| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Medical Sciences (V.D., H.E.I., N.K., C.H.L.S., P.M.S., W.A.), Institute of Biomedical Research, University of Birmingham, Birmingham B15 2TT, United Kingdom; and Genome Damage and Stability Centre (A.J.D.), University of Sussex, Brighton BN1 9RQ, United Kingdom
Address all correspondence and requests for reprints to: Prof. Wiebke Arlt, Division of Medical Sciences, Institute of Biomedical Research, The University of Birmingham, Birmingham B15 2TT, United Kingdom. E-mail: w.arlt{at}bham.ac.uk.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
-hydroxylase (CYP17A1) and 21-hydroxylase (CYP21A2) deficiency was first described in 1985 (1), but only recently the molecular cause of the disease has been identified as inactivating mutations in P450 oxidoreductase (POR) (2, 3). POR crucially facilitates electron transfer from nicotinamide adenine dinucleotide phosphate (NADPH) to microsomal cytochrome P450 (CYP) enzymes, including CYP17A1 and CYP21A2. CAH is usually caused by mutations in single steroidogenic enzymes involved in adrenal steroid biosynthesis, most frequently by mutant CYP21A2 causing 21-hydroxylase deficiency (4). In contrast, POR deficiency is unique among all other CAH variants by indirectly impacting on steroidogenesis subsequent to a mutation in an electron donor enzyme rather than a steroidogenic enzyme. The clinical phenotype of POR deficiency is remarkably variable and may comprise glucocorticoid deficiency, disordered sex differentiation with ambiguous genitalia in both 46,XX and 46,XY individuals, and multiple, predominantly craniofacial skeletal malformations. The latter is a phenomenon not observed in any other CAH variant.
Gas chromatography/mass spectrometry (GC/MS) analysis of urinary steroid metabolite excretion in patients with POR deficiency characteristically indicates functional impairment of both CYP17A1 and CYP21A2 (2, 5). These two enzymes catalyze key reactions in adrenal steroid biosynthesis (Fig. 1
). CYP17A1 exhibits two activities: 1) 17-hydroxylation of pregnenolone and progesterone (Prog), and 2) 17,20 lyase activity that catalyzes the conversion of 17-hydroxypregnenolone (17-Preg) to dehydroepiandrosterone (DHEA) and, with much lesser preference (6), the conversion of 17-hydroxyprogesterone (17-OHP) to androstenedione (Fig. 1). Thus, CYP17A1 represents a crucial facilitator of human sex steroid synthesis. CYP21A2 catalyzes 21-hydroxylation of Prog and 17-OHP and is therefore essential for glucocorticoid and mineralocorticoid synthesis (Fig. 1).
|
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
). POR mutants Y181D and H628P are naturally occurring mutations both located in close proximity to the central electron transfer region (Fig. 2B). The fourth POR domain is the so-called connecting domain that is thought to approximate the FAD and FMN domains during electron transfer. The flexible hinge region (residues 237 to 246, corresponding to residues 234 to 243 in the rat Por protein) represents an important structural component of the connecting domain; to examine the functional role of the hinge, we created the POR mutant S244C (Fig. 2C). In contrast to all other missense mutations described so far (2, 3, 7, 10, 11), the POR mutant A287P, which is the most frequent mutation in Caucasians with POR deficiency, is located neither in close proximity to the central electron transfer region nor to the hinge region (Fig. 2D).
|
-hydroxylase and 17,20 lyase activities; the latter is further enhanced by allosteric interaction of the CYP17A1-POR complex with cytochrome b5 (6). Thus, 17,20 lyase assays were performed with exogenously added cytochrome b5. In the yeast microsomal coexpression assay, kinetic constants for the 17-hydroxylation of pregnenolone and Prog are equivalent, whereas the 17,20 lyase activity of CYP17A1 has a 100-fold higher substrate preference for 17-Preg than for 17-OHP (6). Therefore, we assessed 17-hydroxylase activity as the conversion of Prog to 17-OHP, and 17,20 lyase activity was measured as the conversion of 17-Preg to DHEA.
All POR mutants examined led to equivalent decreases in 17-hydroxylase activity when coexpressed with CYP17A1 (Fig. 3A), with the exception of Y181D that resulted in complete loss of function (Table 1). Coexpression of S244C, A287P, and H628P with human CYP17A1 significantly reduced the maximal velocity (Vmax) of the enzymatic reaction, whereas Km remained essentially unaltered (Table 1).
|
|
), with an even more marked reduction in Vmax (Table 1), with only 18–22% of wild-type catalytic efficiency (Vmax/Km) remaining. H628P appeared to lead to the most significant reduction in 17,20 lyase activity (Fig. 3B), whereas its inhibitory effect on 17-hydroxylase activity did not differ from the other POR mutants examined. Western blot analysis documented equal amounts of CYP17A1 protein in the microsome preparations (Fig. 3C).
NADPH binding assays demonstrated a significant increase in 17-hydroxylase activity with increasing NADPH concentrations for wild-type POR and the A287P and S244C mutants. In contrast, H628P, which is located in immediate proximity to the NADPH binding domain of POR (Fig. 2B), did not respond to NADPH administration (Fig. 4).
|
, A and B) comparable with the magnitude of the observed effects on 17-hydroxylase activity. Consistent with its effects of CYP17A1 activities, Y181D completely abolished CYP21A2 function. Similar levels of expression of CYP21A2 and POR wild-type and mutant proteins were verified by Western blotting (Fig. 5C). Consistent with the effects of the POR mutants on CYP17A1 activities, the observed decrease in catalytic efficiency of CYP21A2 was primarily attributable to reduced maximal velocity (Vmax) (Table 1).
|
) and 17-OHP to 11-deoxycortisol (Fig. 5B), retaining 77 and 63% of wild-type activity, respectively.
Direct comparison of the impairment of catalytic efficiencies for the four examined enzymatic reactions (Fig. 6) illustrates that all mutations other than A287P result in equivalent decreases in CYP17A1 and CYP21A2 activities. In contrast, A287P shows differential effects, with strong inhibition of CYP17A1 but primarily preserved CYP21A2 activity (Fig. 6).
|
-hydroxylase activity and consequently a higher corticosterone over cortisol metabolite ratio than sex- and age-matched healthy controls. However, patients homozygous for the A287P mutation had a significantly higher corticosterone over cortisol metabolite ratio compared with other patients with POR deficiency, including one patient homozygous for H628P (Fig. 7), thus indicating a preferential inhibition of CYP17A1 over CYP21A2 by A287P also in the in vivo situation.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The tyrosine 181 residue is of central importance for FMN binding (2, 12), and the Y181D mutation has been shown previously to result in complete loss of function (2, 7). The novel mutation H628P is located in proximity to the binding site of NADPH, similar to the previously reported mutation C569Y (2, 3). Unsurprisingly, we could confirm impaired NADPH binding for H628P, resulting in significant and equivalent impairments of CYP17A1 and CYP21A2 activities. The S244C mutant is not naturally occurring, but we specifically generated this mutant to examine the functional significance of the hinge region, which had not been addressed by any previous functional studies on the POR molecule. According to the three-dimensional POR model based on x-ray crystallography (9), amino acid residues 237–246 represent a highly flexible region between the FMN domain and the connecting domain of POR. These residues are mainly hydrophilic, and, therefore, the interaction between them is thought to be essentially electrostatic (9), thus our mutation of serine to cysteine was chosen to induce only a subtle change within the hinge structure. In our assay, S244C resulted in a decrease in catalytic efficiency of both CYP17A1 and CYP21A2, similar to that observed for H628P, a mutation in immediate proximity to the electron transport chain itself. This supports the view that the hinge is crucial for full functionality of electron transfer within the POR molecule, in keeping with previous suggestions (9).
Intriguingly, our in vitro assays showed that, in contrast to all other mutants examined, the POR mutant A287P differentially inhibited steroidogenic activities, resulting in marked reduction of CYP17A1 activities but primarily preserving CYP21A2 function. Importantly, this finding was mirrored by the results of GC/MS analysis of urinary steroid excretion, demonstrating a significantly increased corticosterone metabolite over cortisol metabolite ratio in patients homozygous for A287P, thereby providing compelling in vivo evidence for a preferential inhibition of CYP17A1 over CYP21A2 by A287P. Because the vast majority of patients with POR deficiency identified to date are infants or young children, one cannot give precise answers yet regarding the eventual phenotypic consequences of this finding. However, one would assume that the preferential inhibition of CYP17A1 over CYP21A2 in A287P homozygous patients might lead to mineralocorticoid-mediated hypertension later in life, albeit milder than usually observed in isolated and complete CYP17A1 deficiency attributable to CYP17A1 mutations. Long-term clinical follow-up studies will have to clarify whether this is the case.
The differential inhibition of CYP enzymes interacting with mutant POR has several obvious implications beyond the inhibition of CYP17A1 and CYP21A2. In patients affected by POR deficiency, a considerable phenotypic variability is observed, in particular with regard to the presence of skeletal malformations and the degree of genital ambiguity. However, the phenotype appears to be primarily consistent within individuals of the same genotype. Therefore, phenotypic variability might at least in part be caused by differential interactions of the specific POR mutant with electron-accepting CYP enzymes. This might include CYP51A1 (14-lanosterol-demethylase), a key enzyme in sterol biosynthesis, that has been implicated previously in the pathogenesis of the Antley-Bixler type skeletal malformations observed in many but not all patients affected by POR deficiency (2, 3). Importantly, recent genotype phenotype analysis that we performed in a large cohort of patients with POR deficiency (our unpublished data) indicates that A287P homozygous patients always present with overt skeletal malformations, whereas several other POR mutants do not appear to cause a malformation phenotype. This observation together with our current finding of differential effects of POR mutations on CYP enzyme activities generates a unique opportunity to test whether inhibition of sterol biosynthesis and specifically CYP51A1 is indeed involved in the pathogenesis of skeletal malformations. If this is the case, one would expect preferential inhibition of CYP51A1 activity by A287P with lesser or no inhibition by the POR mutants not associated with a malformation phenotype.
There are a number of possible mechanisms by which the A287P mutant could impact on POR function. First, the mutation is a substitution of alanine by proline within a ß-sheet of the FAD domain and proline residues tend to be ß-sheet breakers. Thus, A287P could significantly disrupt the ß-sheet structure, thereby potentially altering the binding affinity of POR for FAD. However, this option is an unlikely explanation for our findings because this would not explain a differential inhibition of CYP17A1 and CYP21A2 activities. If the conformation of the whole FAD domain is destabilized by A287P, one would assume a decrease in all enzymatic activities.
An alternative and potentially more plausible model is derived from examining the impact of A287P on POR structure using a three-dimensional model (Fig. 8). Modeling reveals that A287P is located in immediate proximity to a proline-phenylalanine-rich (PPF) motif (residues 277–286) that extends to an adjacent region containing many charged residues in close proximity to the N-terminal transmembranous membrane-anchoring domain of POR (Fig. 8A). Additionally, considering that the extended PPF motif contains several clusters of positively charged residues (K/R), which can interact with negative charges on phospholipid head groups, it is feasible to hypothesize that this region is involved in membrane attachment of POR. The change from alanine to proline in position 287 is likely to impact on an adjacent phenylalanine residue in position 285 (Fig. 8, B and C), thereby potentially inducing a conformational change in the PPF motif. This extended PPF motif (POR residues 253–286) and the adjacent alanine are highly conserved among mammalian species and also Xenopus laevis, Drosophila melanogaster, and Saccharomyces cerevisiae (Fig. 9), indicating an important role for this domain in POR function. Thus, a conformational change in the PPF motif brought on by A287P might disorder the attachment of the POR molecule to the endoplasmic reticulum membrane. This in turn could disrupt the access of electron-accepting CYP enzymes to the CYP docking site of POR. As a consequence, some CYP enzymes (e.g. CYP21A2) will still achieve a near normal interaction, whereas others (e.g. CYP17A1) are no longer capable of forming a complex with POR that allows for efficient electron transfer. However, at present, this proposed mechanism is hypothetical and requires additional investigation.
|
|
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Site-Directed Mutagenesis for Generation of POR Mutants
Human wild-type POR cDNA was subjected to PCR-based site-directed mutagenesis as described previously (2). For generation of the POR mutants Y181D and A287P, previously reported primer pairs were used (2). For generation of the novel mutants S244C and H628P, the following primer pairs were used (mutated base pairs in bold, affected codon underlined): S244C, forward primer, 5'-CTGGCGAGGAGTCCTGCATTCGCCAGTACG; reverse primer, 5'-CGTACTGGCGAATGCAGGACTCCTCGCCAG-3'; H628P, forward primer, 5'-GAAGGCGGTGCCCCCATCTACGTCTGTGG-3'; and reverse primer, 5'-CCACAGACGTAGATGGGGGCACCGCCTTC-3'. All inserts were sequenced in their entirety to confirm the mutations and to ensure that no other bases had been changed.
Yeast Transformation
S. cerevisiae strain W303B (15) was transformed using a modification of the lithium acetate method (16). Yeast were grown in 15 ml YPD medium to an OD600 of 0.5–0.8, and 1.5 ml was harvested by centrifugation, resuspended in 100 µl Li/Te [0.1 M lithium acetate, 10 mM Tris-HCl (pH 7.5), and 1 mM EDTA], and incubated for 5 min at room temperature. The yeast pellet was mixed with 700 µl freshly prepared PEG/LiAc [40% aqueous polyethylene glycol 3350, 0.1 M lithium acetate, 10 mM Tris-HCl (pH 7.5), and 1 mM EDTA] and then gently mixed with 50 µg denatured (95 C for 5 min) herring sperm DNA before adding 2 µg plasmid DNA. Yeast were then incubated at 30 C for 30 min, heat shocked at 42 C for 15 min, and harvested by centrifugation for 5 min at 16,000 rpm. Cells were then washed in 500 µl TE/sorbitol [1 M sorbitol, 10 mM Tris-HCl (pH 7.5), and 1 mM EDTA], before resuspension in 100 µl TE [10 mM Tris-HCl (pH 7.5) and 1 mM EDTA]. Transformed yeast clones were selected on minimal medium [1.7 g/liter yeast nitrogen base (Difco, Oxford, UK), 5 g/liter ammonium sulfate, and 2 g/liter glucose] with the appropriate amino acid complementation (40 mg/liter). To ensure similar expression of wild-type CYP17A1 or wild-type CYP21A2, yeast transformation was performed in two subsequent steps. First, yeast were transformed with yeast expression vector V10 (15) containing the coding sequence for wild-type human CYP17A1 (6) (kindly donated by Prof. Walter L. Miller, University of California, San Francisco, San Francisco, CA) or wild-type human CYP21A2. To generate V10-CYP21A2, the CYP21A2 coding sequence was amplified from human adrenal cDNA by using 5' sense primer CCAGATCTGCGTCTCGCCATGC that included a BglII restriction site and 3' antisense primer CGGCTGGCATCGGTCCTG. This facilitated directional cloning into V10, which had been digested previously with EcoRI, followed by blunt ending and digestion with BglII. In a second transformation step, a CYP17A1- or CYP21A2-expressing yeast clone was selected, propagated, and subsequently cotransformed with yeast expression vector pYcDE2 (17), containing the coding sequence of either wild-type human POR (6) (kindly donated by Prof. Walter L. Miller) or mutant POR.
Microsome Preparation
Transformed yeast were grown in 300 ml liquid minimal medium with adenine and harvested at a density of 3–5 x 107 cells/ml (OD600 of 1.0–1.8) by centrifugation. Cells were resuspended in 5 ml TEK (0.1 M KCl, 50 mM Tris-HCl, and 1 mM EDTA), kept at ambient temperature for 5 min, and collected by centrifugation. Cells were then resuspended in 2 ml TES-B [50 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 0.6 M sorbitol] containing protease inhibitors (Mini EDTA free cocktail tablet; Roche, Lewes, UK). Acid washed glass beads (425–600 µm) were added, and the mixture was vortexed five times (30 sec pulse, 30 sec on ice). Disrupted cells were centrifuged twice for 10 min at 10,000 x g to remove cell debris, nuclei, and mitochondria; microsomes were collected by ultracentrifugation of the supernatant at 100,000 x g for 90 min. Resulting pellets were homogenized in TE-G [50 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 20% glycerol] by mechanical shearing through 19- and 25-gauge needles. Microsomes were kept frozen in aliquots at –80 C until use.
Protein Measurements
Microsomal protein content was measured by the Bradford method (Bio-Rad, Hemel Hempstead, UK), and the expression of similar amounts of CYP was confirmed by CO difference spectra analysis as described previously (18) using 500 mg microsomal protein on a Uvikon 922 dual-beam spectrophotometer (Kontron Instruments, Bletchley, UK). To ensure the use of similar amounts of wild-type and mutant POR proteins, Western blot analysis was performed as described previously (19) with the use of polyclonal human antibodies to POR (20) (kindly donated by Prof. C. Roland Wolf, University of Dundee, Dundee, UK). The yeast strains used for POR transformation stably expressed CYP17A1 and CYP21A2, respectively, subsequent to the first transformation step as described above. However, to further ensure that CYP17A1 and CYP21A2 expression did not vary, we also performed Western blot analysis for protein expression of CYP17A1 (kindly donated by Prof. William H. Rainey, University of Augusta, Augusta, GA) and CYP21A2 (generous gift from Dr. Svetlana Lajic, Karolinska Institutet, Stockholm, Sweden).
Enzymatic Activity Assays
Yeast microsomes containing wild-type CYP17A1 or CYP21A2 and either wild-type or mutant POR were incubated in 196 µl of 50 mM potassium phosphate buffer (pH 7.4). Microsomes were incubated with 0.5–5.0 µM Prog or 17-Preg for 17-OHP and 17,20 lyase activities of CYP17A1 and 0.5–5.0 µM Prog or 17-OHP for 21-hydroxylase activities of CYP21A2. Steroids were added in 4 µl ethanol, also containing 10,000 cpm of [3H]Prog, 17-OHP, and 17-Preg, respectively (all 55.4 Ci/mol). All reactions were initiated by the addition of 10 mM NADPH, with subsequent incubation at 37 C. All assays were performed within the linear time range of the enzymatic reaction, as assessed by preceding experiments. Assays for 17,20 lyase activity were performed with the addition of 10 pmol of purified recombinant human cytochrome b5 (Invitrogen, Paisley, UK).
NADPH binding assays were performed by increasing the NADPH concentration (0–8 µM) in 17-hydroxylase assays performed for analyzing the conversion of Prog to 17-hydroyxprogesterone at 5 µM Prog.
Steroids were extracted with 2 ml dichloromethane, concentrated by evaporation at 55 C, and separated by thin-layer chromatography on PE SIL G/UV silica gel plates (Whatman, Maidstone, Kent, UK) using a 3:1 chloroform/ethyl acetate solvent system. Substrates and conversion products were identified by comparison with comigration of unlabeled reference steroids using Liebermann-Burchard reagent as described previously (21) and quantified using a Bioscan 2000 image analyzer (Lablogic, Sheffield, UK). All assays were performed in at least three independent triplicate experiments, and data are presented as means ± SD. Kinetic parameters were established by nonlinear regression, using the Michaelis-Menten equation to determine the Michaelis-Menten constant Km and maximal velocity Vmax. Catalytic efficiency was defined as the ratio Vmax/Km and expressed as percentage of wild-type activity. Calculation of enzyme kinetic parameters and subsequent statistical analysis was performed using curve-fitting software (Enzfitter 2.0.9.1; Biosoft, Cambridge, UK).
Urinary Steroid Metabolite Analysis
Urinary steroid excretion was measured in 11 patients with POR deficiency attributable to POR mutations on both the paternal and the maternal allele, as proven by direct sequencing. Analysis of urinary steroid metabolite excretion was performed as described previously by a quantitative GC/MS selected ion-monitoring method (5, 22, 23). In brief, steroids were enzymatically released from conjugation and, after extraction, chemically derivatized before GC/MS selected ion-monitoring analysis. Steroids quantified included corticosterone metabolites (tetrahydro-11-dehydrocorticosterone, 5-tetrahydro-11-dehydrocorticosterone, tetrahydrocorticosterone, and 5-tetrahydrocorticosterone) and cortisol metabolites (tetrahydrocortisone, tetrahydrocortisol, 5-tetrahydrocortisol, and 5-tetrahydrocortisol). The ratio of corticosterone metabolites over cortisol metabolites was calculated as a measure of relative contributions of CYP17A1 and CYP21A2 to the conversion of Prog to 17-OHP and 11-DOC, respectively.
Molecular Modeling
The x-ray structure of rat POR (9) (Protein Data Bank accession code 1J9Z) served as the template for three-dimensional modeling of the location and structural impact of the studied POR mutations. Rat POR (NCBI accession no. NP_113764) shares 92.2% sequence identity to the human POR protein (NCBI accession no. NP_000932), and all amino acids affected by mutations and their immediate proximity are 100% conserved between human and rat. Amino acid differences between human and rat POR were corrected by exchange of residues in the template, followed by energy minimization using the steepest descent algorithm implemented in the GROMOS software (http://www.igc.ethz.ch/gromos/). The structural representations of the humanized three-dimensional POR model were generated using the programs Deep View/Swiss-PDB Viewer (http://www.expasy.org/spdbv/) and POVRAY (The Persistence of Vision Raytracer; http://www.povray.org).
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Disclosure Summary: V.D., H.E.I., N.K., C.H.L.S., and A.J.D. have nothing to declare. P.M.S. received consultant fees from Pfizer, Speedel, and Duocort, and W.A. received consultant fees from Phoqus and HRA Pharma.
First Published Online May 15, 2007
Abbreviations: CAH, Congenital adrenal hyperplasia; CYP, cytochrome P450; DHEA, dehydroepiandrosterone; 11-DOC, 11-deoxycorticosterone; FAD, flavin adenine dinucleotide; FMN, flavin mononucleotide; GC/MS, gas chromatography/mass spectrometry; 17-OHP, 17-hydroxyprogesterone; NADPH, nicotinamide adenine dinucleotide phosphate; NCBI, National Center for Biotechnology Information; PPF, proline-phenylalanine-rich; POR, P450 oxidoreductase; 17-Preg, 17-hydroxypregnenolone; Prog, progesterone.
Received for publication February 1, 2007. Accepted for publication May 10, 2007.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
a-Reduced C21 steroids are substrates for human cytochrome P450c17. Arch Biochem Biophys 418:151–160[CrossRef][Medline]This article has been cited by other articles:
 |
|
 |
|
  V. Dhir, N. Reisch, C. M. Bleicken, J. Lebl, C. Kamrath, H.-P. Schwarz, J. Grotzinger, W. G. Sippell, F. G. Riepe, W. Arlt, et al. Steroid 17{alpha}-Hydroxylase Deficiency: Functional Characterization of Four Mutations (A174E, V178D, R440C, L465P) in the CYP17A1 Gene J. Clin. Endocrinol. Metab., August 1, 2009; 94(8): 3058 - 3064. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Fukami, G. Nishimura, K. Homma, T. Nagai, K. Hanaki, A. Uematsu, T. Ishii, C. Numakura, H. Sawada, M. Nakacho, et al. Cytochrome P450 Oxidoreductase Deficiency: Identification and Characterization of Biallelic Mutations and Genotype-Phenotype Correlations in 35 Japanese Patients J. Clin. Endocrinol. Metab., May 1, 2009; 94(5): 1723 - 1731. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. G. Gomes, N. Huang, V. Agrawal, B. B. Mendonca, T. A. S. S. Bachega, and W. L. Miller The Common P450 Oxidoreductase Variant A503V Is Not a Modifier Gene for 21-Hydroxylase Deficiency J. Clin. Endocrinol. Metab., July 1, 2008; 93(7): 2913 - 2916. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Huang, V. Agrawal, K. M. Giacomini, and W. L. Miller Genetics of P450 oxidoreductase: Sequence variation in 842 individuals of four ethnicities and activities of 15 missense mutations PNAS, February 5, 2008; 105(5): 1733 - 1738. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
