| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Urological Diseases Research Center, Department of Urology, Childrens Hospital Boston (N.K.M., B.C., M.L., J.K., R.M.A., M.R.F.), Molecular Urology Laboratory, Division of Urology, Brigham and Womens Hospital (L.M., A.S.F., J.P.R., B.C.-S.L.), and Departments of Surgery (N.K.M., B.C., M.L., J.K., R.M.A., M.R.F.) and Biological Chemistry and Molecular Pharmacology (M.R.F.), Harvard Medical School, Boston, Massachusetts 02115; Emory University School of Medicine (L.W.K.C.), Atlanta, Georgia 30322; and Division of Gastroenterology (S.K.R., A.B.L.), Tufts–New England Medical Center, Tufts University School of Medicine, Boston, Massachusetts 02111
Address all correspondence and requests for reprints to: Nishit K. Mukhopadhyay, Ph.D., Department of Urology/Surgery, Childrens Hospital Boston, Harvard Medical School, 300 Longwood Avenue, Boston, Massachusetts 02115. E-mail: nishit.mukhopadhyay{at}childrens.harvard.edu.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The effects of androgen are mediated through the androgen receptor (AR). The AR is a 110-kDa ligand-dependent transcription factor (TF) that is required for normal development and maintenance of male sexual characteristics (1, 2, 3). It has been documented that aberrant or inappropriate activation of the AR enhances the formation of prostatic hyperplasia or neoplasia. Multiple recent reports (4, 5, 6) also indicate that AR is functional even in the presence of trace (below physiologic) amounts of androgen. Androgen-independent PCa can express high levels of AR, which is thought to be physiologically relevant even in the castrate condition.
Before ligand binding, AR exists in an inactive form associated with heat-shock proteins and moves diffusely throughout the cytoplasm and nucleus. After ligand binding, heat-shock proteins dissociate from the receptor, and the AR translocates to the nucleus (7, 8, 9) in which it regulates transcription by binding to discrete DNA sequences termed androgen response elements (AREs) in the promoters of target genes. An important feature of ligand binding is that it induces a conformational change in the AR ligand binding domain, providing a surface for interactions with coregulatory proteins. These coregulators have the ability to act as either coactivators or corepressors of AR and influence its transcriptional activity (10, 11).
Several coactivators of AR-dependent transcription are known as the targets of Ras-related signals (12, 13, 14, 15, 16). Ras activation is a component of the signaling pathways for virtually all of the receptors shown to be up-regulated in advanced PCa. Autocrine and paracrine growth factor stimulation can induce the chronic activation of endogenous Ras and may sensitize prostate cells to subphysiological levels of androgen (17). It has also been shown that the expression of Ras increases the ability of LNCaP cells to form tumors and to resist regression after castration (12). In addition, the expression of dominant-negative N-17-Ras can restore androgen dependence to an androgen "independent" LNCaP derivative, C4-2 (18). Finally, gene expression profiling of androgen-independent LNCaP sublines revealed heightened steady-state levels of several proteins as potential mediators of androgen-independent growth, including MAPK, one of the downstream targets of Ras (19). Thus, these findings suggest that Ras may be involved in the progression of PCa cells to androgen independence. However, little is known about the mechanisms involved in this transition.
The presence of Ras response transcriptional elements (RREs) has been discovered in the promoters of various genes, and several proteins capable of binding to RRE have been reported (20, 21). Multiple splice variants of the RRE binding protein RREB-1 (Finb), which can bind to human, Drosophila, and chicken RRE, have been identified (21, 22, 23, 24, 25). It has been demonstrated that RREB-1 proteins can function as corepressors or coactivators depending on the specific promoter and cellular context (25, 26, 27).
By using a TF-TF interaction array procedure, we identified several new partners of AR (28). In the present study, we studied RREB-1 as a novel AR partner and investigated its potential role as an AR coregulator. We demonstrated that RREB-1 physically interacts with AR both in vitro and in vivo and serves as a potent AR corepressor. Moreover, the repressor activity of RREB-1 is significantly attenuated by activation of Ras. Our study demonstrates, for the first time, that the activation of Ras signaling can attenuate AR repression by a corepressor.
| RESULTS |
|---|
|
|
|---|
To identify AR-associated TFs, we used this technique using nuclear extracts (NEs) prepared from LNCaP cells in the presence or absence of 10 nM dihydrotestosterone (DHT). An AR-specific monoclonal antibody was used to immunoprecipitate AR and AR-associated TFs. The cis-elements that were retrieved by immunoprecipitation (IP) were then added to prehybridized array membranes containing consensus sequences of 94 different TFs (Table 1
). As indicated in Fig. 1A
, AR can bring down the binding sites of more than 10 TFs, including an upstream RRE present in the human calcitonin gene (spot K 7–8, also shown by a box). When the assay was performed without LNCaP NEs, none of these binding sites were detectable (data not shown), indicating that binding site selection relies solely on DNA-protein complex formation. To confirm the selection of RRE by the AR complexes, we repeated the same assay with RRE plus additional binding sites of some known TFs such as thyroid receptor and myeloid zinc finger-1, which are either absent in AR immunoprecipitate, or activating enhancer-binding protein-2 and Pax-5 (paired box gene 5), which are known to be present in AR immunoprecipitates but were not included in this array platform (Table 1
). As indicated in Fig. 1B
, only RRE was selected, indicating that protein(s) directly binding to the RRE were present in the AR complex. Moreover, the RRE binding activity as visualized in the array was indistinguishable irrespective of the treatment of the cells with hormone (data not shown).
|
|
To verify the presence of RRE-specific functional DNA-binding proteins in LNCaP NEs, we performed gel mobility shift assays with an RRE probe (GATCCGGTCCCCCACCATCCCCCGCCATTTCCA), which consists of a consensus RRE binding site (CCCCACCA) (21). As established in Fig. 1C
, 2
µg LNCaP NE showed strong binding activity compared with the probe alone. The specificity of this binding was also tested by the addition of 100-fold excess of RRE-specific oligomer, which abolished the signal (Fig. 1C
, lane 3).
|
To determine whether these interactions are direct, we performed glutathione S-transferase (GST) pull-down experiments using RREB-1 fused with GST protein or GST protein alone, preincubated with LNCaP NEs. The GST-RREB-1 column purified AR but the GST-column did not, indicating that RREB-1 directly interacts with AR (Fig. 1E
, lane 1 vs. lane 2).
Colocalization of RREB-1 and AR in LNCaP Cells
Studies by Ray et al. (25) indicated that RREB proteins exclusively localize in the nucleus in the human cervical carcinoma cell line C33A. In LNCaP cells, we find that RREB-1 primarily localizes in the nucleus with a small proportion of the protein remaining cytoplasmic irrespective of the hormone treatment (Fig. 2B
). In agreement with the existing AR literature (30), we found that AR localizes primarily in the cytoplasm under conditions of low androgen (Fig. 2C
) but translocates to the nucleus after hormone stimulation (Fig. 2G
). Our data also indicated that AR and RREB-1 colocalize in the nucleus after hormone treatment (Fig. 2H
).
RREB-1 Binds to the Prostate-Specific Antigen (PSA) Promoter
Because our results suggested that RREB-1 is a TF associated with AR, we performed chromatin immunoprecipitation (ChIP) to determine whether RREB-1 binds to the well-characterized, androgen-responsive human PSA promoter. Three AREs are located at nucleotides –170 (ARE I), –394 (ARE II), and –4200 (ARE III) in the PSA promoter. All of these AREs (31, 32) are involved in transcriptional regulation by androgen (Fig. 3A
). Chromatin of average fragment length 500-1000 bp was prepared from LNCaP cells and was immunoprecipitated with anti-AR, anti-RREB-1, and IgG control antibody. The purified protein-DNA complexes were isolated, and PSA promoter-specific primers were used to analyze the presence of promoter DNA sequence in the immunoprecipitate (Fig. 3
, B and C, top panels). Control PCR was also run in parallel with the genomic DNA purified from a portion of the starting material used for each IP and was used as an input control (Fig. 3
, B and C, bottom panels).
|
To verify whether RREB-1 can bind to the PSA promoter directly or, alternatively, via AR, we repeated the LNCaP experiment in AR-negative PC-3 cells. As shown in Fig. 3D
, RREB-1 did not bind to the PSA promoter in the absence of AR, at least in detectable amounts (lane 3). IgG IP and AR IP were used as negative controls (lanes 1 and 2), and genomic DNA was used as positive control. The bottom panel indicates the amount of input PSA before IP.
RREB-1 Down-Regulates PSA Promoter Activation
Co-occupancy of RREB-1 and AR on the PSA promoter raised the question of the function of RREB-1 in AR-mediated activation of the PSA promoter. To determine the role of RREB-1, we transiently transfected LNCaP cells with either empty vector or with increasing doses of wild-type human RREB-1 (pcDNA3-Finb/RREB-1) expression plasmid together with PSA-luciferase (p61PSA-Luc) promoter reporter construct in the presence or absence of synthetic androgen R1881 17ß-hydroxy-17
-methyl-estra-4,9,11-trien-3-one. As expected, the PSA reporter was strongly stimulated (12-fold) by R1881. However, the androgen-induced activation of the reporter gene was progressively repressed with increasing doses of RREB-1, indicating that RREB-1 may negatively regulate the transcriptional activity of AR (Fig. 4A
).
|
To confirm the above results, we used COS cells that do not express AR and asked whether the inhibitory function of RREB-1 on the pG4-Luc reporter gene expression was AR dependent. Given that the transcriptional activity of AR depends on the presence of its ligand (agonist), we also included R1881 treatment as described above. As expected, in the absence of the ligand, we observed a minimal increase of the reporter gene expression by AR alone, and coexpression of RREB-1 had only a minimal effect on transcription (Fig. 4C
). However, in the presence of ligand, AR elicited a robust increase in reporter gene expression, which was inhibited on coexpression of RREB-1 (Fig. 4C
). Collectively, our transfection results indicate that RREB-1 can down-regulate the transactivation function of AR. This effect is most likely mediated through protein-protein interactions involving AR bound to its target gene.
To eliminate potential artificial effects linked to the reporter assay, we examined the effect of RREB-1 expression on the expression and stability of AR and the expression of PSA. To determine whether the repression of PSA might be attributable to decreased AR expression or stability, lysates from transfected cells were immunoblotted for AR. AR protein levels were greater in the presence of androgen (Fig. 5A
, compare lane 1 with lane 2), but cotransfection with two different amounts of RREB-1 did not alter the level of AR (Fig. 5A
, lanes 4 and 6).
|
To verify the effect of RREB-1 on PSA expression, we knocked down RREB-1 using an RREB-1-specific small interfering RNA (siRNA) oligonucleotide pool electroporated into LNCaP cells. This resulted in 65% transfection efficiency as judged by green fluorescent protein expression (supplemental Fig. 1, published as supplemental data on The Endocrine Societys Journals Online web site at http://mend.endojournals.org). Under these conditions, we observed a marked increase in PSA expression, in both the presence and absence of hormone, after treatment with 100 nM siRNA (Fig. 5C
) compared with the control transfection, in which siRNA encoding scrambled sequence was used.
Domains of RREB-1 Mediating the PSA Promoter Repression
To delineate which domains of RREB-1 are involved in repression of androgen action at the PSA promoter, we generated a series of deletion mutants shown schematically in Fig. 6A
. Expression of all mutants was confirmed by Western blot analysis (data not shown). These deletion mutants were tested for their ability to act as repressors in a transient cotransfection assay in the presence and absence of ligand. As indicated in Fig. 6B
, deletion of 912 amino acids from the N terminus generated a form of RREB-1 (
1RREB-1) that retained only 31% of the repressor activity compared with the full-length RREB-1 construct (75% inhibition, compare lanes 4 and 6 with lane 2). Additional deletion of 285 more amino acids (
2RREB-1) did not have any additional effect on loss of repression compared with the
1RREB-1 construct. Rather, this mutant elicited 46% of the repression activity toward the PSA promoter (compare lane 2 with lane 8). Interestingly, a small deletion of the C-terminal 125 residues of the RREB-1 construct (
3RREB-1) only retained 8% of the repressor activity compared with the full-length RREB-1. Our observations suggest that repression of AR by RREB-1 apparently involves both the N- and C-terminal regions of the RREB-1 protein.
|
|
One of the best-characterized effector pathways triggered by Ras activation is the ERK-MAPK pathway (34). To further test the role of Ras signaling in RREB-1-mediated repression of AR transcriptional activity, we cotransfected RREB-1 and v-Ras in LNCaP cells in the presence and absence of PD98059 [2-(2-amino-3-methyoxyphenyl)-4H-1-benzopyran-4-one], a pharmacologic inhibitor of MEK, an immediate upstream activator of ERKs. PD98059 alone reduced the R1881-induced activation of PSA promoter activity by 70% (data not shown). Moreover, in the presence of PD98059, the attenuating effect of v-Ras expression on RREB-1-dependent PSA promoter repression in LNCaP cells was not observed (Fig. 7C
, compare lane 4 with lanes 8 and 10).
We took an alternate approach to establish further the effect of Ras in this process. We repeated the luciferase experiments in LNCaP cells in the presence of siRNA targeted to RREB-1 mRNA. As indicated in Fig. 7D
(inset), a significant decrease in the level of transfected RREB-1 was observed in which an RREB-1-specific siRNA pool was used but not with siRNA encoding scrambled sequence. Under these conditions, we observed a significantly higher level of PSA promoter activity in the presence of R1881, indicating that v-Ras is able to substantially nullify the RREB-1-mediated effect on the PSA promoter. Collectively, our data indicate that the Ras-MEK pathway is an antagonist of RREB-1-mediated repression of AR transcriptional activity, in contrast to the role of Ras in regulating RREB-1 at the calcitonin gene promoter.
RREB-1-Mediated Repression of PSA Promoter Activity Is Independent of Histone Deacetylase (HDAC) Activity and AR Phosphorylation
It has been reported that coactivator and corepressor complexes that exhibit HDAC activity play an important role in regulating nuclear receptor transactivation activity. Because AR can be acetylated in vivo and acetylation of AR regulates coactivator and corepressor binding and function (35, 36), we asked whether the HDAC inhibitor trichostatin A (TSA) would block RREB-1-mediated repression of PSA promoter activity. We observed inhibition of R1881-induced PSA promoter activity by TSA in LNCaP cells (Fig. 8
, compare lane 2 with lane 4), although TSA by itself enhanced the promoter activity by 5-fold (compare lane 1 with lane 3). Moreover, the fold repression of AR activity remained unchanged in the presence of TSA alone or in combination with R1881 (compare lane 6 with lanes 7 and 8). These results suggest that HDAC activity is unlikely to be involved in RREB-1-mediated repression of AR transcriptional activity. We observed identical results in the presence of a 10-fold lower dose (100 nM) of TSA (data not shown). Several reports (37, 38, 39) indicate the importance of AR phosphorylation for its transcriptional activity. Enforced RREB-1 expression did not have any detectable influence on the hormone-induced phosphorylation status of AR (data not shown).
|
|
| DISCUSSION |
|---|
|
|
|---|
Understanding the molecular mechanisms by which androgen-dependent tumor cells progress to androgen independence will help in designing effective therapy for androgen-independent PCa. Androgen action generally results in a cascade of events starting from dissociation of the AR from cytosolic heat-shock protein complex, translocation of the receptor to nuclei, and finally binding to target genes. It is possible that Ras signaling can influence either this sequence of events, causing deregulation of AR-dependent gene transcription, or other coregulators associated with AR-dependent transcription. Several coactivators of AR-dependent transcription [e.g. CREB (cAMP response element-binding protein) binding protein, p300, steroid receptor coactivator-1, glutamate receptor-interacting protein-1, and amplified in breast cancer-I] are known to be targets of Ras-related signals (12, 13, 14, 15, 16). Given that stringent expression of genes relies on both positive and negative regulators of transcription, the identified negative regulators of AR are relatively few and not well characterized. Among some of the known negative regulators are cyclin D1 (40), calreticulin (41), p53 (42), the Y chromosome encoded male sex determining factor SRY, a testis-expressed orphan nuclear receptor Dax-1 (DSS-AHC critical region on the X chromosome, gene 1) (43), and the silencing mediator for retinoid acid receptor SMRT (44). However, the functional link of the above negative regulators with the Ras pathway is unknown given the important role of Ras in aberrant gene regulation by AR.
Because TFs function in nuclei, the subcellular distribution of RREB-1 was examined in our study. Previous studies have shown that multiple splice variants of RREB-1 are present in different cell types (21, 22, 23, 24, 25), and the subcellular distribution of RREB-1 family members may depend on the size of the specific variant protein. Fujimoto-Nishiyama et al. (22) found that, although full-length RREB-1 localized within the punctate nuclear domain of the COS and CV1 cells, the N-terminal truncated version of the protein localized to both the nucleus and cytoplasm. Ray et al. (25) found nuclear localization of RREB-1 in cervical carcinoma cell lines using an N-terminal-deleted version of the full-length form (25). Our observations regarding the nuclear compartmentalization of full-length RREB-1 in LNCaP cells are consistent with previous studies.
Full-length RREB-1 repressed the activity of the androgen-sensitive PSA promoter reporter by 75%. Our study with different deletion mutants of RREB-1 indicated that both the N and C termini of RREB-1 are required for complete repression activity. At present, we do not have an explanation for the finding that a small deletion in the C terminus can ablate the repressor effect. We are currently pursuing more detailed mapping of the C terminus to identify the specific regulatory region important for RREB-1-mediated repression of AR. Interestingly, several phosphorylation sites within this domain, including potential sites for protein kinase C and casein kinase II subunit, may play important roles in that context.
The normal cellular function of RREB-1 is unclear, although the transcripts for this gene have been identified in all tissues other than the brain in both mammalian and avian species. RREB-1 was originally identified as a protein that binds to the upstream Ras-responsive element of human calcitonin promoter and activates transcription only in the presence of Ras (22). The c-erbB2 and secretin promoters were also shown to be targets of this protein. Ray et al. (25) reported that RREB-1 lacks an intrinsic activation function, yet it potentiates the transcriptional activity of another protein (BETA2; ß-cell E-box trans-activator 2) that binds in the promoter region. Recently, down-regulation of several other promoters by RREB-1 was also reported. Zhang et al. (26) has demonstrated repression of the p16INK4a promoter by RREB-1. In addition, Date et al. (27) also reported repression of transcription by RREB-1 from the human angiotensinogen gene. In our study, we have shown for the first time that the androgen-sensitive PSA gene, and PSA protein, is a biological target of RREB-1.
Given that the transcriptional function of RREB-1 depends on the cellular or promoter context, it is conceivable that other proteins that bind to RREB-1 may influence its transcriptional activity. It is interesting to note that RREB-1 was shown recently to be a component of a multiprotein complex with the transcriptional corepressor C-terminal binding protein (CtBP) and other chromatin modifying enzymes (45). Many of these enzymes, including HDACs, are able to repress transcription through modification of chromatin structure. Acetylation of AR promotes transcriptional activity and recruits cofactors. It has been reported that some repressors inhibit AR transcriptional activity by recruiting HDACs to the promoter (35, 36). Our observation that TSA does not block RREB-1-mediated repression of AR (Fig. 8
) indicates that the inhibitory mechanism of AR by RREB-1 is not via HDACs but by some other mechanism. In addition, our results indicate that CtBP is a part of the AR/RREB-1/PSA promoter complex (supplemental Fig. 2, published as supplemental data on The Endocrine Societys Journals Online web site at http://mend.endojournals.org). Whether CtBP plays any role in RREB-1-mediated repression is the subject of future investigation.
Alteration of AR function by growth factor signaling is a mechanism that is likely to play a role in at least half of advanced PCa, in which activation of Ras is a component of the signaling pathways for almost all of the receptors shown to be up-regulated (12). Activation of Ras signaling in LNCaP cells is sufficient for progression toward androgen independence, with respect to growth, gene expression, and tumorigenicity (12). Our data from experiments using N-17-Ras, MEK inhibitor PD98059, and RNA interference all support the involvement of Ras signaling in the regulation of the AR via RREB-1. Our protein depletion experiments suggest that detachment of AR from the RREB-1/AR complex is a downstream effect of the action of Ras on the complex and is the means by which Ras interferes with the repressor activity of RREB-1. The evidence presented in our study favors the interpretation that the disruption of the biochemical pathways influenced by Ras and that drive tumor progression in PCa can be regulated by the action of RREB-1. In addition, RREB-1 may act as a molecular switch for Ras operating in contexts in which the AR performs a normal physiologic role. Importantly, our study has identified for the first time a direct link between the Ras pathway and the transcriptional function of the AR.
In summary, we demonstrated that RREB-1 can interact with AR physiologically and suppress AR transactivation and that Ras signaling can attenuate this repressor activity. Additional studies of the mechanism of RREB-1-mediated transcriptional repression of AR and the identification of the Ras pathway signaling molecules involved will provide additional insight into the potential role of RREB-1 as a signaling mediator in PCa and other physiologic situations in which the AR plays an important role.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Cultures
Androgen responsive human PCa LNCaP cells were cultured in RPMI 1640 medium containing 10% heat-inactivated fetal bovine serum, 2% glutamine, and penicillin/streptomycin antibiotics. All cultures were maintained in a humidified chamber at 37 C with 5% CO2. For DHT stimulation, cells were placed in 10% charcoal-stripped serum for 48 h after 36 h of normal growth. Cells were treated with 10 nM DHT for 45 min before harvesting.
Plasmid Constructions
The RREB-1 (pME-Finb) construct was originally from Tadashi Yamamoto (22). The full-length Finb (RREB-1) coding sequence from the pME-Finb plasmid was subcloned into pcDNA 3.1 (+) as described previously (25). The GST-RREB construct (amino acids 913-1668) used for GST pull-down assay, the pcDNA-
1RREB-1 (913–1668), pcDNA-
2RREB-1 (1197–1668), and pcDNA-
3RREB-1 (1–1543), and Flag-RREB1 constructs were made as described previously (25). The construction of PSA-Luc reporter (p61-Luc) and GRE4-TATA-Luc (pG4-Luc) plasmids were described previously (33).
NE Preparations
Before and after stimulation with DHT, LNCaP cells were washed with cold PBS twice and 1 ml of cold buffer A mix [10 mM HEPES (pH 7.9), 10 mM KCl, 10 mM EDTA, 10 mM DTT, and 2.5% IGEPAL] and 100 µM vanadate, and a cocktail of protease inhibitors, including leupeptin, aprotinin, phenylmethylsulfonylfluoride, and pepstatin were added to each plate. The plates were placed on ice and were shaken at 150 rpm on a rocking platform for 10 min. Cells were scraped and centrifuged at maximum speed in a microfuge in the cold room for 5 min. The pellet was suspended in buffer B (150 µl/plate) containing 20 mM HEPES (pH 7.9), 400 mM NaCl, 1 mM EDTA, 10% glycerol, 10 mM DTT, and a cocktail of protease inhibitors and was kept on ice with occasional vortexing for 2 h. The lysate was centrifuged for 10 min at 13,000 x g at 4 C, and the supernatant was collected. This NE was immediately frozen at –80 C after estimating the protein concentration.
TF-TF Array Analysis
We determined the TF-TF interactions by using the TranSignal TF-TF Array Kit according to the procedure described in the protocol of the manufacturer (Panomics). We used the array version II spotted with 96 different consensus sequences (Table 1
). In practice, NE (200 µg) from DHT-treated or untreated cells was mixed with TranSignal TF-TF Probe Mix II (10 µl of 10 ng/µl), 10 µl of poly-dI-dC (10 ng/µl), and binding buffer in a total volume of 75 µl, and the mixture was incubated first at 15 C for 30 min and then on ice for an additional 30 min. After the initial incubation with TF-TF probe, the mixture was diluted with IP Dilution Buffer (TF-TF Array Kit) and was immunoprecipitated with 1–2 µg AR-specific antibody for 2 h in the cold room on a rocking platform. The DNA/protein/antibody complex formed after 2 h was mixed with freshly equilibrated Dynal Beads Protein G and was incubated for 1 additional hour at 4 C. The beads were washed several times with chilled IP Wash Buffer (TF-TF Array Kit), and the probe was eluted in IP Elution Buffer (TF-TF Array Kit) by using the magnetic beads. The recovered protein/DNA complex was incubated at 100 C for 5 min to denature the protein, and the purified cDNA probe was collected as described by the manufacturer (Panomics). The probes were hybridized to the array membrane at 42 C overnight (16 h) in hybridization buffer as described in the TF-TF Array Kit. The membrane was washed twice in wash buffer I and twice in wash buffer II at 48 C for 20 min before being placed into blocking buffer. The subsequent steps were the same as described for the gel mobility shift assay (see below).
For analysis and comparison of the results, we adjusted the exposure time such that the biotin spots (along the right and bottom sides of the array membrane) have equal signal intensity. All of the spots appearing in the array should be positive. As a negative control, we used control antibody (normal IgG) and also neglected some weak spots (background, false positives), which may appear as a result of nonspecific hybridization of the oligonucleotides.
Gel Mobility Shift Assay
The nonradioactive gel mobility shift assay was performed according to the instructions of the manufacturer (Panomics). NE (1–5 µg) from DHT-treated and untreated cells was mixed with 1 µl specific primer (10 ng/µl) and 1 µl poly-dI-dC (1 ng/µl) in a 10–15 µl reaction mixture and was incubated at 15–20 C for 30 min. The samples were mixed with 1 µl loading dye, were loaded onto a 6% nondenatured polyacrylamide gel, and electrophoresed at 120 V in 0.5x Tris-borate EDTA buffer after the gel was prewarmed for 10 min at 120 V. The samples were transferred in 0.5x Tris-borate EDTA onto a presoaked Pall Biodyne B membrane at 300 mA for 30 min. After transfer, the samples were fixed on the membrane by UV cross-linking for 3 min (model UV Stratalinker 2400; Stratagene, La Jolla, CA). The membrane was blocked in blocking buffer at room temperature first for 15 min and then for an additional 15 min with 20 µl streptavidin-horseradish peroxidase conjugates. The membrane was washed four times (5 min each), and the ECL detection was performed after putting the membrane in detection buffer for 5 min. The membrane was exposed using Hyperfilm ECL.
RNA Silencing
For RNA interference experiments, we used ON-TERGETplus SMART pool siRNA oligonucleotides, a predesigned siRNA reagent against four different splice variants of RREB-1 (alternate names Finb, LZ321) from Dharmacon. As a control, we used siRNA encoding scrambled sequence from the same company. In the case of luciferase assays, siRNAs were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA), and electroporation was used for PSA detection experiments.
Immunofluorescence Cell Staining
LNCaP cells were plated at 70% confluency in eight-well chamber slides and allowed to grow at 37 C. The cells were then transfected with pcDNA3.1 vector only, pcDNA3.1RREB-1, or pcDNA3.1HA-AR or both in respective wells. After transfection, cells were fixed in 3% paraformaldehyde for 1 h at room temperature and washed three times in PBS. Cells were then permeabilized in PBS/1% Triton X-100 for 5 min blocked in PBS/0.1% Tween 20/1% BSA for 1 h. After three washes in PBS, the fixed cells were incubated in PBS/0.1% Tween 20/1% BSA with primary polyclonal RREB antibody (25) and monoclonal AR antibody (BD Biosciences, San Jose, CA) overnight (16 h). The cells were then washed three times in PBS and incubated in goat antirabbit cyanine 3 (Cy3) secondary antibody (diluted at 1:500) for detection of RREB localization (Jackson ImmunoResearch, West Grove, PA) and goat antimouse fluorescein isothiocyanate (FITC) secondary (diluted at 1:100) for AR localization for 1 h at room temperature. The cells were then washed and mounted in Mounting Media with 4',6'-diamidino-2-phenylindole (DAPI) (Vector Laboratories, Burlingame, CA). Images were captured on an Axioplan 2 Epifluorescence microscope using the Apotome feature and Axiovision 4.5 software (Zeiss, Oberkochen, Germany).
ChIP
We used a published protocol (46) with some modifications using the ChIP Assay Kit from Upstate Biotechnology. Briefly, LNCaP cells (1 x 107 cells/100 mm disc) treated with or without DHT were crosslinked by adding formaldehyde (1%) directly to the culture medium and incubated at room temperature for 10 min on a rotating platform. The cells were scraped into PBS containing protease inhibitors (1 µM phenylmethylsulfonyl fluoride, 100 ng/ml aprotinin, 100 ng/ml pepstatin A, and 2 µg/ml leupeptin) and centrifuged for 5 min at 2000 x g. The cell pellets were resuspended in 0.5 ml of cell lysis buffer containing 50 mM HEPES (pH 8.0), 1 mM EDTA, 0.5 mM EGTA, 140 mM NaCl, 10% glycerol, 0.5% Nonidet P-40 (NP-40), and protease inhibitors and incubated for 10 min on ice. The cell nuclei obtained by microcentrifugation at 4000 x g for 5 min at 4 C were lysed in SDS lysis buffer [50 mM Tris-HCl (pH 8.1), 10 mM EDTA, 1% SDS, and protease inhibitors] and sonicated for 15 sec for a total of four cycles using a bath sonicator (Bronson Sonifier 450; VWR International, West Chester, PA) to obtain an average DNA length of 500-1000 bp. Sonicated chromatin was centrifuged at 14,000 x g for 10 min at 4 C to remove large debris, and the soluble chromatin was diluted 10-fold in ChIP dilution buffer. The diluted suspension (2 ml) was precleared by incubating with 60 µl salmon sperm DNA/Protein A agarose (50% slurry) for 30 min at 4 C. The supernatant was immunoprecipitated by incubating overnight (16 h) in the cold room with either 1 µg AR or RREB-1 antibody. Salmon sperm/Protein A mixture (50 µl) and an aliquot of mouse secondary antibody (for AR only) were added for 1 h at 4 C with rotation. The agarose-bound immune complexes were sequentially washed for 5 min each in a low-salt, high-salt, and LiCl wash buffer. The complexes were recovered from agarose beads with a elution buffer containing 0.1 M NaHCO3 and 1% SDS. For DNA isolation and reversal of crosslinking, NaCl (final concentration of 200 mM) and ribonuclease A (final concentration of 5 µg/ml) were used and incubated for 16 h at 65 C. The DNA-protein complex was precipitated by ethanol, pelleted at 14,000 x g for 10 min, air dried, and suspended in 100 µl Tris-EDTA buffer. To remove the proteins from DNA, the samples were digested with proteinase K (final concentration at 100 µg/ml) for 1.5 h at 45 C. The DNA was recovered using QIAquick PCR Purification Kit, and the PCR was performed using Herculase Hotstart DNA polymerase and the PSA primers (5'-AGAACAGCAAGTGCTAGCTC-3' and 5'- AGGTGGTAAGCTTGGGGC-3' for ARE I; and 5'-TGAAAACAGACCTACTCTGGA-3' and 5'-TCTGGATTGTTGTTTCAAGGA-3' for ARE III) in the presence of dimethylsulfoxide. Control reactions with genomic DNA and the DNA from normal IgG antibody control were always performed alongside the immunoprecipitated samples. For PSA amplification, 34 PCR cycles were used. Each cycle consisted of a 1 min denaturation at 95 C, a 1.5 min annealing at 62 C, and a 1.5 min elongation at 72 C. PCR products were fractionated on a 2% agarose gel.
IP and Western Blots
NEs (1–1.2 mg protein) for IP were incubated with polyclonal RREB-1 antibody at 4 C for overnight with Protein A Sepharose beads. The bead bound complexes were pelleted, washed several times with lysis buffer and PBS, and boiled with SDS sample buffer for 3–5 min before loading on SDS-PAGE (7.5–10%). For Western blot analysis, the proteins were transferred to nitrocellulose membranes after SDS-PAGE and blocked with 5% dry milk in TBST [25 mM Tris, 2.7 mM KCl, 137 mM NaCl, and 0.1% Tween 20 (pH 7.4)]. The blots were incubated with specific primary antibody for 2 h at room temperature at a dilution of 1:2000 for AR or 1:200 for PSA. Membranes were washed briefly with TBST and incubated with the horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature (1:5000 dilution for both AR and PSA). After extensive washing, immunoreactive bands were visualized by chemiluminescence. When required, membranes were stripped in 62.5 mM Tris-HCl (pH 6.8), 2% SDS, and 1.0 mM ß-mercaptoethanol for 30 min at 50 C and reblotted.
GST Pull-Down Assay
Bacterially expressed GST-RREB-1 fusion proteins were adsorbed to glutathione-Sepharose beads as described previously (25). The protein-bound beads were then incubated with AR immunoprecipitated from LNCaP NEs. The beads were extensively washed with PBS binding buffer (PBS with 0.1% NP-40), and the bead-bound proteins were analyzed by SDS-PAGE, followed by Western blotting and chemiluminescence using AR-specific antibody.
Electroporation
Nucleofector Kit (Amaxa, Gaithersburg, MD) was used to electroporate 100 nM of each siRNA into LNCaP cells according to the protocols of the manufacturer. At 36 h after electroporation, LNCaP cells were serum-starved overnight (20 h), followed by a 45 min R1881 (1 nM) treatment.
Transfections, Luciferase Assays, and G418 Selection
All transfection assays were performed according to the DOTOP liposome transient transfection protocol as described previously (33). Briefly, 2 x 105 LNCaP cells were seeded per well in 12-well plates overnight (16 h). The medium was removed, and the cells were washed with serum- and phenol red-free RPMI 1640 medium before transfection. Cells were then exposed to a plasmid DNA/lipid mixture, for which 1.5–2 µg plasmid DNA was allowed to form a complex with transfection reagents for 15 min at room temperature before their addition per well containing 0.5 ml of serum and antibiotic-free RPMI 1640 medium. As a transfection control, a cytomegalovirus-directed ß-galactosidase (ß-gal) reporter plasmid was cotransfected. The cells were incubated with the complexes for 6–8 h in 5% CO2 at 37 C. The DNA/lipid medium was then removed, and the cells were washed and incubated in RPMI 1640 containing 5% dextran-coated charcoal and R1881 (10 nM) or respective vehicles (ethanol/BSA) for 24–36 h.
For luciferase assays, cells were washed with ice-cold PBS and lysed in luciferase lysis buffer at room temperature with constant rocking for 15 min. Cell lysates were collected, vortexed briefly, and centrifuged at 13,000 x g for 3 min at 4 C. Luciferase activity was measured as described previously (33). ß-gal activity was assessed according to the protocol of the manufacturer (Promega, Madison, WI). Either ß-gal activity or total protein was used to normalize relative luciferase units, and the data were expressed as fold induction with respect to the promoter-reporter activity of vector backbone.
For the selection of RREB-1-expressed cells, the transfected cells (with both pcDNA vector and pcDNA-RREB-1 construct) were seeded in medium containing G418 (350 µg/ml) after stimulation with 10 nM R1881 for 36 h. After two weeks in G418 medium, the cells were trypsinized and seeded in fresh G418 medium for 1 additional week. The G418-resistant cells were lysed in radioimmunoprecipitation assay buffer [50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 0.1% SDS, 1% NP-40, and 0.5% sodium deoxycholate], and 30 µg protein from vector and pcDNA-RREB-1 selected cells were compared for PSA expression using nonselected cells as positive control.
Densitometric Scanning
Quantitation of the Western blots was accomplished with a densitometry-based analysis performed on scanned fluorograms using Scion Image Beta 4.02 software from Scion (Frederick, MD).
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Disclosure Statement: The authors have nothing to disclose.
First Published Online June 5, 2007
Abbreviations: AR, Androgen receptor; ARE, androgen response element; ChIP, chromatin immunoprecipitation; CtBP, C-terminal binding protein; Cy3, cyanine 3; DAPI, 4',6'-diamidino-2-phenylindole; DHT, dihydrotestosterone; ECL, enhanced chemiluminescence; FITC, fluorescein isothiocyanate; ß-gal, ß-galactosidase; GRE, glucocorticoid response element; GST, glutathione S-transferase; HDACs, histone deacetylases; IP, immunoprecipitation; NE, nuclear extract; NP-40, Nonidet P-40; PCa, prostate cancer; PSA, prostate-specific antigen; RRE, Ras response transcriptional element; RREB, Ras-responsive element binding protein; siRNA, small interfering RNA; TF, transcription factor; TSA, trichostatin A.
Received for publication November 27, 2006. Accepted for publication May 30, 2007.
| REFERENCES |
|---|
|
|
|---|
NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
S. Flajollet, I. Poras, E. D. Carosella, and P. Moreau RREB-1 Is a Transcriptional Repressor of HLA-G J. Immunol., December 1, 2009; 183(11): 6948 - 6959. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Eisold, M. Asim, H. Eskelinen, T. Linke, and A. Baniahmad Inhibition of MAPK-signaling pathway promotes the interaction of the corepressor SMRT with the human androgen receptor and mediates repression of prostate cancer cell growth in the presence of antiandrogens J. Mol. Endocrinol., May 1, 2009; 42(5): 429 - 435. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. Mukhopadhyay, J. Kim, B. Cinar, A. Ramachandran, M. H. Hager, D. Di Vizio, R. M. Adam, M. A. Rubin, P. Raychaudhuri, A. De Benedetti, et al. Heterogeneous Nuclear Ribonucleoprotein K Is a Novel Regulator of Androgen Receptor Translation Cancer Res., March 15, 2009; 69(6): 2210 - 2218. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Quan, Z.-L. Ji, X. Wang, A. M. Tartakoff, and T. Tao Evolutionary and Transcriptional Analysis of Karyopherin {beta} Superfamily Proteins Mol. Cell. Proteomics, July 1, 2008; 7(7): 1254 - 1269. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |