to SUM44 cells, we stably expressed GFP, GFP-CTHER4, and GFP-s80HER4 in the following lines: MDA-MB-453 and SUM102 cells, both of which are human breast cancer cell lines with low-level or absent HER4 expression, respectively; a nontransformed human mammary cell line, MCF10A; and the nontransformed mouse mammary epithelial cell line, HC11. Figure 7C
shows cell growth comparisons for each line, stably expressing GFP, GFP-CTHER4, or GFP-s80HER4. In each instance, growth rates in GFP and GFP-CTHER4 were similar; expression of GFP-s80HER4 reduced growth by approximately 50%. Thus, the tyrosine kinase domain-bearing s80HER4 mimics growth inhibition observed with heregulin treatment in HER4-expressing cells.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 7. Ectopic Expression of GFP-s80HER4, But Not GFP-CTHER4, Decreases Cell Proliferation
A, Time course of cell proliferation of SUM44 cells stably expressing GFP, GFP-CTHER4, or GFP-s80HER4. SUM44 cells (5000 cells per well) stably expressing GFP, GFP-CTHER4, or GFP-s80HER4 were plated in 96-well plates and cultured. At indicated time points, the relative cell numbers (OD values) were measured using MTS assay. Percentage increased OD value at each time point over the 20-h time point are shown (mean ± SEM of triplicates). B, Cell proliferation of SUM44 cells stably expressing GFP, GFP-CTHER4, or GFP-s80HER4 after 7 d incubation. The percentages of increased OD value at the end of the incubation (7 d) to that at 20 h are shown. The error bar represented SEM of five independent experiments, each analyzed in triplicate. Students t test was used for statistical analysis. ***, P < 0.001 vs. GFP control. C, MTS assays showing cell proliferation of MDA-MB-453, MCF10, HC11, and SUM 102 cells stably expressing GFP, GFP-CTHER4, or GFP-s80HER4. OD values of the cells stably expressing GFP, GFP-CTHER4, or GFP-s80HER4 were determined at 20 h and the end of the cell culture (MDA-MB-453, 5 d; MCF10A, 8 d; HC11, 3 d; SUM102, 4 d) using MTS assay. The percentages of increased OD value at the end of the incubation to that at 20 h are shown (the error bar represented SEM of triplicate samples). *, P < 0.05; **, P < 0.01 vs. GFP control.
|
|
The Antiproliferative Effects of GFP-s80HER4 Were Not Caused by Excess Apoptosis
Data of others suggest that transient transfection of s80HER4 results in decreased cell number by inducing caspace activity and apoptosis (54). We measured apoptosis in several cell lines in which stable expression of s80HER4 reduced cell number during 3- to 7-d growth experiments. SUM44 cells stably expressing GFP, GFP-CTHER4, or GFP-s80HER4 were cultured for 6 d in serum-free growth factor-defined media, and trypsinized, and equal cell numbers were used to detect histone-associated DNA fragment (apoptosis) using a sensitive ELISA assay. No statistically significant differences were detected in apoptosis rates between GFP, GFP-CTHER4, or GFP-s80HER4 cells. As a positive control, GFP-expressing cells were treated with 1.0 µM camptothecin for the final 24 h of the culture. Camptothecin increased apoptosis by 9-fold (Fig. 8A
). Similarly, HC11 cells, stably expressing GFP, GFP-CTHER4, or GFP-s80HER4, were plated and cultured in complete medium for 1 d, and then replaced with serum-free growth factor-defined medium and cultured for 2 d. Then the cells were trypsinized, and equal cell numbers were used to detect apoptosis. No difference in apoptotic rates was detected between the three HC11 lines. Camptothecin treatment again dramatically increased apoptosis in GFP-HC11 cells (Fig. 8B
). In both experiments, equal cell numbers were used, even though GFP-s80HER4 cells grew at half the rate, and the equal cell number represented a larger proportion of the culture. Still, rates of apoptosis were the same, suggesting that the expression of s80HER4 inhibits cell number increase by mechanisms other than stimulating apoptosis. Other experiments using cell lines stably or inducibly expressing s80HER4 have failed to show sub-2N DNA content on cell cycle analyses (45) or positive TUNEL (terminal deoxyuridine triphosphate) assays.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 8. Stable Expression of GFP-s80HER4 Does Not Induce Apoptosis
A, SUM44 cells stably expressing GFP, GFP-CTHER4, or GFP-S80HER4 were cultured in serum-free medium for 7 d. GFP-expressing cells were also treated with 1 µM of camptothecin (CAM) for 24 h before harvesting the cells as a positive control. Equal cell numbers were analyzed for apoptosis by ELISA, which quantitatively measures cytoplasmic histone-associated DNA fragments. Results are expressed as mean ± SEM of three independent experiments, each sample being analyzed in duplicate. Students t test was used for statistical analysis. **, P = 0.006 vs. GFP control. B, HC-11 cells stably expressing GFP, GFP-CTHER4 or GFP-S80HER4, were analyzed for apoptosis after 3 d as described above. A second plate of GFP expressing cells was treated with 1 µM of camptothecin for the final 24 h of the incubation. **, P = 0.04 vs. GFP control.
|
|
GFP-s80HER4, But Not GFP-CTHER4, Stimulates ß-Casein Promoter Activity and Protein Expression
Previous reports demonstrate that CTHER4, when fused to the GAL4 DNA binding domain, transactivated a GAL4 reporter system (25, 42). Data from other groups have shown that a similar C-terminal construct from EGFR and HER2 also transactivated the GAL4 promoter (43, 44). Recently, work showed that HER4, transfected with STAT5A, stimulated ß-casein promoter activity in MCF7B cells (53). In other work, we have demonstrated that ligand- and HER4-dependent ß-casein transcription is abrogated by preventing HER4 cleavage and s80HER4 production (50). To determine whether promoter activation is stimulated by CTHER4 or s80HER4, we transiently cotransfected parental HC11 cells with plasmids containing GFP, GFP-CTHER4, or GFP-s80HER4, and pß casein-lux, a reporter construct used to detect STAT5A-dependent gene expression (50), or pGL3 vector without ß-casein promoter as control. Whereas cotransfection with GFP or GFP-CTHER4 produced similar ß-casein promoter activity, cotransfection with GFP-s80HER4 increased luciferase transcription from the ß-casein promoter (Fig. 9A
). This indicates (using a mammary-specific promoter system) that the entire HER4 cytoplasmic domain is more effective than the HER4 C terminus at increasing transactivation. We next checked the ß-casein mRNA levels in HC11 cells stably expressing GFP, GFP-CTHER4, or GFP-s80HER4 using quantitative RT-PCR (qRT-PCR). In the basal state, ß-casein mRNA level in GFP-s80HER4-expressing cells was more than 5-fold above that in GFP or GFP-CTHER4 -expressing cells. Addition of 5 µg/ml of prolactin resulted in huge increases in all the HC11 cells, but GFP-s80HER4-expressing cells still produced approximately 2-fold more ß-casein mRNA above that seen in GFP or GFP-CTHER4-expressing cells (Fig. 9B
). Lastly, we showed that prolactin-stimulated ß-casein protein expression was greater in HC11 cells stably expressing GFP-s80HER4 (Fig. 9C
). The effect of tyrosine kinase-active s80HER4 on STAT5A dynamics and on ß-casein expression strongly suggests a role for s80HER4 in the events regulation of mammary cell differentiation.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 9. GFP-s80HER4, But Not GFP-CTHER4, Activates ß-Casein Promoter and Increases ß-Casein mRNA and Protein Expression
A, HC11 cells transfected with plasmids containing GFP, GFP-CTHER4, or GFP-S80HER4, and pßcasein-lux, a reporter construct in which a human ß-casein promoter was fused to the upstream of luciferase reporter gene, or pGL3 vector without ß-casein promoter, were lysed 48 h after transfection. The lysates were immunoprecipitated with anti-HER4 antibody and blotted with antiphosphotyrosine antibody, and anti-HER4 antibody (top panel). The lysates from above were also used to determine luciferase activity by luciferase assay system (Promega). Results are expressed as mean ± SEM of three independent experiments with each sample being analyzed in duplicate (bottom panel). Students t test was used for statistical analysis. ***, P < 0.001 vs. GFP control or GFP-CTHER4. B, ß-casein mRNA levels as determined by qRT-PCR. HC11 cells stably expressing GFP, GFP-CTHER4, or GFP-s80HER4 were cultured in normal culture medium for 2 d, changed to serum-free complemented medium containing 5 µg/ml insulin for 2 d, and then treated with or without 5 µg/ml prolactin in the complemented medium for 2 d. Total RNA was extracted and qRT-PCR was performed using ß-casein-specific fluorescence-labeled oligonucleotide probes (the error bar represented SEM of triplicate samples). **, P 0.01 vs. GFP control. C, HC11 cells stably expressing GFP, GFP-CTHER4, or GFP-s80HER4 were cultured as above and treated with or without 5 µg/ml prolactin in the complemented medium for 2 d. The cells were lysed, and the lysates were immunoblotted with anti-ß-casein or anti- -tubulin antibody. IB, Immunoblotting; IP, immunoprecipitation.
|
|
 |
DISCUSSION
|
|---|
The EGFR has been studied as the prototype for receptor tyrosine kinase proliferative signaling. The discovery that HER2/neu, the second member of the family, could be mutated to cause experimental carcinogenesis and was overexpressed in almost 20% of human breast cancers reinforced the idea that ErbB receptors regulate proliferation and, when activated, oncogenic progression. HER3/ErbB3 is often coexpressed with HER2 in human breast cancers and is implicated in proliferation and survival signaling.
HER4 is the one family member that has been associated with growth inhibition in many, but not all, cell culture models. We and others have used breast cancer cell lines under serum-free conditions to show that ligand-dependent activation of endogenous HER4 results in growth inhibition (25, 32) and, in responsive cells, a differentiation signal defined by the transcription of lactation genes (52). Our new results confirm the ability of HER4 to inhibit growth of breast cancer cells and demonstrate that the intracellular domain of HER4, s80HER4, is sufficient to confer growth inhibition to a wide range of breast cells. However, there are examples in which ectopic expression or activation of HER4 results in a proliferative rather than a growth-inhibitory response (37, 55); these have generally used nonbreast cell models or an alternative, spliced cytoplasmic HER4 isoform (Cyt2).
Answers to the conundrum of differential HER4 responses in different cell types is beginning to emerge, with several discoveries. The first [by Elenius and co-workers (19, 20, 21)] demonstrated multiple HER4 isoforms, resulting from alternative splicing in two regions, the extracellular juxtamembrane region (JM-a and JM-b) and a C-terminal insert region, CYT-1 (vs. CYT-2), that changes signaling capabilities (19, 20, 21). The second discovery [by Carpenters (25) and Kims (47) groups] was the finding that the JM-a isoform, which contains a TACE cleavage site, was susceptible to a second
-secretase cleavage. Our interest in HER4-dependent growth inhibition prompted us to look at the role of s80HER4 in that process.
Carpenters original report (25) suggested that T47D growth could be inhibited by the heregulin-induced production of s80HER4, and that the nuclear localization and nuclear export sequences, found uniquely in HER4 among members of the EGFR family, could bring s80HER4 to the nucleus. Jones and co-workers (53) showed that this translocation may result in cotranslocation of STAT5A with s80HER4 into the nucleus, with potential consequences for STAT5A-inducible genes. Additionally, a HER4 C terminus fusion protein, lacking the tyrosine kinase domain, was capable of transactivating a GAL4 promoter construct in cotransfection studies (25, 42). This is parallel to findings that a similar amino acid region in the C terminus of both EGFR and HER2 can likewise transactivate GAL4 in cotransfection assays (43, 44). It has been speculated that s80HER4 might be cleaved in the nucleus to yield a transactivating product without the tyrosine kinase domain (56).
Our current work extends these recent results, first by using the SUM44 cell, our major model of heregulin and HB-EGF-dependent growth inhibition, to show that
-secretase inhibition blocks the HER4 antiproliferative effect. Likewise, we show that inhibition of the tyrosine kinase activity, by GW572016, also blocks the antiproliferative effects. The blockade of heregulin-dependent HER4 tyrosine phosphorylation (e.g. in Figs. 2
and 3
) could inhibit signaling, either by blocking surface HER4 signaling or by inhibiting the production of s80HER4 by TACE and
-secretase. Although additional experiments are needed, our data suggest that s80HER4 can recapitulate ligand-dependent HER4 growth inhibition (Figs. 1
, 2
, and 7
). However, at physiological ligand and receptor levels, HER4-dependent growth inhibition may require both the production and action of s80HER4, as well as sustained HER4 cell surface tyrosine kinase activity.
Our data show that s80HER4 translocated and accumulated in the nucleus, in both live and fixed cells. We note that s80HER4 was not predominantly in the nucleus of every cell in which it was expressed, suggesting that there are complex mechanisms governing s80HER4 nuclear translocation. Tyrosine kinase activity appears to be at least one regulatory component, because GW572016 inhibition of s80HER4 constitutive tyrosine kinase activity dramatically impaired s80HER4s nuclear accumulation. This constitutive ligand-independent, transmembrane HER4-independent, s80HER4 tyrosine phosphorylation indicates that the GFP-s80HER4 fusion protein has tyrosine kinase activity, a finding recently confirmed by others (49). We have confirmed the importance of s80HER4 tyrosine kinase activity in nuclear localization by showing the site-directed mutant s80HER4 lacking kinase activity also fails to localize in HC11 nuclei (50).
Lastly, our data indicate that s80HER4 inhibits growth and can enhance a STAT5-mediated transcription process to a greater extent than the HER4 C-terminal fragment. In five different breast/mammary cell lines, the expression of s80HER4, but not CTHER4, resulted in substantial growth inhibition. Growth inhibition under the conditions tested was not due to increased apoptosis. Although published data suggest that specific sequences within the cytoplasmic domain of HER4 can activate caspaces and apoptosis (54), our data indicate that chronic s80HER4 expression results in slower growth, without increasing apoptosis. Transactivation by the HER4 C terminus, and other EGFR family C termini, has been shown by several groups, using a GAL4 promoter transactivation assay (25, 42). Our data indicate that the mammary gland ß-casein promoter is not effectively transactivated by CTHER4, whereas s80HER4, presumably in concert with STAT5A, can produce at least modest transactivation in this cotranfection assay. Taken together, our results suggest that s80HER4, rather than CTHER4, is the biologically relevant entity in breast cells.
We do not know how growth inhibition or differentiated gene expression is regulated by s80HER4, but evidence is accumulating that HER4 is a uniquely endowed receptor tyrosine kinase, one in which precisely regulated proteolysis releases the cytoplasmic domain with an intact kinase activity. The encoded nuclear localization and export sequences are unique for the EGFR family and result in cytoplasmic nuclear shuttling with the nuclear localization appearing to depend upon an active kinase. The released cytoplasmic kinase domain is capable of continuous autophosphorylation, presumably until some physiologically relevant process turns it off or destroys s80HER4. The localization gives an indication that signals important to a cells fate, growth inhibition, and differentiation are played out in the cell nucleus. Future challenges include understanding the consequences of s80HER4 in human breast cancers where it is detected in a number of cases and appears to correlate with good prognosis tumors.
 |
MATERIALS AND METHODS
|
|---|
Cell Lines and Cell Culture
SUM44 and SUM102 cells were grown in serum-free growth factor-defined media as previously described (31). MDA-MB-453 cells and MCF10A cells were obtained from American Type Culture Collection (Manassas, VA). MDA-MB-453 and COS-7 cells were grown in DMEM (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% fetal bovine serum (FBS). HC11 cells were grown in RPMI 1640 with 10% FBS plus 5 µg/ml insulin (Life Technologies), 10 ng/ml EGF (BD Biosciences, Bedford, MA), and antibiotics in a humidified incubator at 37 C with 5% CO2. All other cells were grown in a humidified incubator at 37 C with 10% CO2. Recombinant heregulin ß1 was a gift from Genentech, Inc. (South San Francisco, CA). HEDI and prolactin were obtained from Sigma-Aldrich (St. Louis, MO).
Cell Growth Assay
Heregulin and inhibitor effects on SUM44 cells were evaluated by counting cells via hemacytometer as previously described (31). The cell growth assays in Fig. 7
were performed as follows: 5000 cells per well were plated in a 96-well plate and cultured in serum-free growth factor-defined media at 37 C with 10% CO2. Cell number was analyzed using MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt] assay [CellTiter 96 Aqueous nonradioactive cell-proliferation assay kit (Promega Corp., Madison, WI)] according to manufacturers directions. Percentage increase = 100 x (ODend – OD20 h)/OD20 h.
Plasmid Construction and Transfection
The expression construct pLXSN-HER4 encoding full-length human HER4 (31) and pEGFP (CLONTECH Laboratories, Inc., Palo Alto, CA) were used as templates for PCR amplification using Pfu DNA polymerase (Stratagene, La Jolla, CA) to make constructs of GFP-CTHER4 (HER4 residues 989-1308) and GFP-s80HER4 (HER4 residues 676-1308) (Fig. 3A
). Both constructs were made by two overlapping PCRs. The primers generating GFP-CTHER4 were as follows: 5'-GFP, cggggtaccatggtgagcaagggcgaggag; 3'-GFP, aagcttcatacgatcatcacccttgtacagctcgtccatgcc; 5'-CT, ggcatggacgagctgtacaagggtgatgatcgtatgaagc; 3'-CT, cggggtaccttacaccacagtattcc. The PCR products initially subcloned into pCDNA3 vector (Invitrogen, Carlsbad, CA), and then subcloned into pMSCVpuro vector (CLONTECH). The primers generating GFP-s80HER4 were: 5'-GFP, ggaagatctgtcgccaccatggtgagcaagggc; 3'-GFP, ctttttgatgctcttccttctagtccggccggacttgtacag; 5'-s80HER4, ctgtacaagtccggccggactagaaggaagagcatcaaaaagaaaagagc; 3'-s80HER4, ttttccttttgcggccgcttacaccacagtattccggtg. The PCR products were subcloned into pMSCVpuro vector. All constructs were fully verified by DNA sequencing. The plasmid constructs pMSCV-GFP, p53-GFP (57), and pQC-GFP-histone were kindly provided by Drs. Scott Hammond, Yanping Zhang, and James Bear (University of North Carolina Lineberger Comprehensive Cancer Center), respectively. Transfection was performed using FuGENE 6 (Roche Molecular Biochemicals, Indianapolis, IN) according to the manufacturers protocol.
Retrovirus Production, Infection, and Stable Cell Lines
A293T cells, seeded 1 d before at a density of 4–5 x 106 cells in 100-mm plates, were transfected with a packaging plasmid pCMV-VSVG and pUMVC3-gagpol (both vectors and A293T cells were kindly provided by Dr. Lishan Su, University of North Carolina Lineberger Comprehensive Cancer Center), and either pMSCV-GFP, pMSCV-GFP-CTHER4, or pMSCV-GFP-s80HER4 using FuGENE 6 (Roche Molecular Biochemicals) according to the manufacturers protocol. Viral supernatants were collected after 60 h of incubation, the last 48 h at 32 C with DMEM plus 2% FBS. Viral supernatants were filtered through a 0.45-µm pore syringe filter and were added with 8 µg of polybrene per ml to recipient cells that had been plated at 7 x 105 cells per 100-mm dish the day before. The cells were incubated at 37 C for 6 h in the filtered viral supernatant and then changed to normal growth medium. After 60 h of incubation, cells were selected in medium containing 2 µg/ml puromycin. Puromycin-resistant cells were pooled, and expression of the cDNA product was confirmed by Western blotting. For the images of live cell microscopy in Figs. 4A
and 5A
, GFP-positive cells were also selected by Modular Flow Cytometer (Cytomation Inc., Fort Collins, CO).
Immunoprecipitation and Immunoblot Analysis
Cells were washed with cold PBS and lysed in regular lysis buffer containing 20 mM Tris-HCl (pH 7.5), 50 mM sodium fluoride, 10% glycerol, 0.5% Nonidet P40, 1 mM EDTA, 1 mM EGTA, 20 mM ß-glycerophosphate, and 137 mM NaCl supplemented with sodium orthovanadate (1 mM) and Protease Inhibitors Cocktail (Roche), or high-salt lysis buffer containing 20 mM HEPES, 50 mM NaF, 10% glycerol, 1% Triton, 5 mM EDTA, 500 mM NaCl, 1 mM sodium orthovanadate, and protease inhibitors cocktail. Insoluble material was removed by centrifugation at 13,000 x g for 10 min at 4 C. Receptor proteins were precipitated for 3 h or overnight at 4 C with protein A/G or protein A agarose beads (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and the following antibodies: HER2 [clone 9G6.10, mouse monoclonal antibody (Neomarkers, Inc., Fremont, CA)]; HER3, polyclonal rabbit antisera raised by this laboratory against HER3 C terminus; HER4, polyclonal rabbit antisera raised by this laboratory against recombinant gluthathione S-transferase fusion protein containing the C-terminal 80 amino acids of HER4; STAT5A (Zymed Laboratories, South San Francisco, CA). Immune complexes were washed three times with lysis buffer and denatured in sodium dodecyl sulfate sample buffer. Protein samples were separated on a sodium dodecyl sulfate-8% polyacrylamide gel and were electrophoretically transferred to a Sequi-blot polyvinylidene difluoride membrane (Bio-Rad Laboratories, Inc., Hercules, CA). After blocking with 3% cold fish gelatin (Sigma), the membrane was probed overnight at 4 C or 1.5 h at room temperature with antiphosphotyrosine antibody (PY20; Santa Cruz Biotechnology), HER4 antibody, HER2 antibody (Clone 2F12, Upstate Biotechnology, Inc., Lake Placid, NY), HER3 antibody (Ab-1, NeoMarkers), GFP antibody (Chemicon, Temecula, CA), STAT5A antibody, ß-casein antibody (Santa Cruz Biotechnology), or
-tubulin antibody (Santa Cruz Biotechnology), washed three times with 0.1% Tween 20 in Tris-buffered saline, and detected with Enhanced ChemiLuminescence detection kit (Amersham Life Sciences, Arlington Heights, IL).
Microscopy and Image Acquisition
The images of live cell microscopy were captured using a Zeiss Axiovert 200 (LD A-Plan 20x /0.30 Ph1) and digitally acquired using a Zeiss AxioCam with Openlab 3.1.4 Zeiss imaging software (Carl Zeiss, Thornwood, NY). For fixed cell microscopy, the cells were grown on coverslips fixed in 3.7% formaldehyde, washed with PBS, and stained with 4',6-diamidino-2-phenylindole (DAPI) (20 ng/ml), or STAT5A antibody and rhodamine red-conjugated donkey antimouse IgG (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). The coverslips were washed with PBS and mounted onto glass slides in fluorescent mounting media (DakoCytomation; DAKO Corp., Carpinteria, CA). Cells were visualized using either the Zeiss Axiovert 200 as above, or the Leica SP2 laser scanning confocal microscope (Leica Corp., Deerfield, IL) with a x63 oil NA 1.40 Plan Apo lens (Nikon, Melville, NY). For confocal microscopy, excitation of GFP and DAPI was performed using an argon ion laser at 488 nm and an UV laser at 364 nm, respectively. Images were acquired and processed using Leica Confocal software. Minimal image processing was performed with Adobe Photoshop (Adobe Systems, Inc., San Jose, CA).
Apoptosis Assay
Cell death was quantified by using the Cell Death Detection ELISA (Roche Molecular Biochemicals), which detects cytoplasmic histone-associated DNA fragments (mono- or oligonucleosomes). SUM44 cells stably expressing GFP, GFP-CTHER4, or GFP-s80HER4 were plated in 100-mm plates in serum-free medium changing the medium every other day. After 7 d, the culture medium was saved to collect any floating cells. HC11 cells stably expressing GFP, GFP-CTHER4, or GFP-s80HER4 were plated in complete medium and cultured for 1 d, after which the medium was replaced with serum-free growth factor-defined medium and cultured for 2 more days. At the end of the cell culture, the culture medium was saved to collect any floating cells. The attached cells were trypsinized off the plate and combined with the saved culture medium. Equal numbers of cells were obtained from each of the SUM44 or HC11 cells expressing GFP, GFP-CTHER4, or GFP-s80HER4 and then processed for apoptosis determination following the instructions of the supplier.
qRT-PCR
qRT-PCR was performed as described previously (45). Briefly, total RNA was isolated from HC11 cells stably expressing GFP, GFP-CTHER4, or GFP-s80HER4 by using an RNeasy kit (QIAGEN, Chatsworth, CA) and was treated with RNase-free DNase (Ambion, Inc., Austin, TX). ß-Casein primers and intervening fluorescent dye-labeled probes were designed using Primer Express software (ABI/PerkinElmer, Wellesley, MA). Total RNA (10 ng) isolated from each cell line was assayed by real-time fluorescence qRT-PCR using an ABI PRISM 7900 instrument (PerkinElmer, Foster City, CA). Relative abundance of ß-casein transcript was calculated by the formula: relative mRNA level = e(40–Ct).
Statistical Analysis
Significant differences between treatment groups were assessed by Students t test. P < 0.05 was considered statistically significant.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. Young Whang and Zonghan Dai for helpful discussions. We thank Dr. Tona Gilmer of GlaxoSmithKline for her helpful comments and for providing lapatinib, GW572016. We also thank Drs. Scott Hammond for providing pMSCV-GFP, Yanping Zhang for providing p53-GFP, James Bear for providing GFP-histone, and Lishan Su for providing VSVG and gagpol plasmids. We appreciate the efforts of Carolyn Coffay in manuscript preparation. The confocal microscopy was done at Michael Hooker Microscopy Facility, University of North Carolina.
 |
FOOTNOTES
|
|---|
This work was supported by the Breast Cancer Research Foundation and National Institutes of Health Grant CA-112553.
Disclosure Summary: The authors have nothing to declare.
First Published Online May 15, 2007
Abbreviations: CTHER4, HER4 C terminus beyond the tyrosine kinase domain, residues 989-1308; DAPI, 4',6-diamidino-2-phenylindole; EGF, epidermal growth factor; EGFR, EGF receptor; FBS, fetal bovine serum; GFP, green fluorescent protein; HB-EGF, heparin-binding EGF; HEDI, hydroxyethylene dihydropeptide isostere; MTS, [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt; qRT-PCR, quantitative RT-PCR; s80HER4, soluble 80-kDa HER4 cytoplasmic domain; STAT5A, signal transducer and activator of transcription 5A; TACE, TNF
-converting enzyme; VSVG, vesicular stomatitis virus glycoprotein.
Received for publication March 2, 2006.
Accepted for publication May 7, 2007.
 |
REFERENCES
|
|---|
- Lacenere CJ, Sternberg PW 2000 Regulation of EGF receptor signaling in the fruitfly D. melanogaster and the nematode C. elegans. Breast Dis 11:19–30[Medline]
- Yarden Y, Sliwkowski MX 2001 Untangling the ErbB signalling network. Nat Rev Mol Cell Biol. 2:127–137
- Earp III HS, Calvo BF, Sartor CI 2003 The EGF receptor family—multiple roles in proliferation, differentiation, and neoplasia with an emphasis on HER4. Trans Am Clin Climatol Assoc 114:315–333[Medline]
- Roskoski Jr R 2004 The ErbB/HER receptor protein-tyrosine kinases and cancer. Biochem Biophys Res Commun 319:1–11[CrossRef][Medline]
- Holbro T, Hynes NE 2004 ErbB receptors: directing key signaling networks throughout life. Annu Rev Pharmacol Toxicol 44:195–217[CrossRef][Medline]
- Stern DF 2003 ErbBs in mammary development. Exp Cell Res 284:89–98[CrossRef][Medline]
- Schroeder JA, Lee DC 1998 Dynamic expression and activation of ERBB receptors in the developing mouse mammary gland. Cell Growth Differ 9:451–464[Abstract]
- Troyer KL, Lee DC 2001 Regulation of mouse mammary gland development and tumorigenesis by the ERBB signaling network. J Mammary Gland Biol Neoplasia 6:7–21[CrossRef][Medline]
- Tidcombe H, Jackson-Fisher A, Mathers K, Stern DF, Gassmann M, Golding JP 2003 Neural and mammary gland defects in ErbB4 knockout mice genetically rescued from embryonic lethality. Proc Natl Acad Sci USA 100:8281–8286[Abstract/Free Full Text]
- Hynes NE, Lane HA 2005 ERBB receptors and cancer: the complexity of targeted inhibitors. Nat Rev Cancer. 5:341–354
- Plowman GD, Culouscou JM, Whitney GS, Green JM, Carlton GW, Foy L, Neubauer MG, Shoyab M 1993 Ligand-specific activation of HER4/p180erbB4, a fourth member of the epidermal growth factor receptor family. Proc Natl Acad Sci USA 90:1746–1750[Abstract/Free Full Text]
- Gullick WJ 2003 c-erbB-4/HER4: friend or foe? J Pathol 200:279–281[CrossRef][Medline]
- Pawlowski V, Revillion F, Hebbar M, Hornez L, Peyrat JP 2000 Prognostic value of the type I growth factor receptors in a large series of human primary breast cancers quantified with a real-time reverse transcription-polymerase chain reaction assay. Clin Cancer Res 6:4217–4225[Abstract/Free Full Text]
- Suo Z, Risberg B, Kalsson MG, Willman K, Tierens A, Skovlund E, Nesland JM 2002 EGFR family expression in breast carcinomas. c-erbB-2 and c-erbB-4 receptors have different effects on survival. J Pathol 196:17–25[CrossRef][Medline]
- Witton CJ, Reeves JR, Going JJ, Cooke TG, Bartlett JM 2003 Expression of the HER1–4 family of receptor tyrosine kinases in breast cancer. J Pathol 200:290–297[CrossRef][Medline]
- Barnes NL, Khavari S, Boland GP, Cramer A, Knox WF, Bundred NJ 2005 Absence of HER4 expression predicts recurrence of ductal carcinoma in situ of the breast. Clin Cancer Res 11:2163–2168[Abstract/Free Full Text]
- Lodge AJ, Anderson JJ, Gullick WJ, Haugk B, Leonard RC, Angus B 2003 Type 1 growth factor receptor expression in node positive breast cancer: adverse prognostic significance of c-erbB-4. J Clin Pathol 56:300–304[Abstract/Free Full Text]
- Bieche I, Onody P, Tozlu S, Driouch K, Vidaud M, Lidereau R 2003 Prognostic value of ERBB family mRNA expression in breast carcinomas. Int J Cancer 106:758–765[CrossRef][Medline]
- Elenius K, Corfas G, Paul S, Choi CJ, Rio C, Plowman GD, Klagsbrun M 1997 A novel juxtamembrane domain isoform of HER4/ErbB4. Isoform-specific tissue distribution and differential processing in response to phorbol ester. J Biol Chem 272:26761–26768[Abstract/Free Full Text]
- Elenius K, Choi CJ, Paul S, Santiestevan E, Nishi E, Klagsbrun M 1999 Characterization of a naturally occurring ErbB4 isoform that does not bind or activate phosphatidyl inositol 3-kinase. Oncogene 18:2607–2615[CrossRef][Medline]
- Junttila TT, Sundvall M, Maatta JA, Elenius K 2000 Erbb4 and its isoforms: selective regulation of growth factor responses by naturally occurring receptor variants. Trends Cardiovasc Med 10:304–310[CrossRef][Medline]
- Rio C, Buxbaum JD, Peschon JJ, Corfas G 2000 Tumor necrosis factor-
-converting enzyme is required for cleavage of erbB4/HER4. J Biol Chem 275:10379–10387[Abstract/Free Full Text] - Cheng QC, Tikhomirov O, Zhou W, Carpenter G 2003 Ectodomain cleavage of ErbB-4: characterization of the cleavage site and m80 fragment. J Biol Chem 278:38421–38427[Abstract/Free Full Text]
- Ebinu JO, Yankner BA 2002 A RIP tide in neuronal signal transduction. Neuron 34:499–502[CrossRef][Medline]
- Ni CY, Murphy MP, Golde TE, Carpenter G 2001
-Secretase cleavage and nuclear localization of ErbB-4 receptor tyrosine kinase. Science 294:2179–2181[Abstract/Free Full Text] - Peles E, Bacus SS, Koski RA, Lu HS, Wen D, Ogden SG, Levy RB, Yarden Y 1992 Isolation of the neu/HER-2 stimulatory ligand: a 44 kd glycoprotein that induces differentiation of mammary tumor cells. Cell 69:205–216[CrossRef][Medline]
- Bacus SS, Huberman E, Chin D, Kiguchi K, Simpson S, Lippman M, Lupu R 1992 A ligand for the erbB-2 oncogene product (gp30) induces differentiation of human breast cancer cells. Cell Growth Differ 3:401–411[Abstract]
- Bacus SS, Gudkov AV, Zelnick CR, Chin D, Stern R, Stancovski I, Peles E, Ben-Baruch N, Farbstein H, Lupu R, Wen D, Sela M, Yarden Y 1993 Neu differentiation factor (heregulin) induces expression of intercellular adhesion molecule 1: implications for mammary tumors. Cancer Res 53:5251–5261[Abstract/Free Full Text]
- Culouscou JM, Plowman GD, Carlton GW, Green JM, Shoyab M 1993 Characterization of a breast cancer cell differentiation factor that specifically activates the HER4/p180erbB4 receptor. J Biol Chem 268:18407–18410[Abstract/Free Full Text]
- Daly JM, Jannot CB, Beerli RR, Graus-Porta D, Maurer FG, Hynes NE 1997 Neu differentiation f