help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2007-0002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Echchgadda, I.
Right arrow Articles by Chatterjee, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Echchgadda, I.
Right arrow Articles by Chatterjee, B.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Molecular Endocrinology 21 (9): 2099-2111
Copyright © 2007 by The Endocrine Society

The Xenobiotic-Sensing Nuclear Receptors Pregnane X Receptor, Constitutive Androstane Receptor, and Orphan Nuclear Receptor Hepatocyte Nuclear Factor 4{alpha} in the Regulation of Human Steroid-/Bile Acid-Sulfotransferase

Ibtissam Echchgadda, Chung S. Song, Taesung Oh, Mohamed Ahmed, Isidro John De La Cruz and Bandana Chatterjee

Department of Molecular Medicine/Institute of Biotechnology (I.E., C.S.S., T.O., M.A., I.J.D.L.C., B.C.), The University of Texas Health Science Center at San Antonio, San Antonio, Texas 78245; and South Texas Veterans Health Care System (B.C.), Audie L. Murphy VA Hospital, San Antonio, Texas 78229

Address all correspondence and requests for reprints to: Bandana Chatterjee, Ph.D., Department of Molecular Medicine/Institute of Biotechnology, The University of Texas Health Science Center at San Antonio, 15355 Lambda Drive, San Antonio, Texas 78245. E-mail: chatterjee{at}uthscsa.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The nuclear receptors pregnane X receptor (PXR) and constitutive androstane receptor (CAR) are the primary transcription factors coordinating induced expression of the enzymes and proteins directing oxidative, conjugative, and transport phases of endobiotic and xenobiotic metabolism, whereas hepatocyte nuclear factor 4{alpha} (HNF4{alpha}), a regulator of hepatic lipid homeostasis, can modify the PXR/CAR response. Steroid- and bile acid-sulfotransferase (SULT2A1) promotes phase II metabolism through its sulfonating action on certain endobiotics, including steroids and bile acids, and on diverse xenobiotics, including therapeutic drugs. This study describes characterization of a PXR- and CAR-inducible composite element in the human SULT2A1 promoter and its synergistic interaction with HNF4{alpha}. Inverted and direct repeats of AG(G/T)TCA (IR2 and DR4), both binding to PXR and CAR, define the composite element. Differential recognition of the composite element by PXR and CAR is evident because single-site mutation at either IR2 or DR4 in the natural gene abolished the PXR response, whereas mutations at both repeats were necessary to abrogate completely the CAR response. The composite element conferred xenobiotic response to a heterologous promoter, and the cognate ligands induced PXR and CAR recruitment to the chromatin-associated response region. An HNF4{alpha} element adjacent to the –30 position enhanced basal promoter activity. Although functioning as a synergizer, the HNF4{alpha} element was not essential for the PXR/CAR response. An emerging role of SULT2A1 in lipid and caloric homeostasis suggests that illumination on the regulatory interactions driving human SULT2A1 expression may reveal new avenues to control certain metabolic disorders.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE NUCLEAR XENOBIOTIC receptors PXR (NR1I2; pregnane X receptor) and CAR (NR1I3; constitutive androstane receptor) are the principal transcription factors regulating induction of the lipid-metabolizing phase I and phase II enzymes as well as induction of membrane-bound transporters mediating uptake or efflux of lipids and lipid metabolites. The carbon-21 steroids pregnanes are the endogenous activating ligands for PXR, whereas the C-19 androstane derivatives androstanol and androstenol are the CAR ligands that inhibit the constitutive activity of CAR by causing coactivator dissociation. The repertoire of PXR and CAR activators also includes high concentrations of toxic endobiotics, such as the cholesterol-derived bile acid lithocholic acid, and diverse xenochemicals, most notably common medicinal products and agriculturally useful pesticides (1, 2, 3). Deregulated PXR and CAR signaling can cause metabolic and xenobiotic stress and the associated adverse impacts on health (4). The vitamin D receptor (VDR; NR1I1) also plays a direct role in the transcriptional induction of the genes involved in the oxidative, conjugative, and transport phases of metabolism and disposition (5, 6, 7, 8, 9). The xenobiotic nuclear receptors and VDR share many (but not all) target genes, often acting via common DNA elements. Competitive functional interaction at shared regulatory sites has been reported in cell transfection studies for several target genes (7, 10). Physiological ramifications for the common locus of regulation by multiple nuclear receptors, however, remain to be elucidated.

The orphan nuclear receptor HNF4{alpha} (hepatocyte nuclear factor 4{alpha}, NR2A1) is a central mediator of hepatocyte differentiation and lipid homeostasis in the liver (11, 12). Emerging evidence points to an important role of HNF4{alpha} in the PXR- and CAR-mediated lipid metabolism (13, 14). In the fasting mouse liver, interaction of HNF4{alpha} with the coactivator PGC-1{alpha} (peroxisome proliferator-activated receptor gamma coactivator-1{alpha}) at an Hnf4{alpha}-binding site in the genomic Car caused enhanced expression of Car and various Car target genes (including the phase II sulfotransferase Sult2A1) (14). Liver-specific Hnf4{alpha} inactivation in mice prevented the fasting-induced up-regulation of Car and Car targets. Fasting, however, did not alter the liver expression of Pxr. In another example, HNF4{alpha} plays an essential role in the PXR/CAR dependent induction of human CYP3A4, the enzyme that mediates phase I metabolism of nearly 40% of all prescription drugs (15). Thus, an HNF4{alpha} element adjacent to the PXR and CAR binding sites in the human CYP3A4 promoter is an obligatory component of a xenobiotic-responsive distal enhancer (13). Mutational inactivation of the HNF4 site within the enhancer abolished xenobiotic responsiveness of the human CYP3A4 promoter in the mouse liver upon its introduction through tail vein injection. Abrogation of the Pxr/Car-mediated induction of Cyp3a isoforms (rodent equivalents of human CYP3A4) in Hnf4{alpha}-knockout mice further underscores the importance of HNF4{alpha} in the PXR- and CAR-induced transcription response (13). Synergistic interaction of a proximal HNF4{alpha} element with a distal xenobiotic-responsive enhancer was observed in the PXR- and CAR-mediated induction of the transfected human CYP2C9 promoter (16). In this case the extent of induction was significantly reduced, although not totally abolished, when the interacting HNF4{alpha} site was mutated. However, a more essential role of an alternate HNF4{alpha} site is still possible in the PXR- and CAR-induced regulation of CYP2C9.

The present study describes characterization of a PXR- and CAR-inducible composite element in the human SULT2A1 promoter and its functional interaction with HNF4{alpha}. SULT2A1 is a steroid- and bile acid-sulfotransferase, mediating catalytic conversion of hydroxysteroids, bile acids, and certain clinical drugs to water-soluble sulfated metabolites. The liver and intestine are the two major sources of SULT2A1 expression. In addition, the enzyme is present abundantly in the steroidogenic and DHEA-producing adrenocortical tissue. Earlier studies established that an IR0 element (an inverted repeat lacking a spacer nucleotide) directs the CAR-, PXR- and VDR-induced activity of the rat and mouse Sult2A1 promoter (7, 17, 18, 19, 20, 21, 22). Additionally, we had previously shown that the vitamin D3 response of the human SULT2A1 gene is coordinated through a functional interaction of VDR with the CAAT/enhancer binding transcription factor (C/EBP{alpha}) at a D3 response region in this gene. Here we show that the same VDR-inducible region is activated by PXR and CAR to stimulate SULT2A1. Furthermore, an HNF4{alpha}-binding site near the TATA box region (just upstream of –30) regulated the basal and PXR-/CAR-induced expression of human SULT2A1. With the emerging evidence for a role of SULT2A1 in lipid and caloric homeostasis (14, 22, 23), delineation of the regulatory elements coordinating the xenobiotic response of human SULT2A1 is a timely advance.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
SULT2A1 Gene Induction by PXR and CAR
Activated PXR and CAR induced SULT2A1 mRNAs in human cell lines of enterohepatic origin, such as Caco-2 intestinal cells (Fig. 1AGo) and HepG2 hepatoma cells (data not shown). Quantitative (Q)RT-PCR assay showed approximately 1.7- and 3.5-fold induction of SULT2A1 mRNAs (normalized to the invariant ß-actin expression) by virus protein (VP)-16-activated PXR and CAR, respectively. Similar induction is also evident from the ethidium bromide-stained gel pattern of semi-quantitative RT-PCR, normalized to GAPDH expression (Fig. 1AGo). VP-PXR and VP-CAR are in-frame fusions of the strong transactivation domain of the herpes simplex VP with the downstream full-length PXR or CAR, thus transforming the receptors into constitutively active forms. Induction of endogenous human SULT2A1 by activated PXR and CAR, as seen here, is in agreement with previous reports that this endogenous gene is induced by rifampicin-activated PXR in primary human hepatocytes (24), and by VP-CAR or PB-activated CAR in HepG2 cells and primary human hepatocytes (25).


Figure 1
View larger version (49K):
[in this window]
[in a new window]

 
Fig. 1. PXR, CAR, and Induction of SULT2A1

A, Induction of human SULT2A1 mRNAs in Caco-2 cells by PXR (VP-PXR) and CAR (VP-CAR). The mRNAs were assayed semi-quantitatively by RT-PCR (upper panel) and quantitatively by real-time RT-PCR (lower panel). B and C, SULT2A1 promoter induction in mouse primary hepatocytes. The cells were cotransfected with plasmids encoding rat PXR or mouse CAR (50 ng) and (–302 to +10) SULT2A1-Luc (500 ng). At 24 h after transfection cells were treated for 24 h with vehicle (veh) or ligands specific to PXR or CAR [10 µM pregnenolone-16{alpha}-carbonitrile (PCN), 250 nM 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCP), 1 mM PB, 10 µM AND-ol]. Luciferase activity in the harvested cells was normalized to constant protein amount. Data are from two independent transfections with two independent hepatocyte cultures. Values for each transfection are average of duplicate experiments.

 
Mouse primary hepatocytes were used to examine regulation of the human SULT2A1 promoter by the ligand-activated PXR and CAR (Fig. 1Go, B and C). The catatoxic synthetic steroid PCN (pregnenolone-16{alpha}-carbonitrile), a ligand agonist for the transfected rodent PXR, induced the promoter-directed luciferase expression approximately 6-fold (Fig. 1BGo). Similarly, the SULT2A1 promoter was induced by CAR (Fig. 1CGo). The transfected mouse CAR by itself induced the promoter approximately 2.5-fold by virtue of its constitutive activity (Fig. 1CGo, right panel). 1,4-Bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP) (TCP, a pesticide and an activating ligand for murine CAR) and phenobarbital (PB, a barbiturate) can further increase the constitutive activity of CAR more than 6-fold (Fig. 1CGo, left panel). As expected, the CAR inverse agonist androstenol (And-ol) reduced the promoter activity (~50%). Concomitant treatment of cells with And-ol and TCP or PB reversed this inhibition (Fig. 1CGo, left panel). The TCPOBOP-mediated reversal of the inhibitory effect of androstenol, shown here, is in agreement with other reports that had demonstrated increased CAR function by TCPOBOP or meclizine (an agonist for murine CAR) in the presence of the CAR inverse agonists androstenol and androstanol (20, 26). However, androstanol-mediated repression of the constitutive CAR activity at the complex LXRE (CAR responsive) in the MMTV promoter was not antagonized by TCPOBOP when androstanol to TCPOBOP ratio was 15:1 (27). In the case of SULT2A1, TCPOBOP antagonized androstenol-mediated repression despite the much higher concentration of androstenol relative to TCPOBOP (at androstenol to TCPOBOP ratio of 40:1). Differences in the relative CAR activity at the responsive SULT2A1 vs. MMTV-LXRE site, as well as differential activity between androstenol (used in Fig. 1CGo) and androstanol (used in Ref. 27), may account for the ability of TCPOBOP to reverse the androstenol effect on human SULT2A1 but not the androstanol effect on MMTV-LXRE. The PXR- and CAR-mediated regulation in Fig. 1Go, B and C, was examined with the –302 to +10 promoter of SULT2A1, providing a clue to the location of a xenobiotic-responsive region.

Direct Engagement of Endogenous PXR and CAR in the Promoter Induction
Ligand-directed association of endogenous PXR and CAR with the xenobiotic-responsive SULT2A1 chromatin is evident from chromatin immunoprecipitation (ChIP) of Caco-2 cells (Fig. 2Go). A PCR primer set (at –354, forward primer; –55, reverse primer) amplified the anti-CAR or anti-PXR immunoprecipitated SULT2A1 chromatin fragments. CAR was enriched several-fold at the specific promoter site in the presence of CITCO (ligand agonist of human CAR) or PB (activator of CAR) (Fig. 2AGo). Similarly, PXR was recruited to the promoter in the presence of rifampicin, which activates human PXR (Fig. 2BGo). The absence of signal from the use of a nonrelated antibody (anti-Cox-2), or PCR primers complementary to an upstream region (at –1612/–1393) that lacks PXR/CAR binding sites demonstrated the specificity of the ChIP assay. The kinetics of receptor occupancy varied depending on the individual xenobiotic agent. CITCO signaled maximal recruitment of CAR within 1 h, whereas the CAR response to PB was significantly delayed, requiring about 5 h for the receptor to accumulate maximally at the regulatory site. Rifampicin-induced PXR recruitment peaked at 2.5 h. The cyclic response of CAR to CITCO, displaying peak promoter engagement at 1 h and a second peak at 5 h is reminiscent of the oscillatory occupancy of the estrogen receptor at the estrogen-responsive pS2 promoter (28). Endogenous expression of PXR and CAR in Caco-2 cells is shown (Fig. 2CGo).


Figure 2
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 2. Ligand-Dependent Recruitment of PXR and CAR to the Human SULT2A1 Gene

A, ChIP assay of Caco-2 cells for association of CAR with the response region at various time points after 1 µM CITCO treatment or 1 mM PB treatment. B, ChIP assay for PXR recruitment to the response region at various time points after treatment of Caco-2 cells with 10 µM rifampicin (RIF). The absence of PXR- and CAR-immunoprecipitable SULT2A1 chromatin from an upstream region lacking PXR/CAR responsive enhancer is also shown. C, Western blot of Caco-2 cells for endogenous PXR, CAR, and ß-actin.

 
Binding of PXR and CAR to cognate DNA elements in the xenobiotic-responsive promoter is evident from the DNase I footprints of the –302 to +10 SULT2A1 promoter (Fig. 3Go). The combined presence of PXR and RXR-{alpha} or CAR and RXR-{alpha} revealed two binding sites—one at –131 to –155 (FP1) and the other at –167 to –190 (FP2)—which are nested within the two larger footprints produced by the liver nuclear extract (Fig. 3Go; lanes 2, 3, and 4). The FP2 element contains an IR2-type motif (palindromic repeat of the core AGCTCA) and FP1 contains a DR4-type arrangement of the core hexamer AGTTCA (Fig. 3BGo). The 9-cis retinoic acid receptor RXR-{alpha} is the obligatory heterodimer partner of PXR and CAR and thus it was used in combination with PXR or CAR. In the absence of RXR{alpha}, neither PXR nor CAR protected the promoter sequence from DNase1 digestion (data not shown).


Figure 3
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 3. DNAse I Footprinting of the Human SULT2A1 Promoter

A, Footprinting in the presence of mouse liver nuclear extract (NE) (lane 2), recombinant PXR plus RXR-{alpha} (lane 3), recombinant CAR plus RXR-{alpha} (lane 4), and BSA control (lane 1). B, The DNA sequence within FP1 (–155 to –131) and FP2 (–190 to –167).

 
The composite functional nature of FP1 and FP2 is shown by the result that although each footprint element specifically bound the recombinant receptors, the minimal heterologous promoter gained xenobiotic responsiveness only with the concurrent presence of FP1 and FP2 in the reporter construct (Fig. 4Go). The EMSA complex between PXR/RXR{alpha} and FP1 (Fig. 4AGo) or FP2 (Fig. 4BGo) was competed out by 100-fold molar excess of homologous cold oligo (DR4 for FP1; IR2 for FP2), not by a heterologous sequence (NF-{kappa}B consensus element); the antibody to RXR-{alpha} supershifted both EMSA complexes (Fig. 4Go, A and B, lane 7); the non-immune serum and the anti-FXR antibody did not recognize the complexes (Fig. 4Go, A and B, lanes 6 and 8). CAR/RXR{alpha} also showed specific in vitro binding to FP1 and FP2, generating complexes recognized specifically by the anti-RXR{alpha} antibody (Fig. 4Go, C and D). Point mutations at DR4 or IR2 did not produce complex with the two xenobiotic receptors (data not shown). The ER6 element in the human CYP3A4 promoter is a well-characterized PXR/CAR-binding element and thus its binding affinity for these receptors was compared with that of IR2 and DR4 (Fig. 4Go, E and F). The EMSA complex between ER6 and recombinant PXR/RXR{alpha} or recombinant CAR/RXR{alpha} was reduced by the cold competitor ER6 or IR2 at comparable molar excess. Nevertheless, ER6 seems to have a slightly higher affinity for PXR and CAR than IR2 (Fig. 4Go, E and F, lanes 1–7), indicating that affinities of PXR and CAR for ER6/CYP3A4 and IR2/SULT2A1 are not significantly different. On the other hand, DR4 within the FP1 site is a much weaker PXR/CAR element compared with ER6 and IR2 because, unlike the ER6 and IR2 oligos, the EMSA complex was only partially reduced by cold DR4 at a 50-fold molar excess, and even at 100-fold excess the radiolabeled band was not completely wiped out (Fig. 4Go, E and F, lanes 8–11).


Figure 4
View larger version (35K):
[in this window]
[in a new window]

 
Fig. 4. FP1 and FP2 as PXR- and CAR-Binding Elements

A and B, EMSA of FP1 and FP2 in the presence of recombinant PXR and RXR{alpha}. C and D, EMSA of FP1 and FP2 with recombinant CAR and RXR{alpha}. Binding specificity was determined by competition with various cold oligos (at 100-fold molar excess) and supershift with specific antibody. The up-shifted bands are shown with asterisks. E and F, Oligonucleotide competition of the EMSA complexes of the radiolabeled ER6 with PXR/RXR{alpha} (E) and CAR/RXR{alpha} (F). Cold ER6, IR2, and DR4 oligos were used at increasing molar excess as indicated. G, PXR/CAR responsiveness of the composite element showing the requirement of both FP1 and FP2. Caco-2 cells were cotransfected with PXR/CAR, RXR-{alpha} (5 ng), and 400 ng construct containing both elements (left panel) or single element (right panel). Fold induction of the reporter expression (normalized to equal protein amounts) is the average ± SD from three independent transfections.

 
The combined presence of FP1 and FP2 was required for rifampicin/TCPOBP-induced stimulation of luciferase expression from the minimal thymidine kinase (TK) promoter in Caco-2 cells (Fig. 4GGo). Xenobiotic inducibility of the heterologous reporter construct was also observed in HepG2 human hepatoma cells and in mouse primary hepatocytes (data not shown). FP1 or FP2 alone showed no significant induction in response to rifampicin or TCPOBP (Fig. 4GGo, right panel). Thus, a composite element that includes both FP1 and FP2 is identified as a xenobiotic-responsive enhancer in the human SULT2A1 promoter.

Functional Interdependence of IR2 and DR4 in the Natural and Heterologous Promoter
The relationship between IR2 and DR4 was investigated in their natural gene environment (Fig. 5AGo). As noted above, point mutations disrupting the DR4-type motif and IR2-type motif prevented in vitro binding of PXR and CAR to the FP1 and FP2 footprinted sequences. Therefore, we compared the inducible activity of the wild-type SULT2A1 promoter with that of three mutant SULT2A1 promoters—FP1mt (inactivated at DR4); FP2mt (inactivated at IR2); and double mt (concurrent inactivation at FP1 and FP2). The constructs are schematically depicted. Mutation at either site (or concomitantly at both sites) prevented rifampicin-induced luciferase expression in PXR-transfected cells, demonstrating nonredundant roles of IR2 and DR4 in the induction by activated PXR (Fig. 5AGo, lower left panel). In contrast, single-element mutants, i.e. FP1mt and FP2mt partially retained induction by CAR with or without the exogenous activating ligand TCPOBOP. The double mt construct, however, completely wiped out CAR-induced luciferase expression (lower right panel). Functional interdependence of FP1 and FP2 is also evident in the context of the heterologous TK promoter (Fig. 5BGo). As in the natural gene, PXR response required both FP1 and FP2. Essential roles of FP1 and FP2 are also evident for the CAR response on a heterologous promoter. This result contrasts that in the natural gene, in which case partial retention of the CAR-induced activity was observed for constructs with single-site mutation (Fig. 5AGo). Additional 5' and/or 3' sequences in the natural gene may confer the residual CAR response to the promoter bearing mutation at a single footprinted site.


Figure 5
View larger version (30K):
[in this window]
[in a new window]

 
Fig. 5. Interdependence of FP1 and FP2 in the PXR and CAR Response

A, Response in the natural SULT2A1 promoter. Upper panel, Schema showing wild-type and mutant constructs. Lower panel, Wild-type and FP1 and FP2 mutant promoters were assayed for the PXR- and CAR-induced activity in Caco-2 cells. Induction was by activated PXR (left) and by CAR (right) in the absence or presence of rifampicin (RIF)/TCP. Normalized fold induction was averaged from three independent transfections ± SD. B, Response on the heterologous TK promoter. C, 1,25-(OH)2D3-mediated induction of the natural promoter (–302 to +10) and composite element (3xFP1+3xFP2) in HepG2 cells (cotransfected with 50 ng VDR plus 5 ng RXR-{alpha}). Fold induction ± SD was computed from three independent transfections.

 
In agreement with our earlier result, the combined activity of FP1 and FP2 was also involved in the vitamin D3-mediated stimulation of SULT2A1 gene transcription (Fig. 5CGo; Ref. 9). In this case FP2 serves as the VDR-binding element, whereas the FP1-bound C/EBP-{alpha} transcription factor plays an essential role in the response to D3 (9). Responses to both VDR and PXR were abolished by FP1 mutation that inactivated C/EBP{alpha} binding. However, C/EBP does not appear essential for the CAR response because the FP1 mutation, which totally abolished interaction with C/EBP in vitro, partly maintained the SULT2A1 promoter response to CAR (Fig. 5AGo, right panel). We should also note that the C/EBP transcription factors are likely to regulate basal expression of human SULT2A1, given their liver/intestine-enriched expression and role in the basal expression of rat Sult2A1 promoter (29).

HNF4{alpha}-Regulated Basal and Xenobiotic-Induced Activity of the SULT2A1 Promoter
How HNF4{alpha} might be involved in modulating the xenobiotic-induced expression of phase II enzymes in general, and SULT2A1 in particular, is of considerable interest because this orphan nuclear receptor plays a central role in the regulation of lipid homeostasis in the liver. A functional HNF4 element resides in the proximal promoter of human SULT2A1 (Fig. 6Go). Reporter assay showed a 4-fold stimulation of the SULT2A1 promoter activity in HNF4{alpha}-cotransfected Caco-2 cells (Fig. 6AGo). DNase1 digestion of the human SULT2A1 promoter in the presence of liver nuclear extract mapped a footprint near the TATA box region (just upstream of –30 position, hereon referred as –30 site). This site was specifically abolished in the presence of an HNF4{alpha}-binding oligo sequence, but not by consensus binding sequences for C/EBP or estrogen receptor (Fig. 6BGo). The absence of competition at the upstream second footprint (bracketed region) further strengthens the notion that the DR1-type motif at the –30 site corresponds to an HNF4 element (Fig. 6CGo).


Figure 6
View larger version (39K):
[in this window]
[in a new window]

 
Fig. 6. Functional HNF4{alpha} Site in the SULT2A1 Promoter

A, Stimulation of the SULT2A1 promoter activity in Caco-2 cells upon cotransfection with HNF4{alpha}. B, DNase I footprinting of the SULT2A1 promoter produced by mouse liver nuclear extract (NE) and competition assay for the footprint specificity. C, DR1 motif in the –63/–35 footprinted sequence. D, EMSA with mouse liver nuclear extract (NE) and the 32P-labeled –63/–35 SULT2A1 double-stranded oligo probe (left panel) or 32P-labeled double-stranded HNF4{alpha} consensus oligo probe (right panel). E, Loss of stimulation of the basal activity of the SULT2A1 promoter mutated at DR1.

 
The DR1-type motif was validated as an HNF4 element by EMSA and transfection assay (Fig. 6Go, D and E). The EMSA complex with liver nuclear extract was specifically competed out by 100-fold molar excess of the homologous sequence and the HNF4 consensus sequence and was supershifted by the antibody to HNF4{alpha} (Fig. 6DGo; lanes 3, 4, and 6). The complex was unperturbed in the presence of a heterologous oligo (NF-{kappa}B element, lane 5) and the anti-RXR{alpha} antibody (lane 7). The lack of recognition of the complex by the anti-RXR{alpha} antibody is consistent with the homodimeric composition of the DNA-bound HNF4{alpha}. The specificity profile of the complex with a consensus HNF4 element is similar to that with the –30 site, further indicating DR1 as an HNF4 element (Fig. 6DGo, lanes 8–11). Finally, loss of induction of DR-1 mutated SULT2A1 promoter in HNF4{alpha}-cotransfected cells validated the –30 site as a functional HNF4{alpha} element (Fig. 6EGo).

The synergistic influence of the –30 HNF4{alpha} site was observed in the xenobiotic response of SULT2A1 (Fig. 7Go). HNF4{alpha} or CAR cotransfection stimulated luciferase expression to about the same extent (compared with the vector transfection). In contrast, marked synergism in the stimulation of luciferase expression was observed in cells cotransfected concurrently with HNF4{alpha} and CAR (Fig. 7AGo). Mutation of the –30 HNF4{alpha} site reduced the basal promoter activity by more than 3-fold. Nevertheless, the CAR-mediated induction persisted in this case, showing a similar extent of induction in the wild-type vs. HNF4-site mutant promoter (~3-fold in both cases). The double-mutant promoter with inactivated FP1 and FP2 elements completely abrogated the CAR-mediated induction, while maintaining the induction by HNF4{alpha} (Fig. 7AGo). HNF4{alpha} also rendered a synergistic increase in the rifampicin-induced luciferase expression (Fig. 7BGo). These results indicate that HNF4{alpha} can further enhance the xenobiotic response, although the CAR-/PXR-mediated induction of SULT2A1 can occur even in the absence of the HNF4{alpha} effect.


Figure 7
View larger version (22K):
[in this window]
[in a new window]

 
Fig. 7. Synergy of HNF4{alpha} with CAR or PXR in SULT2A1 Induction

Caco-2 cells were cotransfected with SULT2A1-luc (wt) or SULT2A1-luc (HNF4mt) or SULT2A1-luc (double mt) along with CAR/PXR (50 ng) and HNF4{alpha} (50 ng) singly or in combination. Normalized luciferase activities ± SD is shown.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The present study delineates the role of a composite element that acts in cis to mediate PXR- and CAR-regulated transcriptional induction of SULT2A1. Additionally, the synergistic involvement of a more proximally located HNF4{alpha} element in the xenobiotic response of SULT2A1 was identified. The role of SULT2A1 in lipid and energy homeostasis (discussed below) underscores the significance of the effort to illuminate the cis-trans interactions that coordinate the induced expression of human SULT2A1 under nutritional, metabolic, or xenobiotic perturbations. Unlike the multiple rodent Sult2A1 isoforms, SULT2A1 in human tissues is expressed as a single form (30, 31, 32, 33). Although the rodent Sult2A1 gene was previously characterized for a PXR- and CAR-inducible IR0 element, this is the first description of the counterpart element in the human gene.

We show that a shared composite element comprised of two distinct footprinted sites capable of binding PXR and CAR, one harboring an imperfect DR4 (AGTTCATGATTGCTCA at FP1) and the other an imperfect IR-2 (AGCTCAGATGACCC at FP2), mediates the xenobiotic-induced expression of SULT2A1. The two nuclear receptors, however, differ as to how they would recognize the sequence architecture within the composite element. For PXR-mediated induction, both DR4 and IR2 are essential because mutational inactivation of either one completely abolished the regulation (Fig. 5AGo). In contrast, mutations at both repeat motifs were necessary for total abrogation of the CAR-dependent regulation; mutation of a single motif (IR2 or DR4) preserved the CAR response, albeit to an attenuated extent (Fig. 5AGo). Both half sites in IR-2 and DR-4 were disrupted in the reporter constructs used for Fig. 5AGo. We also examined the consequences of half-site mutation at DR4 or IR2. In this case even single-site mutation abrogated the PXR response, whereas the CAR response was preserved to a similar extent as the wild-type promoter (data not shown). The CAR response was completely lost only when the two half sites of both repeat motifs were mutated concurrently (Fig. 5AGo). Nevertheless, on a heterologous promoter the CAR response was totally blocked with mutation at either IR-2 or DR-4 (Fig. 5BGo). Thus it appears that the two receptors differentially recognize the sequence architecture of the composite element in a natural gene environment. This contrasting sequence recognition pattern, as well as the kinetic differences in the PXR and CAR recruitment to the regulatory site (Fig. 2Go), is suggestive of the involvement of distinct sets of coregulators in the CAR- vs. PXR-elicited response. We may speculate that the context-dependent non-overlapping functions of CAR and PXR are linked to the assembly of distinct coregulator complexes at the shared composite site. For example, CAR is thought to regulate energy homeostasis and hinder weight loss in mice in part through increased SULT2A1 expression and the consequent change in thyroid hormone metabolism (14). PXR has no role in this regard. On the other hand, PXR may have a broader role in drug and xenobiotic metabolism compared with CAR, given that the former is activated by a much wider spectrum of xenobiotics (34). SULT2A1 gene induction due to a PXR-selective xenobiotic response may result from the interplay of unique coregulators within the coactivator complex that play no role in the CAR response. Future studies are planned to explore these possibilities. Another important feature of the composite element is that FP1 contains a binding site for C/EBP{alpha}/ß, which was previously shown to play an essential role in the vitamin D3-mediated induction of human SULT2A1 (9). Mutation at FP1 that abolished the PXR response also abolished C/EBP{alpha}/ß binding (data not shown). Thus, as with VDR, interdependence of PXR and C/EBP appears to define the PXR response. In contrast, the same mutation at FP1 only partially inhibited the CAR-mediated induction of SULT2A1, indicating an uncoupling of the CAR activity from the C/EBP{alpha}/ß activity at the composite site. Merged regulatory signals from different nuclear receptors to a common cis element may indicate that the cellular receptor level and conditions that control the pool of specific ligands (hormones, drugs, nutrients, metabolites) would determine which receptor will be the primary coordinator of SULT2A1 expression in vivo.

We conclude that HNF4{alpha} regulates the basal and CAR-/PXR-induced expression of SULT2A1 (Figs. 6Go and 7Go). Because HNF4{alpha} has a central involvement in lipid homeostasis in enterohepatic tissues, its role in the regulation of the SULT2A1 gene activity is not surprising. The HNF4 site (the –30 site) near the TATA box region was validated by specific binding of HNF{alpha}, evident from competition footprinting and antibody supershift of the EMSA complex and from the abrogated induction of the mutant SULT2A1 promoter (at the –30 site) in HNF4{alpha}-cotransfected Caco-2 cells. The –30 site contains a DR1-type motif, which is known to serve as an HNF4 element in a number of HNF4-regulated genes. The apparent paradox that mouse Sult2A1 expression in the liver increased several-fold in liver-specific HNF4{alpha}-knockout mice (14) is likely due to the high serum levels of bile acids in these mice. Activation of PXR and CAR by toxic levels of bile acids accounts for the up-regulated Sult2A1 expression. Furthermore, the bile acid receptor FXR is known to induce rodent Sult2A1 expression in the liver (35). Thus, a complex interplay of HNF4{alpha} with PXR, CAR, as well as other nuclear receptors determines the overall expression level of SULT2A1. HNF4{alpha} also synergistically increased the PXR- and CAR-induced expression of the human SULT2A1 promoter in transfected Caco-2 cells (Fig. 7Go). Synergism is especially pronounced for the CAR-mediated activation, although HNF4{alpha} also imparts a greater than additive effect on the PXR-mediated regulation. Unlike the case with human CYP3A4, where HNF4{alpha} was shown to play an obligatory role in the xenobiotic response (13), the promoter proximal HNF4{alpha} site is not essential in the PXR-/CAR-mediated induction of human SULT2A1 because mutation of the HNF4{alpha} site still preserved the PXR/CAR response (Fig. 7Go). Nevertheless, our results do not rule out a more obligatory involvement of HNF4{alpha} in the xenobiotic response (either through the –30 site or alternate HNF4{alpha} sites outside of the –302/+10 promoter) in a tissue context.

Sulfonation of endobiotic substrates by SULT2A1 can influence physiological homeostasis by altering specific metabolic wiring. For example, increased SULT2A1 activity is associated with a reduced basal metabolic rate due to thyroid hormone inactivation resulting from altered metabolism of the precursor hormone T4 (T4). In this case, the diminished outer ring deiodinase activity on sulfonated T4 prevents production of the biologically active triiodothyronine (T3). Contrastingly, a dramatic rise of the inner ring deiodinase activity on sulfonated T4 promotes inactive reverse T3 formation (36, 37). Indeed, resistance to weight loss in mice during prolonged calorie restriction was attributed to the increased Sult2A1 expression in the liver (under the regulation of Car) and the associated reduction in the serum active thyroid hormone level (21). Cholesterol and bile acid homeostasis is also potentially influenced by SULT2A1 because bile acid sulfation, a primary route of bile acid metabolism in humans (38), is mediated exclusively by this enzyme (39). Furthermore, SULT2A1 can protect the enterohepatic tissues and biliary tract against bile acid overload that may arise from deregulated lipid metabolism or from excessive fat intake. Indeed, the observed association of cholestasis, liver cirrhosis, hepatitis, and hepatocellular carcinoma with high urinary levels of sulfated bile acids (as high as 90% of total bile acids) is likely due to disrupted sterol homeostasis and the consequent rise in bile acids (40). SULT2A1 also catalyzes the metabolism of common medicine and other xenobiotics, as is the case with the breast cancer drug hydroxytamoxifen, the anti-inflammatory drug budesonide, and the estrogenic plasticizer bisphenol-A (41, 42, 43). Given the role of SULT2A1 in caloric balance and energy homeostasis, its role in the metabolism of bile acids and other steroids, and its role in drug metabolism, detailed information on the mechanism regulating the basal and induced expression of human SULT2A1 involving cross talks of xenobiotic receptors with other transcription factors can potentially help strategize new approaches to the remedy for certain metabolic diseases.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Primary Mouse Hepatocytes and Cell Transfections
Hepatocytes were isolated from collagenase-perfused livers of adult male mice (C57BL/6J) as described (44). 3 x 105 viable hepatocytes were plated onto Collagen Type-1 coated wells in 12-well plates (BD Biosciences, San Jose, CA) and maintained in standard Williams’s E media (WEM) (Invitro-gen, Carlsbad, CA) containing 10% FBS, 0.25 U/ml insulin, 10–7 M triamcinolone acetonide, 100 U/ml penicillin, 100 µg/ml streptomycin, and 15 mM HEPES pH 7.4. After cell attachment to the culture dish (3 to 4 h), medium was replaced with serum free WEM. At 24 h post-plating, medium was replaced with WEM lacking serum and triamcinolone acetonide. Hepatocytes were transfected with the reporter plasmid (500 ng) and receptor-encoding plasmids (50 ng) using lipofetamine 2000 (Invitrogen). Transfected cells were overlaid with 0.8 mg Matrigel and fresh medium and incubated overnight at 37 C under 5% CO2. At 24 h post-transfection, cells were treated with vehicle or ligands for 24 h. The harvested cells were assayed for firefly luciferase activity (Promega reagents; Promega Corp., Madison, WI). Caco-2 cells were plated in 24-well flasks for Fugene-mediated (Roche-BMB, Indianapolis, IN) DNA transfection as before (9). All reporter expression was normalized to constant protein amounts. Results were from three independent transfections, each conducted in duplicate.

Assay for SULT2A1 mRNAs
HepG2 (human hepatoma) and Caco-2 (human colonic adenocarcinoma) cells (plated in DMEM, 5% charcoal-stripped serum; 12-well flasks) were transfected with the plasmid encoding VP-PXR (50 ng) or VP-CAR (50 ng) or VP-CMX (50 ng) along with RXR-{alpha} (5 ng) using Fugene (Roche-BMB). Total RNAs (isolated by TRIzol) were reverse transcribed for subsequent QRT-PCR and semi-quantitative PCR. QRT-PCR was performed with iQTM SYBR Green supermix (Bio-Rad, Hercules, CA) using 7900 HT Fast Real-time PCR system (Applied Biosystems, Foster City, CA). Single-peak melting curves ensured the specificity of amplification. SULT2A1 cDNAs were amplified with 5'-GTATACAGCACTCAGTGA (sense primer) and 5'-CCCAGGAATTGACAGATC (antisense primer) and normalized to ß-actin cDNAs. The primers to amplify SULT2A1 cDNAs were selected from a region that did not overlap with any other SULT family members (31). The primers for ß-actin cDNA amplification are: 5'-CGTACCACTGGCATCGTGAT (sense) and 5'-GTGTTGGCGTACAGGTCTTT (antisense). For semi-quantitative RT-PCR, the same primers as above were used for SULT2A1 cDNA amplification, and fold induction was computed after normalization with GAPDH cDNAs, which were amplified with 5'-GTATTGGGCGCC-TGGTCACCAG (sense primer) and 5'-CCTTCTCCATGGTGGTGAAGAC (antisense primer). Bands were quantified using UN-SCAN-IT gel automated digitizing system (Silk Scientific, Orem, UT).

ChIP
Caco-2 cells were analyzed by ChIP as before (9). Briefly, cells (10 cm tissue culture dish) were grown to 80–90% confluence (phenol red-free DMEM supplemented with 5% charcoal-dextran stripped fetal bovine serum). After change to fresh serum-free medium, cells were treated with 10 µM rifampicin or 1 µM CITCO or 1 mM PB, then treated with 1% formaldehyde. Solubilized chromatin fragments (sonicated 500-1000 bp chromatin fragments) were diluted, cleared with protein A-agarose, and immunoprecipitated with CAR- or PXR-specific antibody or the control anti-Cox-2 antibody (Santa Cruz Biotechnology, Santa Cruz, CA). After reversal of cross linking DNA fragments from the proteinase K-digested eluates were purified (Zymoclean system, Zymo Research, Inc, Orange, CA) and analyzed by PCR. The PXR/CAR responsive region was amplified with primer set at –354 (5'-ATGCACGATTGCAGGATTATTTAG); and –55 (5'-GCATGTCACATGTTTGTTG). An upstream sequence of the SULT2A1 gene lacking a PXR/CAR responsive region was amplified with the primer pair 5'-CCTCGGCCTCCCAAAGTGCT (at –1612); 5'-AAAGCTGAATAGAAGTCTAC- (at –1393).

Mutant Plasmid Construction
Mutant promoter-reporter constructs were generated from the wild-type construct (–302/+10 SULT2A1-Luc) as a template using PCR-mediated splicing of mutant DNA fragments as described (9). Primers with altered bases (relative to the wild-type sequence) were used to produce mutant fragments. Altered bases are underlined. For FP2 mutant, we used: GGAACGCAAGCTTTGATTTTCCCTAAAAT (sense); CATTTTAGGGAAAATCAAAGCTTGCGTTC (antisense). FP1mutant: GTCTCT AGATAAGTTTTTGATTGCTTTACATC (sense); AGATGTAAAGCAATCAAAAACTTATCTAGAGA (antisense). Hexamer half-sites are indicated in bold. In the double mutant construct, both half sites of DR4 (within FP1) and both half sites of IR2 (within FP2) were mutated. Mutations in PCR products were verified by sequencing, and the mutant DNAs were subcloned into pGL3b (Promega). The construct 3x(FP2)-3x(FP1)-tk-Luc was prepared by cloning three tandem repeats of FP1 (–155 to –131) and three tandem repeats of FP2 (–192 to –167) into the 5' end of the tk promoter of the tk-Luc vector. FP2 and FP1 mutants in the heterologous constructs were same as in the natural gene.

DNAse I Footprinting and EMSA, Western Blot
The radiolabeled probe for DNase I footprinting was generated by PCR amplification of the human SULT2A1 promoter using a 32P-end-labeled primer. DNA binding and DNAse1 digestion conditions, preparation of the mouse liver nuclear extract, conditions for EMSA, competition of EMSA complexes with double-stranded oligonucleotides, and antibody supershift were described before (22). Bacteria-expressed gluathione S-transferase fusions of human RXR-{alpha}, human PXR, and human CAR were produced in our laboratory. Western blot was performed with the rabbit polyclonal antibodies to PXR or CAR or ß-actin (Santa Cruz Biotechnology).


    ACKNOWLEDGMENTS
 
We acknowledge generous plasmid gifts from Dr. Ronald Evans (RXR{alpha}, mouse CAR, VP-CAR, VP-PXR, VP-CMX), Dr. Steven Kliewer (rat PXR), Dr. Rommel Tirona (human PXR), and Dr. Francis Sladek (HNF4{alpha}).


    FOOTNOTES
 
This work was supported by Philip Morris USA, Morrison Trust, National Institutes of Health (NIH), and Department of Veterans Affairs.

Present address for M.A.: Department of Pathology, Northwestern University, Chicago, IL.

Disclosure: B.C. received research support from NIH-AG10486; VA-Merit review; Philip Morris USA, Inc.; and Morrison Trust, San Antonio. Other authors have no disclosures.

First Published Online June 26, 2007

Abbreviations: AND-ol, Androstenol; CAR, constitutive androstane receptor; CITCO, ligand agonist of human CAR; ChIP, chromatin immunoprecipitation; HNF4, hepatocyte nuclear factor 4; PB, phenobarbital; PXR, pregnane X receptor; QRT-PCR, quantitative RT-PCR; SULT2A1, steroid- and bile acid-sulfotransferase; TCPOBOP, 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene; VDR, vitamin D receptor; virus protein, VP; WEM, Williams’s E media.

Received for publication January 2, 2007. Accepted for publication June 18, 2007.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Chawla A, Repa JJ, Evans RM, Mangelsdorf DJ 2001 Nuclear receptors and lipid physiology: opening the X-files. Science 294:1866–1870[Abstract/Free Full Text]
  2. Kliewer SA, Goodwin B, Wilson TM 2002 The nuclear pregnane X receptor: a key regulator of xenobiotic metabolism. Endocr Rev 23:687–702[Abstract/Free Full Text]
  3. Qatanani M, Moore DD 2005 CAR, the continuously advancing receptor, in drug metabolism and disease. Curr Drug Metab 6:329–339[CrossRef][Medline]
  4. Gachon F, Olela FF, Schaad O, Descombes P, Schibler U 2006 The circadian PAR-domain basic leucine zipper transcription factors DBP, TEF, and HLF modulate basal and inducible xenobiotic detoxification. Cell Metab 4:25–36[CrossRef][Medline]
  5. Thummel KE, Brimer C, Yasuda K, Thottassery J, Senn T, Lin Y, Ishizuka H, Kharasch E, Schuetz J, Schuetz E 2001 Transcriptional control of intestinal cytochrome P-4503A by 1{alpha}, 25-dihydroxy vitamin D3. Mol Pharmacol 60:1399–1406[Abstract/Free Full Text]
  6. Makishima M, Lu TT, Xie W, Whitfield GK, Domoto H, Evans RM, Haussler MR, Mangelsdorf DJ 2002 Vitamin D receptor as an intestinal bile acid sensor. Science 296:1313–1316[Abstract/Free Full Text]
  7. Echchgadda I, Song CS, Roy AK, Chatterjee B 2004 DHEA-sulfotransferase is a target for transcriptional induction by the ligand activated vitamin D receptor. Mol Pharmacol 65:720–729[Abstract/Free Full Text]
  8. Reschly EJ, Krasowski MD 2006 Evolution and function of the NR1I nuclear hormone receptor subfamily (VDR, PXR, and CAR) with respect to metabolism of xenobiotics and endogenous compounds. Curr Drug Metab 7:349–365[CrossRef][Medline]
  9. Song CS, Echchgadda I, Seo YK, Oh T, Kim S, Kim SA, Cho S, Shi L, Chatterjee B 2006 An essential role of the CAAT/enhancer binding protein-{alpha} in the vitamin D-induced expression of the human steroid/bile acid-sulfotransferase (SULT2A1). Mol Endocrinol [Erratum (2006) 20:1286] 20: 795–808
  10. Drocourt L, Ourlin JC, Pascussi JM, Maurel P, Vilarem MJ 2002 Expression of CYP3A4, CYP2B6, and CYP2C9 is regulated by the vitamin D receptor pathway in primary human hepatocytes. J Biol Chem 277:25125–25132[Abstract/Free Full Text]
  11. Hayhurst GP, Lee YH, Lambert G, Ward JM, Gonzalez FJ 2001 Hepatocyte nuclear factor 4{alpha} (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Mol Cell Biol 21:1393–1403[Abstract/Free Full Text]
  12. Watt AJ, Garrison WD, Duncan SA 2003 HNF4: a central regulator of hepatocyte differentiation and function. Hepatology 37:1249–1253[CrossRef][Medline]
  13. Tirona RG, Lee W, Leake BF, Lan LB, Cline CB, Lamba V, Parviz F, Duncan SA, Inoue Y, Gonzalez FJ, Schuetz EG, Kim RB 2003 The orphan nuclear receptor HNF4{alpha} determines PXR- and CAR-mediated xenobiotic induction of CYP3A4. Nat Med 9:220–224[CrossRef][Medline]
  14. Ding X, Lichti K, Kim I, Gonzalez FJ, Staudinger JL 2006 Regulation of constitutive androstane receptor and its target genes by fasting, cyclic AMP, HNF-4{alpha} and the coactivator PGC-1 alpha. J Biol Chem 281:26540–26551[Abstract/Free Full Text]
  15. Guengerich FP 2003 Cytochromes P450, drugs, and diseases. Mol Interv 3:194–204[Abstract/Free Full Text]
  16. Chen Y, Kissling G, Negishi M, Goldstein JA 2005 The nuclear receptors constitutive androstane receptor and pregnane X receptor cross-talk with hepatic nuclear factor 4{alpha} to synergistically activate the human CYP2C9 promoter. J Pharmacol Exp Ther 314:1125–1133[Abstract/Free Full Text]
  17. Runge-Morris M, Wu W, Kocarek TA 1999 Regulation of rat hepatic hydroxysteroid sulfotransferase (SULT2–40/41) gene expression by glucocorticoids: evidence for a dual mechanism of transcriptional control. Mol Pharmacol 56:1198–1206[Abstract/Free Full Text]
  18. Sonoda J, Xie W, Rosenfeld JM, Barwick JL, Guzelian PS, Evans RM 2002 Regulation of a xenobiotic sulfonation cascade by nuclear pregnane X receptor (PXR). Proc Natl Acad Sci 99:13801–13816[Abstract/Free Full Text]
  19. Echchgadda I, Song CS, Oh TS, Cho SH, Rivera OJ, Chatterjee B 2004 Gene regulation for the senescence marker protein DHEA-sulfotransferase by the xenobiotic-activated nuclear pregnane X receptor (PXR). Mech Ageing Dev 125:733–745[CrossRef][Medline]
  20. Saini SPS, Sonoda J, Xu L, Toma D, Uppal H, Mu Y, Ren S, Moore DD, Evans RM, Xie W 2004 A novel constitutive androstane receptor-mediated and CYP3A-independent pathway of bile acid detoxification. Mol Pharmacol 65:292–300[Abstract/Free Full Text]
  21. Maglich JM, Watson, J McMillen PJ, Goodwin B, Willson TM, Moore JT 2004 The nuclear receptor CAR is a regulator of thyroid hormone metabolism during caloric restriction. J Biol Chem 279:19832–19838[Abstract/Free Full Text]
  22. Chatterjee B, Echchgadda I, Song CS 2005 Vitamin D receptor regulation of steroid/bile acid sulfotransferase SULT2A1. Methods Enzymol 400:165–191[Medline]
  23. Runge-Morris M, Kocarerk TA 2005 Regulation of sulfotransferases by xenobiotic receptors. Current Drug Metab 6:299–307[CrossRef]
  24. Fang HL, Strom SC, Cai H, Falany CN, Kocarek TA, Runge-Morris M 2005 Regulation of human hepatic hydroxysteroid sulfotransferase gene expression by the peroxisome proliferator-activated receptor {alpha} transcription factor. Mol Pharmacol 67:1257–1267[Abstract/Free Full Text]
  25. Assem M, Schuetz EG, Leggas M, Sun D, Yasuda K, Reid G, Zelcer N, Adachi M, Strom S, Evans RM, Moore DD, Borst P, Schuetz JD 2004 Interactions between hepatic Mrp4 and Sult2a as revealed by the constitutive androstane receptor and Mrp4 knockout mice. J Biol Chem 279:22250–22257[Abstract/Free Full Text]
  26. Huang W, Zhang J, Wei P, Schrader WT, Moore DD 2004 Meclizine is an agonist ligand for mouse constitutive androstane receptor (CAR) and an inverse agonist for human CAR. Mol Endocrinol 18:2402–2408[Abstract/Free Full Text]
  27. Tzameli I, Pissios P, Schuetz EG, Moore DD 2000 The xenobiotic compound 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene is an agonist ligand for the nuclear receptor CAR. Mol Cell Biol 20:2951–2958[Abstract/Free Full Text]
  28. Métivier R, Penot G, Hübner MR, Reid G, Brand H, Kos M, Gannon F 2003 Estrogen receptor-{alpha} directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115:751–763[CrossRef][Medline]
  29. Song CS, Jung MH, Kim SC, Hassan T, Roy AK, Chatterjee B 1998 Tissue-specific and androgen-repressible regulation of the rat dehydroepiandrosterone sulfotransferase gene promoter. J Biol Chem 273:21856–21866[Abstract/Free Full Text]
  30. Ogura K, Satsukawa M, Okuda H, Hiratsuka A, Watabe T 1994 Major hydroxysteroid sulfotransferase STa in rat liver cytosol may consist of two microheterogeneous subunits. Chem Biol Interact 92:129–144[CrossRef][Medline]
  31. Kong AN, Fei P 1994 Molecular cloning of three sulfotransferase cDNAs from mouse liver. Chem Biol Interac 92:161–168[CrossRef]
  32. Weinshilboum RM, Otterness DM, Aksoy IA, Wood TC, Her C, Raftogianis RB 1997 Sulfation and sulfotransferases 1: sulfotransferase molecular biology: cDNAs and genes. FASEB J 11:3–14[Abstract]
  33. Falany CN 1997 Enzymology of human cytosolic sulfotransferases. FASEB J 11:206–216[Abstract]
  34. Moore LB, Maglich JM, McKee DD, Wisely B, Willson TM, Kliewer SA, Lambert MH, Moore JT 2002 Pregnane X receptor (PXR), constitutive androstane receptor (CAR), and benzoate X receptor (BXR) define three pharmacologically distinct classes of nuclear receptors. Mol Endocrinol 6:977–986
  35. Song CS, Echchgadda I, Baek BS, Ahn SC, Oh T, Roy AK, Chatterjee B 2001 Dehydroepiandrosterone sulfotransferase gene induction by bile acid activated farnesoid X receptor. J Biol Chem 276:42549–42556[Abstract/Free Full Text]
  36. Mol JA, Visser TJ 1985 Rapid and selective inner ring deiodination of thyroxine sulfate by rat liver deiodinase. Endocrinol 117:8–12[Abstract/Free Full Text]
  37. Li X, Anderson RJ 1999 Sulfation of iodothyronines by recombinant human liver steroid sulfotransferases. Biochim Biophys Res Commun 263:632–639[CrossRef][Medline]
  38. Palmer RH 1971 Bile acid sulfates. II. Formation, metabolism and excretion of lithocholic acid sulfates in the rat. J Lipid Res 12:680–687[Abstract]
  39. Radominska A, Comer KA, Zimniak P, Falany J, Iscan M, Falany CN 1990 Human liver steroid sulphotransferase sulphates bile acids. Biochem J 272:597–604[Medline]
  40. Makino I, Shinozaki K, Nakagawa S, Mashimo K 1974 Measurement of sulfated and nonsulfated bile acids in human serum and urine. J Lipid Res 15:132–138[Abstract]
  41. Shibutani S, Shaw PM, Suzuki N, Dasaradhi L, Duffel MW, Terashima I 1998 Sulfation of {alpha}-hydroxytamoxifen catalyzed by human hydroxysteroid sulfotransferase results in tamoxifen-DNA adducts. Carcinogenesis 19:2007–2011[Abstract/Free Full Text]
  42. Meloche CA, Sharma V, Swedmark S, Andersson P, Falany CN 2002 Sulfation of budesonide by human cytosolic sulfotransferase, dehydroepiandrosterone-sulfotransferase (DHEA-ST). Drug Metab Dispos 30:582–585[Abstract/Free Full Text]
  43. Pai TG, Sugahara T, Suiko M, Sakakibara Y, Xu F, Liu MC 2002 Differential xenoestrogen-sulfating activities of the human cytosolic sulfotransferases: molecular cloning, expression, and purification of human SULT2B1a and SULT2B1b sulfotransferases. Biochim Biophys Acta 1573:165–170[Medline]
  44. Klaunig JE, Goldblatt PJ, Hinton DE, Lipsky MM, Chacko J, Trump BF 1981 Mouse liver cell culture. I. Hepatocyte isolation. In Vitro 17:913–925[Medline]

NURSA Molecule Pages Link:

Nuclear Receptors:   PXR  |  CAR  |  HNF4α  |  RXRα
Ligands:   Rifampicin  |  Pregnenolone carbonitrile  |  Calcitriol  |  CITCO  |  Phenobarbital  |  Androstenol  |  TCPOBOP



This article has been cited by other articles:


Home page
Toxicol SciHome page
Y. Alnouti
Bile Acid Sulfation: A Pathway of Bile Acid Elimination and Detoxification
Toxicol. Sci., April 1, 2009; 108(2): 225 - 246.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
S. Surapureddi, R. Rana, J. K. Reddy, and J. A. Goldstein
Nuclear Receptor Coactivator 6 Mediates the Synergistic Activation of Human Cytochrome P-450 2C9 by the Constitutive Androstane Receptor and Hepatic Nuclear Factor-4{alpha}
Mol. Pharmacol., September 1, 2008; 74(3): 913 - 923.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Echchgadda, I.
Right arrow Articles by Chatterjee, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Echchgadda, I.
Right arrow Articles by Chatterjee, B.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals