help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2007-0066
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dhir, V.
Right arrow Articles by Arlt, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dhir, V.
Right arrow Articles by Arlt, W.
Molecular Endocrinology 21 (8): 1958-1968
Copyright © 2007 by The Endocrine Society

Differential Inhibition of CYP17A1 and CYP21A2 Activities by the P450 Oxidoreductase Mutant A287P

Vivek Dhir, Hannah E. Ivison, Nils Krone, Cedric H. L. Shackleton, Aidan J. Doherty, Paul M. Stewart and Wiebke Arlt

Division of Medical Sciences (V.D., H.E.I., N.K., C.H.L.S., P.M.S., W.A.), Institute of Biomedical Research, University of Birmingham, Birmingham B15 2TT, United Kingdom; and Genome Damage and Stability Centre (A.J.D.), University of Sussex, Brighton BN1 9RQ, United Kingdom

Address all correspondence and requests for reprints to: Prof. Wiebke Arlt, Division of Medical Sciences, Institute of Biomedical Research, The University of Birmingham, Birmingham B15 2TT, United Kingdom. E-mail: w.arlt{at}bham.ac.uk.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
P450 oxidoreductase (POR) has a pivotal role in facilitating electron transfer from nicotinamide adenine dinucleotide phosphate to microsomal cytochrome P450 (CYP) enzymes, including the steroidogenic enzymes CYP17A1 and CYP21A2. Mutations in POR have been shown recently to cause congenital adrenal hyperplasia with apparent combined CYP17A1 and CYP21A2 deficiency that comprises a variable clinical phenotype, including glucocorticoid deficiency, ambiguous genitalia, and craniofacial malformations. To dissect structure-function relationships potentially explaining this phenotypic diversity, we investigated whether specific POR mutations have differential effects on CYP17A1 and CYP21A2. We compared the impact of missense mutations encoding for single amino acid changes in three distinct regions of the POR molecule: 1), Y181D and H628P close to the central electron transfer area, 2) S244C located within the hinge close to the flavin adenine dinucleotide and flavin mononucleotide domains of POR, and 3) A287P that is clearly distant from the two other regions. Functional analysis using a yeast microsomal assay with coexpression of human CYP17A1 or CYP21A2 with wild-type or mutant human POR revealed equivalent decreases in CYP17A1 and CYP21A2 activities by Y181D, H628P, and S244C. In contrast, A287P had a differential inhibitory effect, with decreased catalytic efficiency (Vmax/Km) for CYP17A1, whereas CYP21A2 retained near normal activity. In vivo analysis of urinary steroid excretion by gas chromatography/mass spectrometry in 11 patients with POR mutations showed that A287P homozygous patients had the highest corticosterone/cortisol metabolite ratios, further indicative of preferential inhibition of CYP17A1. These findings provide novel mechanistic insights into the redox regulation of human steroidogenesis. Differential interaction of POR with electron-accepting CYP enzymes may explain the phenotypic variability in POR deficiency, with additional implications for hepatic drug metabolism by POR-dependant CYP enzymes.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
CONGENITAL ADRENAL HYPERPLASIA (CAH) with apparent combined 17{alpha}-hydroxylase (CYP17A1) and 21-hydroxylase (CYP21A2) deficiency was first described in 1985 (1), but only recently the molecular cause of the disease has been identified as inactivating mutations in P450 oxidoreductase (POR) (2, 3). POR crucially facilitates electron transfer from nicotinamide adenine dinucleotide phosphate (NADPH) to microsomal cytochrome P450 (CYP) enzymes, including CYP17A1 and CYP21A2. CAH is usually caused by mutations in single steroidogenic enzymes involved in adrenal steroid biosynthesis, most frequently by mutant CYP21A2 causing 21-hydroxylase deficiency (4). In contrast, POR deficiency is unique among all other CAH variants by indirectly impacting on steroidogenesis subsequent to a mutation in an electron donor enzyme rather than a steroidogenic enzyme. The clinical phenotype of POR deficiency is remarkably variable and may comprise glucocorticoid deficiency, disordered sex differentiation with ambiguous genitalia in both 46,XX and 46,XY individuals, and multiple, predominantly craniofacial skeletal malformations. The latter is a phenomenon not observed in any other CAH variant.

Gas chromatography/mass spectrometry (GC/MS) analysis of urinary steroid metabolite excretion in patients with POR deficiency characteristically indicates functional impairment of both CYP17A1 and CYP21A2 (2, 5). These two enzymes catalyze key reactions in adrenal steroid biosynthesis (Fig. 1Go). CYP17A1 exhibits two activities: 1) 17{alpha}-hydroxylation of pregnenolone and progesterone (Prog), and 2) 17,20 lyase activity that catalyzes the conversion of 17-hydroxypregnenolone (17-Preg) to dehydroepiandrosterone (DHEA) and, with much lesser preference (6), the conversion of 17-hydroxyprogesterone (17-OHP) to androstenedione (Fig. 1Go). Thus, CYP17A1 represents a crucial facilitator of human sex steroid synthesis. CYP21A2 catalyzes 21-hydroxylation of Prog and 17-OHP and is therefore essential for glucocorticoid and mineralocorticoid synthesis (Fig. 1Go).


Figure 1
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 1. Structures and Enzymatic Reactions Catalyzed by Human CYP17A1 and CYP21A2

The 17{alpha}-hydroxylase activity of CYP17A1 catalyzes the conversion of pregnenolone to 17-Preg and Prog to 17-OHP with equivalent efficiency, whereas the catalytic efficiency of the 17,20 lyase activity is much lower, with a 100-fold higher preference for the conversion of 17-Preg to DHEA than of 17-OHP to androstenedione. DHEA and androstenedione represent crucial precursors of human sex steroid biosynthesis. 21-Hydroxylase (CYP21A2) catalyzes Prog to 11-DOC and 17-OHP to 11-deoxycortisol (S), conversions that represent key steps in aldosterone and cortisol synthesis, respectively.

 
Here we examined POR missense mutations located in three distinct regions of the POR molecule, including A287P, the most frequent POR mutation in Caucasians (7), to determine whether they differentially affect the activities of POR-dependant CYP enzymes and thereby account for phenotypic variability in POR deficiency. We assessed the effects of POR mutations on the enzymatic activities of CYP17A1 and CYP21A2, using a humanized yeast microsomal expression assay that allows examination of steroidogenic activities in their native microsomal environment (6, 8). In addition, we performed analysis of urinary steroid metabolite excretion in 11 patients with POR deficiency by GC/MS, which provided us with an in vivo measure for CYP17A1 and CYP21A2 activities.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Location of Selected Mutations in the POR Molecule
Modeling of the molecular structure of POR based on x-ray crystallography (9) suggests that POR consists of four distinct domains. The first three are the binding domains of NADPH, flavin adenine dinucleotide (FAD), and flavin mononucleotide (FMN), respectively, which bind in the central cavity of the molecule (Fig. 2AGo). POR mutants Y181D and H628P are naturally occurring mutations both located in close proximity to the central electron transfer region (Fig. 2BGo). The fourth POR domain is the so-called connecting domain that is thought to approximate the FAD and FMN domains during electron transfer. The flexible hinge region (residues 237 to 246, corresponding to residues 234 to 243 in the rat Por protein) represents an important structural component of the connecting domain; to examine the functional role of the hinge, we created the POR mutant S244C (Fig. 2CGo). In contrast to all other missense mutations described so far (2, 3, 7, 10, 11), the POR mutant A287P, which is the most frequent mutation in Caucasians with POR deficiency, is located neither in close proximity to the central electron transfer region nor to the hinge region (Fig. 2DGo).


Figure 2
View larger version (63K):
[in this window]
[in a new window]

 
Fig. 2. Structural Representations of the Human POR Molecule with Introduction of POR Mutants

A, Structural key elements of the human POR molecule, including the NADPH binding domain (blue ribbon), the FAD binding domain (yellow ribbon), the FMN binding domain (green ribbon), and the connecting domain (gray ribbon) with the flexible hinge region (orange). NADPH, FAD, and FMN are depicted in balls with colors matching their binding domains. B, POR mutants Y181D and H628P located within the central electron transfer area of the POR molecule (NADPH > FAD > FMN), in immediate proximity to the FMN (Y181D) and NADPH binding site (H628P). C, POR mutant S244C located within the hinge region (amino acids 237–246) of the molecule that forms part of the connecting domain and is thought to bring the FAD and FMN domains into spatial contiguity to facilitate electron transfer. D, POR mutant A287P, located in clear distance to all other mutants opposite the central cavity with the binding sites for the elements of the electron transfer chain.

 
Effects of POR Mutants on CYP17A1 Activities
POR facilitates the transfer of electrons to CYP17A1, and this is required for both 17{alpha}-hydroxylase and 17,20 lyase activities; the latter is further enhanced by allosteric interaction of the CYP17A1-POR complex with cytochrome b5 (6). Thus, 17,20 lyase assays were performed with exogenously added cytochrome b5. In the yeast microsomal coexpression assay, kinetic constants for the 17{alpha}-hydroxylation of pregnenolone and Prog are equivalent, whereas the 17,20 lyase activity of CYP17A1 has a 100-fold higher substrate preference for 17-Preg than for 17-OHP (6). Therefore, we assessed 17{alpha}-hydroxylase activity as the conversion of Prog to 17-OHP, and 17,20 lyase activity was measured as the conversion of 17-Preg to DHEA.

All POR mutants examined led to equivalent decreases in 17{alpha}-hydroxylase activity when coexpressed with CYP17A1 (Fig. 3AGo), with the exception of Y181D that resulted in complete loss of function (Table 1Go). Coexpression of S244C, A287P, and H628P with human CYP17A1 significantly reduced the maximal velocity (Vmax) of the enzymatic reaction, whereas Km remained essentially unaltered (Table 1Go).


Figure 3
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 3. Kinetic Analysis of CYP17A1 Activities

Lineweaver-Burk plots of 17{alpha}-hydroxylase activity converting Prog to 17-OHP (A) and 17,20 lyase activity converting 17-Preg to DHEA (B) as assessed by incubation of yeast microsomes coexpressing human wild-type (WT) or mutant POR and human CYP17A1 with either 0.5–5.0 µM [3H]Prog (17{alpha}-hydroxylase) or 17-Preg (17,20 lyase). C, A representative Western blot using antibodies against human CYP17A1 and human POR confirming equivalent expression of both CYP17A1 and POR in all microsomal preparations.

 

View this table:
[in this window]
[in a new window]

 
Table 1. Enzyme Kinetic Analysis of CYP17A1 and CYP21A2 Coexpressed with Wild-Type or Mutant POR

 
Impairment of 17,20 lyase activity by coexpression of mutant POR proteins displayed a similar pattern (Fig. 3BGo), with an even more marked reduction in Vmax (Table 1Go), with only 18–22% of wild-type catalytic efficiency (Vmax/Km) remaining. H628P appeared to lead to the most significant reduction in 17,20 lyase activity (Fig. 3BGo), whereas its inhibitory effect on 17{alpha}-hydroxylase activity did not differ from the other POR mutants examined. Western blot analysis documented equal amounts of CYP17A1 protein in the microsome preparations (Fig. 3CGo).

NADPH binding assays demonstrated a significant increase in 17{alpha}-hydroxylase activity with increasing NADPH concentrations for wild-type POR and the A287P and S244C mutants. In contrast, H628P, which is located in immediate proximity to the NADPH binding domain of POR (Fig. 2BGo), did not respond to NADPH administration (Fig. 4Go).


Figure 4
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 4. NADPH Binding Assay

Yeast microsomes coexpressing human POR [wild-type (WT) or mutant] and either human CYP17A1 were incubated with 0–8 µM NADPH and 5.0 µM [3H]Prog for assessment of 17{alpha}-hydroxylase activity by measuring the conversion of Prog to 17-OHP.

 
Effects of POR Mutants on CYP21A2 Activities
The POR mutations H628P and S244C again led to significant and equivalent decreases in catalytic efficiency (Fig. 5Go, A and B) comparable with the magnitude of the observed effects on 17{alpha}-hydroxylase activity. Consistent with its effects of CYP17A1 activities, Y181D completely abolished CYP21A2 function. Similar levels of expression of CYP21A2 and POR wild-type and mutant proteins were verified by Western blotting (Fig. 5CGo). Consistent with the effects of the POR mutants on CYP17A1 activities, the observed decrease in catalytic efficiency of CYP21A2 was primarily attributable to reduced maximal velocity (Vmax) (Table 1Go).


Figure 5
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 5. Kinetic Analysis of CYP21A2 Activities

Lineweaver-Burk plots of 21-hydroxylase activity converting Prog to 11-DOC (A) and converting 17-OHP to 11-DOC (S) (B) as assessed by incubation of yeast microsomes coexpressing human wild-type (WT) or mutant POR and human CYP21A2 with either 0.5–5.0 µM [3H]Prog or 17-OHP. C, A representative Western blot using antibodies against human CYP21A2 and human POR confirming equivalent expression of both CYP21A2 and POR in all microsomal preparations.

 
However, in contrast, CYP21A2 coexpressed with the POR mutant A287P showed only mild functional impairment for the conversion of Prog to 11-deoxycorticosterone (DOC) (Fig. 5AGo) and 17-OHP to 11-deoxycortisol (Fig. 5BGo), retaining 77 and 63% of wild-type activity, respectively.

Direct comparison of the impairment of catalytic efficiencies for the four examined enzymatic reactions (Fig. 6Go) illustrates that all mutations other than A287P result in equivalent decreases in CYP17A1 and CYP21A2 activities. In contrast, A287P shows differential effects, with strong inhibition of CYP17A1 but primarily preserved CYP21A2 activity (Fig. 6Go).


Figure 6
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 6. Catalytic Efficiency of CYP17A1 and CYP21A2 after Coexpression with Mutant or Wild-Type POR

Yeast microsomes coexpressing human POR (wild-type or mutant) and either human CYP17A1 or CYP21A2 were incubated with 0.5–5 µM [3H]Prog (for assessment of 17{alpha}-hydroxylase and 21-hydroxylase activity), 17-OHP (for 21-hydroxylase activity), or 17-Preg (for 17,20 lyase activity). Catalytic efficiencies were calculated as the ratio of Vmax/Km based on the results of kinetic analysis shown in Table 1Go and expressed as percentage of wild-type activity, with wild-type set as 100% for each experiment, incorporating results from at least three independent triplicate experiments.

 
Effects of Mutant POR on Urinary Steroid Metabolites in Patients with POR Deficiency
In addition to in vitro analysis, we performed in vivo analysis of steroidogenesis by GC/MS analysis of 24-h urinary steroid metabolite excretion in 11 patients with POR deficiency. As a consequence of POR mutations, all affected patients have impaired 17{alpha}-hydroxylase activity and consequently a higher corticosterone over cortisol metabolite ratio than sex- and age-matched healthy controls. However, patients homozygous for the A287P mutation had a significantly higher corticosterone over cortisol metabolite ratio compared with other patients with POR deficiency, including one patient homozygous for H628P (Fig. 7Go), thus indicating a preferential inhibition of CYP17A1 over CYP21A2 by A287P also in the in vivo situation.


Figure 7
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 7. Urinary Excretion of Corticosterone Metabolites over Cortisol Metabolites as Measured by GC/MS in 24-h Urines from Patients with POR Deficiency (ORD; n = 11) and Sex- and Age-Matched Healthy Controls (n = 45)

In all POR deficiency patients, the underlying diagnosis had been established by direct sequencing, providing evidence for either compound heterozygous (n = 7) or homozygous (A287P, n = 3; H628P, n = 1) mutations in the POR gene. The compound heterozygous cohort represents individuals with various combinations of missense, frame shift, and splice site mutations in POR. The higher the corticosterone/cortisol metabolite ratio, the more dominant is the conversion of Prog to 11-DOC by CYP21A2 over the conversion of Prog to 17-OHP by CYP17A1 (see Fig. 1Go). All POR deficiency patients have a higher ratio than the healthy controls because POR mutations invariably result in partial loss of CYP17A1 17{alpha}-hydroxylase activity. However, the highest ratio is found in A287P homozygous patients, thereby indicating preferential inhibition of 17{alpha}-hydroxylase (CYP17A1) over 21-hydroxylase (CYP21A2). Corticosterone metabolites were as follows: THA, tetrahydro-11-dehydrocorticosterone; 5{alpha}THA, 5{alpha}-tetrahydro-11-dehydrocorticosterone; THB, tetrahydrocorticosterone; and 5{alpha}THB, 5{alpha}-tetrahydrocorticosterone. Cortisol metabolites were as follows: THE, tetrahydrocortisone; THF, tetrahydrocortisol; and 5{alpha}THF, 5{alpha}-tetrahydrocortisol.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Here we have shown that human POR mutations located within the central electron transfer region (Y181D and H628P) or the hinge region (S244C) of the POR molecule result in similar disruption of CYP17A1 and CYP21A2 activities, whereas the mutation most commonly found in patients with POR deficiency, A287P, differentially affects the activities of these two key enzymes in steroidogenesis.

The tyrosine 181 residue is of central importance for FMN binding (2, 12), and the Y181D mutation has been shown previously to result in complete loss of function (2, 7). The novel mutation H628P is located in proximity to the binding site of NADPH, similar to the previously reported mutation C569Y (2, 3). Unsurprisingly, we could confirm impaired NADPH binding for H628P, resulting in significant and equivalent impairments of CYP17A1 and CYP21A2 activities. The S244C mutant is not naturally occurring, but we specifically generated this mutant to examine the functional significance of the hinge region, which had not been addressed by any previous functional studies on the POR molecule. According to the three-dimensional POR model based on x-ray crystallography (9), amino acid residues 237–246 represent a highly flexible region between the FMN domain and the connecting domain of POR. These residues are mainly hydrophilic, and, therefore, the interaction between them is thought to be essentially electrostatic (9), thus our mutation of serine to cysteine was chosen to induce only a subtle change within the hinge structure. In our assay, S244C resulted in a decrease in catalytic efficiency of both CYP17A1 and CYP21A2, similar to that observed for H628P, a mutation in immediate proximity to the electron transport chain itself. This supports the view that the hinge is crucial for full functionality of electron transfer within the POR molecule, in keeping with previous suggestions (9).

Intriguingly, our in vitro assays showed that, in contrast to all other mutants examined, the POR mutant A287P differentially inhibited steroidogenic activities, resulting in marked reduction of CYP17A1 activities but primarily preserving CYP21A2 function. Importantly, this finding was mirrored by the results of GC/MS analysis of urinary steroid excretion, demonstrating a significantly increased corticosterone metabolite over cortisol metabolite ratio in patients homozygous for A287P, thereby providing compelling in vivo evidence for a preferential inhibition of CYP17A1 over CYP21A2 by A287P. Because the vast majority of patients with POR deficiency identified to date are infants or young children, one cannot give precise answers yet regarding the eventual phenotypic consequences of this finding. However, one would assume that the preferential inhibition of CYP17A1 over CYP21A2 in A287P homozygous patients might lead to mineralocorticoid-mediated hypertension later in life, albeit milder than usually observed in isolated and complete CYP17A1 deficiency attributable to CYP17A1 mutations. Long-term clinical follow-up studies will have to clarify whether this is the case.

The differential inhibition of CYP enzymes interacting with mutant POR has several obvious implications beyond the inhibition of CYP17A1 and CYP21A2. In patients affected by POR deficiency, a considerable phenotypic variability is observed, in particular with regard to the presence of skeletal malformations and the degree of genital ambiguity. However, the phenotype appears to be primarily consistent within individuals of the same genotype. Therefore, phenotypic variability might at least in part be caused by differential interactions of the specific POR mutant with electron-accepting CYP enzymes. This might include CYP51A1 (14{alpha}-lanosterol-demethylase), a key enzyme in sterol biosynthesis, that has been implicated previously in the pathogenesis of the Antley-Bixler type skeletal malformations observed in many but not all patients affected by POR deficiency (2, 3). Importantly, recent genotype phenotype analysis that we performed in a large cohort of patients with POR deficiency (our unpublished data) indicates that A287P homozygous patients always present with overt skeletal malformations, whereas several other POR mutants do not appear to cause a malformation phenotype. This observation together with our current finding of differential effects of POR mutations on CYP enzyme activities generates a unique opportunity to test whether inhibition of sterol biosynthesis and specifically CYP51A1 is indeed involved in the pathogenesis of skeletal malformations. If this is the case, one would expect preferential inhibition of CYP51A1 activity by A287P with lesser or no inhibition by the POR mutants not associated with a malformation phenotype.

There are a number of possible mechanisms by which the A287P mutant could impact on POR function. First, the mutation is a substitution of alanine by proline within a ß-sheet of the FAD domain and proline residues tend to be ß-sheet breakers. Thus, A287P could significantly disrupt the ß-sheet structure, thereby potentially altering the binding affinity of POR for FAD. However, this option is an unlikely explanation for our findings because this would not explain a differential inhibition of CYP17A1 and CYP21A2 activities. If the conformation of the whole FAD domain is destabilized by A287P, one would assume a decrease in all enzymatic activities.

An alternative and potentially more plausible model is derived from examining the impact of A287P on POR structure using a three-dimensional model (Fig. 8Go). Modeling reveals that A287P is located in immediate proximity to a proline-phenylalanine-rich (PPF) motif (residues 277–286) that extends to an adjacent region containing many charged residues in close proximity to the N-terminal transmembranous membrane-anchoring domain of POR (Fig. 8AGo). Additionally, considering that the extended PPF motif contains several clusters of positively charged residues (K/R), which can interact with negative charges on phospholipid head groups, it is feasible to hypothesize that this region is involved in membrane attachment of POR. The change from alanine to proline in position 287 is likely to impact on an adjacent phenylalanine residue in position 285 (Fig. 8Go, B and C), thereby potentially inducing a conformational change in the PPF motif. This extended PPF motif (POR residues 253–286) and the adjacent alanine are highly conserved among mammalian species and also Xenopus laevis, Drosophila melanogaster, and Saccharomyces cerevisiae (Fig. 9Go), indicating an important role for this domain in POR function. Thus, a conformational change in the PPF motif brought on by A287P might disorder the attachment of the POR molecule to the endoplasmic reticulum membrane. This in turn could disrupt the access of electron-accepting CYP enzymes to the CYP docking site of POR. As a consequence, some CYP enzymes (e.g. CYP21A2) will still achieve a near normal interaction, whereas others (e.g. CYP17A1) are no longer capable of forming a complex with POR that allows for efficient electron transfer. However, at present, this proposed mechanism is hypothetical and requires additional investigation.


Figure 8
View larger version (66K):
[in this window]
[in a new window]

 
Fig. 8. Possible Mechanism Underlying the Differential Inhibition of CYP17A1 and CYP21A2 by the POR Mutant A287P

A, Structural representation of the POR molecule with introduction of the A287P mutation. Key functional elements of the POR molecule are indicated: first, the central electron transfer chain comprising the binding domains for NADPH (blue), FAD (yellow), and FMN (green); second, the CYP docking site (turquoise) in which the electron-accepting CYP enzyme interacts with POR; and third, the start of the membrane-anchoring transmembranous domain (dark blue). The remainder of the transmembranous domain, equivalent to the N-terminal part of the POR protein, is not depicted because it is highly hydrophobic and thus was not amenable to crystallization and subsequent structural modeling (9 ). A287P (red) is located in close proximity to a PPF motif (residues 277–286) (lime green), which is adjacent to an area containing many charged residues (orange). This extended PPF (residues 253–286) is located in immediate proximity to the start of the membrane anchor. B and C, POR residue F285 neighboring A287 and P287, respectively (for visual clarity, amino acids D321–V323 were removed from the ß-sheet depicted in gray above the F285 residue). The change from alanine to proline in position 287 might induce a conformational change in the extended PPF motif by disrupting the interaction between residue 287 and the phenylalanine at position 285. This conformational change could potentially impact the attachment of the POR molecule to the endoplasmic reticulum membrane, thereby hindering some CYP enzymes (e.g. CYP17A1) more than others (e.g. CYP21A2) to access the CYP docking site.

 

Figure 9
View larger version (28K):
[in this window]
[in a new window]

 
Fig. 9. Conservation of the Alanine Residue and the Adjacent Extended PPF Motif in POR Proteins across Species

Alignment of the amino acid sequences of seven POR proteins reveals a high degree of conservation, with the alanine residue conserved in all species examined. All amino acid residues fully conserved between POR proteins from different species are highlighted (black background with white letters), and similar regions are also shown (gray background with white letters). The numbers refer to the residues of the human POR protein, and residue 287 is marked by an asterisk. GenBank accession nos. of the aligned POR proteins are as follows: human POR, NP_000932; mouse (Mus musculus) POR, P37040; rat (Rattus norvegicus) POR, NP_113764; rabbit (Oryctolagus cuniculus) POR, P00389; Drosophila (Drosophila melanogaster) POR, NP_477158; Xenopus (Xenopus laevis) POR, AAH59318; and yeast (Saccharomyces cerevisiae) POR, P16603.

 
In conclusion, the POR mutant A287P differentially affects the catalytic activity of CYP17A1 and CYP21A2. This is a novel observation that might explain phenotypic variability in patients with POR deficiency. Beyond its role as a key regulator of steroid and sterol biosynthesis, POR also represents a crucial electron donor to hepatic CYP enzymes facilitating the hydroxylation of fatty acids, prostaglandins, and, importantly, exogenous toxins and pharmaceutical drugs. Therefore, it is readily conceivable that differential interactions of mutant (or variant) POR may have a significant impact on drug detoxification and metabolism. New mechanistic insights into the differential interaction of POR with electron-accepting CYP enzymes, as exemplified by our findings, open up novel perspectives for pharmacogenomics.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Mutation numbering refers to the amino acid position in the National Center for Biotechnology Information (NCBI) protein database reference sequence of the human POR protein (NCBI accession no. NP_000932). Reagents and chemicals were purchased from either Fisher (Loughborough, UK) or Sigma (Poole, UK) except when indicated. [3H]Prog and 17-OHP were obtained from PerkinElmer (Beaconsfield, UK). [3H]17-Preg was synthesized by incubating yeast microsomes expressing the 17,20 lyase-deficient human CYP17A1 mutant R358Q (13) with [3H]pregnenolone (55.4 Ci/mol; PerkinElmer), as described previously (14).

Site-Directed Mutagenesis for Generation of POR Mutants
Human wild-type POR cDNA was subjected to PCR-based site-directed mutagenesis as described previously (2). For generation of the POR mutants Y181D and A287P, previously reported primer pairs were used (2). For generation of the novel mutants S244C and H628P, the following primer pairs were used (mutated base pairs in bold, affected codon underlined): S244C, forward primer, 5'-CTGGCGAGGAGTCCTGCATTCGCCAGTACG; reverse primer, 5'-CGTACTGGCGAATGCAGGACTCCTCGCCAG-3'; H628P, forward primer, 5'-GAAGGCGGTGCCCCCATCTACGTCTGTGG-3'; and reverse primer, 5'-CCACAGACGTAGATGGGGGCACCGCCTTC-3'. All inserts were sequenced in their entirety to confirm the mutations and to ensure that no other bases had been changed.

Yeast Transformation
S. cerevisiae strain W303B (15) was transformed using a modification of the lithium acetate method (16). Yeast were grown in 15 ml YPD medium to an OD600 of 0.5–0.8, and 1.5 ml was harvested by centrifugation, resuspended in 100 µl Li/Te [0.1 M lithium acetate, 10 mM Tris-HCl (pH 7.5), and 1 mM EDTA], and incubated for 5 min at room temperature. The yeast pellet was mixed with 700 µl freshly prepared PEG/LiAc [40% aqueous polyethylene glycol 3350, 0.1 M lithium acetate, 10 mM Tris-HCl (pH 7.5), and 1 mM EDTA] and then gently mixed with 50 µg denatured (95 C for 5 min) herring sperm DNA before adding 2 µg plasmid DNA. Yeast were then incubated at 30 C for 30 min, heat shocked at 42 C for 15 min, and harvested by centrifugation for 5 min at 16,000 rpm. Cells were then washed in 500 µl TE/sorbitol [1 M sorbitol, 10 mM Tris-HCl (pH 7.5), and 1 mM EDTA], before resuspension in 100 µl TE [10 mM Tris-HCl (pH 7.5) and 1 mM EDTA]. Transformed yeast clones were selected on minimal medium [1.7 g/liter yeast nitrogen base (Difco, Oxford, UK), 5 g/liter ammonium sulfate, and 2 g/liter glucose] with the appropriate amino acid complementation (40 mg/liter). To ensure similar expression of wild-type CYP17A1 or wild-type CYP21A2, yeast transformation was performed in two subsequent steps. First, yeast were transformed with yeast expression vector V10 (15) containing the coding sequence for wild-type human CYP17A1 (6) (kindly donated by Prof. Walter L. Miller, University of California, San Francisco, San Francisco, CA) or wild-type human CYP21A2. To generate V10-CYP21A2, the CYP21A2 coding sequence was amplified from human adrenal cDNA by using 5' sense primer CCAGATCTGCGTCTCGCCATGC that included a BglII restriction site and 3' antisense primer CGGCTGGCATCGGTCCTG. This facilitated directional cloning into V10, which had been digested previously with EcoRI, followed by blunt ending and digestion with BglII. In a second transformation step, a CYP17A1- or CYP21A2-expressing yeast clone was selected, propagated, and subsequently cotransformed with yeast expression vector pYcDE2 (17), containing the coding sequence of either wild-type human POR (6) (kindly donated by Prof. Walter L. Miller) or mutant POR.

Microsome Preparation
Transformed yeast were grown in 300 ml liquid minimal medium with adenine and harvested at a density of 3–5 x 107 cells/ml (OD600 of 1.0–1.8) by centrifugation. Cells were resuspended in 5 ml TEK (0.1 M KCl, 50 mM Tris-HCl, and 1 mM EDTA), kept at ambient temperature for 5 min, and collected by centrifugation. Cells were then resuspended in 2 ml TES-B [50 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 0.6 M sorbitol] containing protease inhibitors (Mini EDTA free cocktail tablet; Roche, Lewes, UK). Acid washed glass beads (425–600 µm) were added, and the mixture was vortexed five times (30 sec pulse, 30 sec on ice). Disrupted cells were centrifuged twice for 10 min at 10,000 x g to remove cell debris, nuclei, and mitochondria; microsomes were collected by ultracentrifugation of the supernatant at 100,000 x g for 90 min. Resulting pellets were homogenized in TE-G [50 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 20% glycerol] by mechanical shearing through 19- and 25-gauge needles. Microsomes were kept frozen in aliquots at –80 C until use.

Protein Measurements
Microsomal protein content was measured by the Bradford method (Bio-Rad, Hemel Hempstead, UK), and the expression of similar amounts of CYP was confirmed by CO difference spectra analysis as described previously (18) using 500 mg microsomal protein on a Uvikon 922 dual-beam spectrophotometer (Kontron Instruments, Bletchley, UK). To ensure the use of similar amounts of wild-type and mutant POR proteins, Western blot analysis was performed as described previously (19) with the use of polyclonal human antibodies to POR (20) (kindly donated by Prof. C. Roland Wolf, University of Dundee, Dundee, UK). The yeast strains used for POR transformation stably expressed CYP17A1 and CYP21A2, respectively, subsequent to the first transformation step as described above. However, to further ensure that CYP17A1 and CYP21A2 expression did not vary, we also performed Western blot analysis for protein expression of CYP17A1 (kindly donated by Prof. William H. Rainey, University of Augusta, Augusta, GA) and CYP21A2 (generous gift from Dr. Svetlana Lajic, Karolinska Institutet, Stockholm, Sweden).

Enzymatic Activity Assays
Yeast microsomes containing wild-type CYP17A1 or CYP21A2 and either wild-type or mutant POR were incubated in 196 µl of 50 mM potassium phosphate buffer (pH 7.4). Microsomes were incubated with 0.5–5.0 µM Prog or 17-Preg for 17{alpha}-OHP and 17,20 lyase activities of CYP17A1 and 0.5–5.0 µM Prog or 17-OHP for 21-hydroxylase activities of CYP21A2. Steroids were added in 4 µl ethanol, also containing 10,000 cpm of [3H]Prog, 17-OHP, and 17-Preg, respectively (all 55.4 Ci/mol). All reactions were initiated by the addition of 10 mM NADPH, with subsequent incubation at 37 C. All assays were performed within the linear time range of the enzymatic reaction, as assessed by preceding experiments. Assays for 17,20 lyase activity were performed with the addition of 10 pmol of purified recombinant human cytochrome b5 (Invitrogen, Paisley, UK).

NADPH binding assays were performed by increasing the NADPH concentration (0–8 µM) in 17{alpha}-hydroxylase assays performed for analyzing the conversion of Prog to 17-hydroyxprogesterone at 5 µM Prog.

Steroids were extracted with 2 ml dichloromethane, concentrated by evaporation at 55 C, and separated by thin-layer chromatography on PE SIL G/UV silica gel plates (Whatman, Maidstone, Kent, UK) using a 3:1 chloroform/ethyl acetate solvent system. Substrates and conversion products were identified by comparison with comigration of unlabeled reference steroids using Liebermann-Burchard reagent as described previously (21) and quantified using a Bioscan 2000 image analyzer (Lablogic, Sheffield, UK). All assays were performed in at least three independent triplicate experiments, and data are presented as means ± SD. Kinetic parameters were established by nonlinear regression, using the Michaelis-Menten equation to determine the Michaelis-Menten constant Km and maximal velocity Vmax. Catalytic efficiency was defined as the ratio Vmax/Km and expressed as percentage of wild-type activity. Calculation of enzyme kinetic parameters and subsequent statistical analysis was performed using curve-fitting software (Enzfitter 2.0.9.1; Biosoft, Cambridge, UK).

Urinary Steroid Metabolite Analysis
Urinary steroid excretion was measured in 11 patients with POR deficiency attributable to POR mutations on both the paternal and the maternal allele, as proven by direct sequencing. Analysis of urinary steroid metabolite excretion was performed as described previously by a quantitative GC/MS selected ion-monitoring method (5, 22, 23). In brief, steroids were enzymatically released from conjugation and, after extraction, chemically derivatized before GC/MS selected ion-monitoring analysis. Steroids quantified included corticosterone metabolites (tetrahydro-11-dehydrocorticosterone, 5{alpha}-tetrahydro-11-dehydrocorticosterone, tetrahydrocorticosterone, and 5{alpha}-tetrahydrocorticosterone) and cortisol metabolites (tetrahydrocortisone, tetrahydrocortisol, 5{alpha}-tetrahydrocortisol, and 5{alpha}-tetrahydrocortisol). The ratio of corticosterone metabolites over cortisol metabolites was calculated as a measure of relative contributions of CYP17A1 and CYP21A2 to the conversion of Prog to 17-OHP and 11-DOC, respectively.

Molecular Modeling
The x-ray structure of rat POR (9) (Protein Data Bank accession code 1J9Z) served as the template for three-dimensional modeling of the location and structural impact of the studied POR mutations. Rat POR (NCBI accession no. NP_113764) shares 92.2% sequence identity to the human POR protein (NCBI accession no. NP_000932), and all amino acids affected by mutations and their immediate proximity are 100% conserved between human and rat. Amino acid differences between human and rat POR were corrected by exchange of residues in the template, followed by energy minimization using the steepest descent algorithm implemented in the GROMOS software (http://www.igc.ethz.ch/gromos/). The structural representations of the humanized three-dimensional POR model were generated using the programs Deep View/Swiss-PDB Viewer (http://www.expasy.org/spdbv/) and POVRAY (The Persistence of Vision Raytracer; http://www.povray.org).


    ACKNOWLEDGMENTS
 
We are grateful to Dr. Richard J. Auchus (University of Texas Southwestern Medical Center, Dallas, TX) for helpful advice regarding the synthesis of radiolabeled 17-hydroxypregnenolone. We thank Beverly A. Hughes and Helois Radford (University of Birmingham, Birmingham, UK) for excellent technical support. Early GC/MS analyses were performed by Dr. Josep Marcos (Children’s Hospital Oakland Research Institute, Oakland, CA). We are indebted to Dr. Boris Kysela (University of Birmingham, Birmingham, UK) and Dr. Steve K. Chapman (Department of Chemistry, University of Edinburgh, Edinburgh, UK) for helpful suggestions.


    FOOTNOTES
 
This work was supported by Medical Research Council (United Kingdom) Senior Clinical Fellowship G116/172 (to W.A.), Wellcome Trust Programme Grant 066357 (to P.M.S.), Clinician Scientist Fellowship Grant 079865MA (to N.K.), and the Royal College of Physicians (Samuel Leonard Simpson Fellowship in Endocrinology; to N.K.). A.J.D. is a Royal Society University Research Fellow.

Disclosure Summary: V.D., H.E.I., N.K., C.H.L.S., and A.J.D. have nothing to declare. P.M.S. received consultant fees from Pfizer, Speedel, and Duocort, and W.A. received consultant fees from Phoqus and HRA Pharma.

First Published Online May 15, 2007

Abbreviations: CAH, Congenital adrenal hyperplasia; CYP, cytochrome P450; DHEA, dehydroepiandrosterone; 11-DOC, 11-deoxycorticosterone; FAD, flavin adenine dinucleotide; FMN, flavin mononucleotide; GC/MS, gas chromatography/mass spectrometry; 17-OHP, 17-hydroxyprogesterone; NADPH, nicotinamide adenine dinucleotide phosphate; NCBI, National Center for Biotechnology Information; PPF, proline-phenylalanine-rich; POR, P450 oxidoreductase; 17-Preg, 17-hydroxypregnenolone; Prog, progesterone.

Received for publication February 1, 2007. Accepted for publication May 10, 2007.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Peterson RE, Imperato-McGinley J, Gautier T, Shackleton C 1985 Male pseudohermaphroditism due to multiple defects in steroid-biosynthetic microsomal mixed-function oxidases. A new variant of congenital adrenal hyperplasia. N Engl J Med 313:1182–1191[Abstract]
  2. Arlt W, Walker EA, Draper N, Ivison HE, Ride JP, Hammer F, Chalder SM, Borucka-Mankiewicz M, Hauffa BP, Malunowicz EM, Stewart PM, Shackleton CH 2004 Congenital adrenal hyperplasia caused by mutant P450 oxidoreductase and human androgen synthesis: analytical study. Lancet 363:2128–2135[CrossRef][Medline]
  3. Fluck CE, Tajima T, Pandey AV, Arlt W, Okuhara K, Verge CF, Jabs EW, Mendonca BB, Fujieda K, Miller WL 2004 Mutant P450 oxidoreductase causes disordered steroidogenesis with and without Antley-Bixler syndrome. Nat Genet 36:228–230[CrossRef][Medline]
  4. Speiser PW, White PC 2003 Congenital adrenal hyperplasia. N Engl J Med 349:776–788[Free Full Text]
  5. Shackleton C, Marcos J, Malunowicz EM, Szarras-Czapnik M, Jira P, Taylor NF, Murphy N, Crushell E, Gottschalk M, Hauffa B, Cragun DL, Hopkin RJ, Adachi M, Arlt W 2004 Biochemical diagnosis of Antley-Bixler syndrome by steroid analysis. Am J Med Genet 128A:223–231
  6. Auchus RJ, Lee TC, Miller WL 1998 Cytochrome b5 augments the 17,20-lyase activity of human P450c17 without direct electron transfer. J Biol Chem 273:3158–3165[Abstract/Free Full Text]
  7. Huang N, Pandey AV, Agrawal V, Reardon W, Lapunzina PD, Mowat D, Jabs EW, Van Vliet G, Sack J, Fluck CE, Miller WL 2005 Diversity and function of mutations in p450 oxidoreductase in patients with Antley-Bixler syndrome and disordered steroidogenesis. Am J Hum Genet 76:729–749[CrossRef][Medline]
  8. Arlt W, Auchus RJ, Miller WL 2001 Thiazolidinediones but not metformin directly inhibit the steroidogenic enzymes P450c17 and 3ß-hydroxysteroid dehydrogenase. J Biol Chem 276:16767–16771[Abstract/Free Full Text]
  9. Wang M, Roberts DL, Paschke R, Shea TM, Masters BS, Kim JJ 1997 Three-dimensional structure of NADPH-cytochrome P450 reductase: prototype for FMN- and FAD-containing enzymes. Proc Natl Acad Sci USA 94:8411–8416[Abstract/Free Full Text]
  10. Adachi M, Tachibana K, Asakura Y, Yamamoto T, Hanaki K, Oka A 2004 Compound heterozygous mutations of cytochrome P450 oxidoreductase gene (POR) in two patients with Antley-Bixler syndrome. Am J Med Genet A 128:333–339[Medline]
  11. Fukami M, Horikawa R, Nagai T, Tanaka T, Naiki Y, Sato N, Okuyama T, Nakai H, Soneda S, Tachibana K, Matsuo N, Sato S, Homma K, Nishimura G, Hasegawa T, Ogata T 2005 Cytochrome P450 oxidoreductase gene mutations and Antley-Bixler syndrome with abnormal genitalia and/or impaired steroidogenesis: molecular and clinical studies in 10 patients. J Clin Endocrinol Metab 90:414–426[Abstract/Free Full Text]
  12. Shen AL, Porter TD, Wilson TE, Kasper CB 1989 Structural analysis of the FMN binding domain of NADPH-cytochrome P-450 oxidoreductase by site-directed mutagenesis. J Biol Chem 264:7584–7589[Abstract/Free Full Text]
  13. Geller DH, Auchus RJ, Mendonca BB, Miller WL 1997 The genetic and functional basis of isolated 17,20-lyase deficiency. Nat Genet 17:201–205[CrossRef][Medline]
  14. Gupta MK, Guryev OL, Auchus RJ 2003 5{alpha}a-Reduced C21 steroids are substrates for human cytochrome P450c17. Arch Biochem Biophys 418:151–160[CrossRef][Medline]
  15. Pompon D, Louerat B, Bronine A, Urban P 1996 Yeast expression of animal and plant P450s in optimized redox environments. Methods Enzymol 272:51–64[CrossRef][Medline]
  16. Gietz D, St Jean A, Woods RA, Schiestl RH 1992 Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res 20:1425[Free Full Text]
  17. Hadfield C, Cashmore AM, Meacock PA 1986 An efficient chloramphenicol-resistance marker for Saccharomyces cerevisiae and Escherichia coli. Gene 45:149–158[CrossRef][Medline]
  18. Omura T, Sata R 1964 The carbon monoxide-binding pigment of liver microsomes. I. Evidence for its hemoprotein nature. J Biol Chem 239:2370–2378[Free Full Text]
  19. Walker EA, Clark AM, Hewison M, Ride JP, Stewart PM 2001 Functional expression, characterization, and purification of the catalytic domain of human 11ß-hydroxysteroid dehydrogenase type 1. J Biol Chem 276:21343–21350[Abstract/Free Full Text]
  20. Smith GC, Tew DG, Wolf CR 1994 Dissection of NADPH-cytochrome P450 oxidoreductase into distinct functional domains. Proc Natl Acad Sci USA 91:8710–8714[Abstract/Free Full Text]
  21. Hammer F, Drescher DG, Schneider SB, Quinkler M, Stewart PM, Allolio B, Arlt W 2005 Sex steroid metabolism in human peripheral blood mononuclear cells changes with aging. J Clin Endocrinol Metab 90:6283–6289[Abstract/Free Full Text]
  22. Shackleton CH 1993 Mass spectrometry in the diagnosis of steroid-related disorders and in hypertension research. J Steroid Biochem Mol Biol 45:127–140[CrossRef][Medline]
  23. Caulfield MP, Lynn T, Gottschalk ME, Jones KL, Taylor NF, Malunowicz EM, Shackleton CH, Reitz RE, Fisher DA 2002 The diagnosis of congenital adrenal hyperplasia in the newborn by gas chromatography/mass spectrometry analysis of random urine specimens. J Clin Endocrinol Metab 87:3682–3690[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
M. Fukami, G. Nishimura, K. Homma, T. Nagai, K. Hanaki, A. Uematsu, T. Ishii, C. Numakura, H. Sawada, M. Nakacho, et al.
Cytochrome P450 Oxidoreductase Deficiency: Identification and Characterization of Biallelic Mutations and Genotype-Phenotype Correlations in 35 Japanese Patients
J. Clin. Endocrinol. Metab., May 1, 2009; 94(5): 1723 - 1731.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. G. Gomes, N. Huang, V. Agrawal, B. B. Mendonca, T. A. S. S. Bachega, and W. L. Miller
The Common P450 Oxidoreductase Variant A503V Is Not a Modifier Gene for 21-Hydroxylase Deficiency
J. Clin. Endocrinol. Metab., July 1, 2008; 93(7): 2913 - 2916.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Huang, V. Agrawal, K. M. Giacomini, and W. L. Miller
Genetics of P450 oxidoreductase: Sequence variation in 842 individuals of four ethnicities and activities of 15 missense mutations
PNAS, February 5, 2008; 105(5): 1733 - 1738.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dhir, V.
Right arrow Articles by Arlt, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dhir, V.
Right arrow Articles by Arlt, W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals