| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Biochemistry and Molecular Biology (K.A.M., M.M.I., K.A.R., N.S.W., C.M.K.), Center for Genetics and Molecular Medicine, and Department of Pediatrics (M.J.B.), Cytogenetics Lab, University of Louisville School of Medicine, Louisville, Kentucky 40292
Address all correspondence and requests for reprints to: Carolyn M. Klinge, Department of Biochemistry and Molecular Biology, University of Louisville School of Medicine, 580 South Preston Street, Louisville, Kentucky 40202. E-mail: carolyn.klinge{at}louisville.edu.
| ABSTRACT |
|---|
|
|
|---|
and ERβ in vitro, and E2 induced ER
and ERβ recruitment to this ERE in chromatin immunoprecipitation assays in MCF-7 cells. The NRF-1 ERE activated reporter gene expression in transfected cells. Small interfering RNA to ER
and ERβ revealed that ER
mediates E2-induced NRF-1 transcription. The E2-induced increase in NRF-1 was followed by increased TFAM and the transcription of Tfam-regulated mitochondrial DNA-encoded COI and NDI genes and increased mitochondrial biogenesis. Knockdown of NRF-1 blocked E2 stimulation of mitochondrial biogenesis and activity, indicating a mechanism by which estrogens regulate mitochondrial function by increasing NRF-1 expression. | INTRODUCTION |
|---|
|
|
|---|
Classical intracellular estrogen action is mediated by estrogen receptors (ERs) via regulation of gene transcription. There are two subtypes of ER: ER
and ERβ. In an estrogen-responsive cell, the vast majority of ER resides within the nucleus where ER
, but not ERβ, is complexed with the heat-shock protein 90 chaperonin complex when a ligand is not present (3, 4). Once activated by estradiol (E2) or other estrogen-like compounds, ERs dimerize and bind to estrogen response elements (EREs) located in the promoters or distal enhancer regions of target genes (5). The majority of estrogen-sensitive genes do not contain palindromic EREs; instead, single or multiple imperfect or half-site EREs regulate the E2 response (6). In addition, ER binds directly to other DNA-bound transcription factors, e.g., Sp1 or AP1, via a tethering mechanism, resulting in increased transcription (7). ER mediates its genomic effects through interactions with coactivators that recruit chromatin remodeling complexes and increase gene transcription (8).
In addition to its genomic effects that occur within 3–6 h after estrogen administration, ER mediates rapid, membrane-initiated, nongenomic effects of E2 that occur within seconds to minutes after treatment in a cell type-dependent manner (9). Nongenomic effects of ER have been best characterized in endothelial cells in which E2 rapidly inhibits calcium influx (10), increases intracellular Ca2+ (11) and cAMP (12), and stimulates nitric oxide (NO) release resulting in vasodilation (13) and thus accounting in part for the observed cardioprotective effects of estrogens. The membrane-associated ERs that mediate these nongenomic effects are transcribed from the same messages used to generate nuclear ER
and ERβ and are inhibited by the ER antagonist ICI 182,780 (14). Membrane-associated ER conveys these rapid intracellular effects by activating G-coupled proteins, adenylate cyclase production, and inositol phosphate production (14). By activating networks including the phosphoinositide-3 kinase (PI3K) and MAPK, nongenomic ER rapidly induces a number of changes within the cell including changes in gene expression through phosphorylation of transcription factors and coregulators (15, 16).
The role of estrogens in mitochondrial function is well established from studies with ER
knockout (ERKO) and Ovx rodents. In a model of cardiac ischemia-reperfusion, the mitochondria of ERKO mice contained noticeable ultrastructural damage and a decrease in mitochondrial respiratory chain (MRC) function (17). A similar study comparing Ovx or E2-supplemented Ovx rats showed that myocardial mitochondrial damage and decreased MRC function in the Ovx rats was ameliorated by E2 (18). These studies suggest an important role for ER in maintaining mitochondrial structure and function in the ischemia-reperfusion model.
Estrogens may exert direct or indirect effects on mitochondrial function in a variety of tissues, most notably in mediating the neuroprotective effects of estrogen (19). ERβ was localized to mitochondria in several brain cell types as well as primary cardiomyocytes (20). Mitochondrial localization of ERβ was demonstrated by a variety of complementary techniques including immunocytochemistry, subcellular fractionation, and mass spectrometry (20). ER
and ERβ have also been detected in mitochondria of MCF-7 human breast cancer cells (21), and treatment with E2 enhanced ER mitochondrial localization in a concentration- and time-dependent manner (22). An E2-dependent increase in mRNA levels of mitochondrial DNA (mtDNA)-encoded genes cytochrome c oxidase subunits I and II (MTCOI and MTCOII) was detected, suggesting a direct effect of E2 on mtDNA gene transcription (22). However, the intra-mitochondrial localization of ER is controversial, and one group reported that ERβ was not detectable in mouse liver mitochondria as analyzed by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (23). The mitochondrial localization of ER may be cell specific because ERβ was recently identified in human heart mitochondrial proteins by MALDI-TOF (24).
The transcription factor nuclear respiratory factor-1 (NRF-1) plays a key role in integrating the transcription of nuclear- and mitochondrial-encoded genes (25). NRF-1 homodimerizes and binds to palindromic NRF-1 sites in the promoters of nuclear-encoded mitochondrial genes (26). NRF-1 interacts with the coactivators Peroxisome proliferator activated receptor
coactivator-1 (PGC-1)
and PGC-1 related coactivator (PRC) to regulate target genes involved in mitochondrial respiratory function (27, 28). NRF-1 target genes include subunits of the five MRC complexes, assembly factors for the respiratory apparatus, parts of the mtDNA transcription and replication machinery, mitochondrial and cytosolic enzymes of heme biosynthesis, components of mitochondrial protein import, and three key mtDNA transcription factors, mitochondrial transcription factor A (Tfam) and mitochondrial transcription factor B types 1 and 2 (TFB1M and TFB2M, mtTFB1 and mtTFB2, hereafter referred to as TFBs) (29). Tfam and TFBs transcribe the mitochondrial genome, resulting in an increase in mitochondrial-encoded subunits of the MRC (29). NRF-1 plays an essential role in integrating nucleo-mitochondrial interactions (30). The NRF-1 knockout mouse showed a decrease in mtDNA that resulted in embryonic lethality, further demonstrating that NRF-1 is essential for viability (31).
Expression of NRF-1 is increased by a variety of environmental stimuli and hormones (32, 33, 34). Thyroid hormone (T3) increases NRF-1 gene expression through a hormone-responsive element in the NRF-1 promoter (35). Although glucocorticoids and estrogens have both been suggested to play a critical role in mitochondrial up-regulation and mitochondrial gene expression, no one has evaluated whether these hormones directly regulate NRF-1 transcription. Interestingly, a recent study revealed that NRF-1 is up-regulated in cerebral blood vessels of Ovx rats chronically treated with E2, suggesting that estrogen may regulate NRF-1 transcription (36).
Coordinate expression of mitochondrial- and nuclear-encoded genes has been proposed to be mediated by hormone receptors within mitochondria inducing expression of mtDNA-encoded genes (37). Here we tested the hypothesis that estrogen increases mitochondrial activity and mtDNA-encoded mRNA expression through ER-mediated up-regulation of NRF-1 gene transcription. We report for the first time that NRF-1 mRNA is up-regulated by E2 and that this is a direct transcriptional effect mediated by ER in a breast cancer and lung cancer cell line.
| RESULTS |
|---|
|
|
|---|
|
NRF-1 Is a Primary Estrogen-Responsive Gene Mediated by Genomic ER
The transcriptional inhibitor actinomycin D (ActD) and protein synthesis inhibitor cycloheximide (CHX) were used to determine whether the E2-ER-mediated increase in NRF-1 was a direct effect of ER at the genomic level or required synthesis of a secondary estrogen-responsive protein. Notably, ActD, but not CHX, inhibited the E2-induced increase in NRF-1 mRNA (Fig. 1C
), indicating that the de novo expression of an E2-induced protein was not required for increased NRF-1 transcription. We conclude that NRF-1 is a primary E2-responsive gene.
To determine whether the E2-induced increase in NRF-1 is mediated by nongenomic ER activity, MCF-7 cells were pretreated for 1 h with the MAPK (MEK) and PI3K inhibitors PD98059 and wortmannin, respectively. Neither inhibitor altered the E2-induced increase in NRF-1 (Fig. 1C
), indicating that the E2 response is mediated by genomic ER activity and not nongenomic/membrane-initiated activation of the PI3K/Akt and MAPK signaling pathways.
Small Interfering (siRNA) to ER
But Not ERβ Inhibits E2-Induced NRF-1 Expression in MCF-7
Because ER
and ERβ proteins are expressed in MCF-7 (38, 41) (see also supplemental Fig. 2, published as supplemental data on The Endocrine Societys Journals Online web site at http://mend.endojournals.org) and H1793 cells (38), the observed ER-dependent up-regulation of NRF-1 by E2 could be mediated by both or either subtype. To examine the contribution of each ER subtype to the E2-induced NRF-1 transcription, MCF-7 cells were transfected with control/nonspecific siRNA or siRNA targeting ER
or ERβ for 48 h followed by treatment with ethanol (EtOH) or 10 nM E2 for 4 h. Control siRNAs did not affect basal or E2-induced NRF-1 transcription (Fig. 1D
). Knockdown of ER
reduced basal and E2-stimulated NRF-1 mRNA by 84 and 89%, respectively. In contrast, knockdown of ERβ did not alter basal NRF-1 or E2-induced NRF-1 mRNA expression (Fig. 1D
). Subtype-specific siRNAs reduced ER
and ERβ protein levels by about 85 and 75%, respectively. Together these data indicate that ER
mediates the E2-induced transcription of NRF-1 in MCF-7 cells.
ER
- and ERβ-Selective Agonists Increase NRF-1 Transcription
To further address the roles of ER
and ERβ in regulating NRF-1 transcription, cells were treated with concentrations of the ER
- and ERβ-selective agonists, propyl pyrazole triol (PPT) (42) and diarylpropionitrile (DPN) (43), that selectively activate each respective ER subtype. PPT induced the same increase in NRF-1 as E2, and DPN yielded about 50% of the E2 increase in NRF-1 in MCF-7. These data indicate that NRF-1 is transcriptionally regulated by agonist-occupied ER
in MCF-7 cells. When MCF-7 cells were treated with PPT and DPN, NRF-1 induction was identical to PPT alone, indicating a saturated response (Fig. 1E
). DPN increased NRF-1 to the same extent as E2 in H1793 cells, whereas PPT had no effect, indicating an ERβ-mediated transactivation. These data agree with the higher expression of ERβ than ER
in H1793. R,R-tetrahydrochrysene (R,R-THC), an ER
agonist/ERβ antagonist (44), stimulated NRF-1 transcription in MCF-7 and had no effect when combined with E2. However, R,R-THC inhibited basal and E2-induced NRF-1 expression in H1793 cells. Overall, we conclude that the induction of NRF-1 in response to E2 appears to be ER
subtype selective in MCF-7 and that ERβ is responsible for E2-induced NRF-1 transcription in H1793 lung adenocarcinoma cells.
NRF-1 Protein Expression Is Increased by E2
Western blot analysis of NRF-1 protein expression after E2 treatment revealed a time-dependent increase in NRF-1 in MCF-7 cells with statistical significance reached after 24 h of E2 treatment (Fig. 1F
). These results agree with the increase seen in NRF-1 mRNA expression with E2 treatment but are delayed in time, as seen for other E2-target genes (45).
The effect of knockdown of ER
and ERβ on NRF-1 protein expression was also examined. ER
and ERβ proteins were reduced about 85 and 95% by their respective siRNAs (Fig. 1G
). siER
reduced E2-induced NRF-1 protein by about 45%, whereas siERβ reduced E2-induced NRF-1 protein by about 24% (Fig. 1
, G and H). The siERβ-mediated decrease in NRF-1 correlates with an approximately 20% reduction in ER
protein in the MCF-7 cells 72 h after transfection (data not shown).
The Expression of Tfam; Complex IV, Cytochrome c Oxidase Subunit I (COI, MTCO1); and NADH Dehydrogenase Subunit I (NDI) mRNAs Are Increased by E2
NRF-1 stimulates transcription of the mitochondrial transcription factor Tfam by binding to an NRF-1 response element in the Tfam promoter (46). Subsequently, Tfam increases the transcription of mtDNA-encoded gene targets (30). The expression of Tfam and two mitochondrial-encoded mRNAs, COI and NDI, were analyzed by QRT-PCR to determine whether the E2-induced increase in NRF-1 resulted in a downstream increase in the transcription of nuclear-encoded Tfam and mitochondrial-encoded Tfam target genes. Tfam mRNA was increased 12–72 h after E2 treatment (Fig. 2A
). The expression of Tfam-regulated, mtDNA-encoded COI and NDI mRNAs was increased 48–72 h after E2 treatment (Fig. 2B
). Furthermore, this increase and that of Tfam was inhibited by ICI 182,780, indicating an ER dependence (Fig. 2C
). To further examine the downstream effects of E2-induced NRF-1 up-regulation, the expression of secondary gene targets COI (mtDNA-encoded, MTCOI) and cytochrome c oxidase (COIV, nuclear-encoded) proteins was evaluated compared with protein disulfide isomerase (PDI) control (Fig. 2D
). COI and COIV are both subunits of complex IV in the MRC. COI is transcriptionally regulated by Tfam and TFBs, whereas COIV is a direct target of NRF-1 (30). E2 induced a significant increase in both proteins after 48 and 72 h (Fig. 2D
).
|
E2 Activates NRF-1 Promoter Function
The Gene2Promoter program (47) predicted the NRF-1 promoter to be within the first –600-bp region of the NRF-1 start site. It was previously reported that a –1000-bp region contained the NRF-1 gene promoter based on transient transfections in COS, HeLa, and L6 cells (48). Using MatInspector (49), an extended –1100-bp region 5' of the NRF-1 start site was examined for putative transcription factor binding sites. The MatInspector program selected an area –963 to –944 as a canonical palindromic ERE with a matrix similarity of 0.831. To investigate the putative ERE in E2 activation of NRF-1 transcription, we used luciferase assays. A series of constructs containing a wild-type NRF-1 promoter, deletions of the ERE, and mutations in the putative ERE were cloned into the pGL2-luciferase reporter plasmid (Fig. 3A
). E2 stimulated an increase in luciferase activity from the pGL2-NRF-1 (–1100) and (–1007 to –807) constructs, which contain the putative ERE but not the pGL2-NRF-1 (–677), (–378), or (–1007 to –807) constructs lacking the ERE, indicating that the region from –1007 to –807 containing the putative ERE is estrogen responsive (Fig. 3B
). Mutagenesis was performed to eliminate the putative ERE from the pGL2-NRF-1 (–1100) construct to further evaluate the role of the putative ERE in the estrogen response. As demonstrated in Fig. 3B
, when nucleotides within the core ERE were mutated within the pGL2-NRF-1 (–1100) construct, E2 did not stimulate luciferase activation. Treatment with ICI 182,780 had no effect on luciferase activity from the full-length promoter construct or pGL2-NRF-1 (–1007 to –807); however, cotreatment of cells with E2 and ICI 182,780 ablated the E2-induced increase in luciferase activity. These results indicate that the E2-induced reporter activity is mediated by ER interaction with the NRF-1 promoter region containing the putative ERE.
|
and ERβ bound directly to a putative ERE identified in silico and in the promoter deletion transient transfection assays in the NRF-1 promoter (–963 to –944) (Fig. 4A
was present on both the NRF-1 and pS2 ERE-containing regions, and ERβ was observed on the pS2 ERE but not on the NRF-1 ERE. E2 increased ER
and ERβ binding to the pS2 and NRF-1 EREs (Fig. 4B
or ERβ was observed in the distal NRF-1 promoter, demonstrating the specificity of the interaction of each ER with the NRF-1 ERE region.
|
and ERβ recruitment observed in response to E2 (Fig. 4B
occupied the pS2 promoter by in the absence of E2, and E2 increased ER
recruitment (Fig. 4C
but not ERβ occupied the NRF-1 ERE in the absence of ligand. E2 significantly increased the recruitment of both ER
and ERβ to the NRF-1 ERE (Fig. 4D
The putative NRF-1 ERE (5'-CGGGCAtggTGTCCT-3') differs from the palindromic consensus ERE (5'-AGGTCAgagTGACCT-3') by two base pair changes in the 5' half-site and one base pair change in the 3' half-site indicated in bold. These changes, while reducing the affinity of ER for the ERE, do not eliminate the site. In fact, all three of the changes in the ERE site in the NRF-1 promoter occur at nucleotide positions previously identified as lower in importance to the binding of ER
(5, 6). EMSAs indicated that recombinant ER
and ERβ bind directly to the putative ERE in the NRF-1 promoter without ligand and in the presence of E2 and 4-hydroxytamoxifen (Fig. 4C
).
Deviation from the perfect consensus ERE correlates with decreasing affinity of ER-ERE binding (6). To determine the Ki of the ER-NRF-1-ERE interaction, competition EMSAs were performed (Fig. 5A
). As shown, the NRF-1-ERE had lower binding affinity for ER than EREc38. The binding affinity was similar for unliganded ER
and ERβ with a Ki = 668 ± 76.2 and 699 ± 71 nM, respectively, and 1056 ± 98 and 895 ± 51 nM for E2-ER
and -ERβ, respectively, indicating lower affinity of E2-ER
for the NRF-1-ERE than E2-ERβ in vitro. ER
binds the nonconsensus ERE at position –1211 in the human c-Fos promoter that has two nucleotide changes in the 5' half-site and a 13-bp palindrome with a Kd of 328 ± 38 nM, and ERβ binds this ERE with a Kd = 240 ± 24 nM (51).
|
|
To further examine the contribution of ER
to the observed E2-induced increase in rates of oxygen consumption, identical experiments were performed in MDA-MB-231 cells, i.e. an E2-insensitive, ER
-negative breast cancer cell line (Fig. 6
, C and D). E2 did not increase oxygen consumption in this estrogen-independent cell line (Fig. 6E
).
| DISCUSSION |
|---|
|
|
|---|
and ERβ interaction with a nonconsensus ERE in the NRF-1 promoter. Knockdown experiments indicated that E2 stimulates NRF-1 transcription through ER
and not ERβ in MCF-7 cells. E2 increases transcription of NRF-1, which is an established integrator of nuclear and mitochondrial interactions (30). The increase in NRF-1 mRNA and protein with E2 treatment agrees with the report that NRF-1 protein was increased in the cerebral blood vessels of E2-treated Ovx rats (36). Although the present study was under review, a newly published microarray profiling study of genes regulated by E2 in aortas from Ovx vs. E2-supplemented Ovx
ERKO, βERKO, and wild-type mice identified more than 18 nuclear-encoded MRC subunits that are E2-ER
regulated (53). Importantly, NRF-1 mRNA was decreased in the
ERKO but not βERKO mice, indicating that E2-ER
regulates NRF-1 in mouse aorta. These in vivo data support the results of our siRNA experiments indicating that ER
and not ERβ was responsible for the E2-induced NRF-1 in MCF-7 cells. Notably, NRF-1 was down-regulated by E2-ERβ and genes including an NRF-1 response element in the –1-kb promoter were also down-regulated in
ERKO mice, indicating that ERβ actively represses a subset of MRC genes (53). The authors speculated that ER
and ERβ directly regulate NRF-1 transcription through an ERE in the promoter and call for studies along these lines. A caveat of this study is the 1-wk E2 treatment; thus, many identified genes are unlikely to be direct E2 targets, but rather secondary or tertiary targets. Nonetheless, together with the previous report regarding E2 up-regulation of NRF-1 in rat cerebral blood vessels, these data provide physiological relevance to the molecular characterization of E2-induced NRF-1 transcription reported here. These results may explain previously observed increases in mitochondrial activity in response to E2, but they do not rule out a role for ER action within mitochondria. A role for nongenomic E2 action in mediating NRF-1 transcription was eliminated because inhibitors of the two dominant nongenomic estrogen signaling pathways in MCF-7 cells, MEK and PI3K (54, 55), had no effect on E2-induced NRF-1 expression. Likewise, E2 increased the expression of genes regulated by NRF-1, Tfam mRNA, and subsequently, in a time-delayed manner, mtDNA-encoded Tfam-regulated COI and NDI mRNA. These data are in agreement with a report demonstrating a 2-fold increase in COI mRNA with E2 treatment in MCF-7 cells (22); however, there was a time difference noted between that study and our results. We detected an increase in COI at 48 h, whereas the previous report (22) indicated this increase at 12 and 24 h after E2 treatment of MCF-7 cells. The use of a 10-fold higher E2 concentration (100 nM, nonphysiological) in the previous study may account for the difference in induction times. Subsequent to the increase in NRF-1 and secondary gene expression, including COI and COIV proteins, an increase in mtDNA and oxygen consumption was observed. The increase in mtDNA in concert with COI and NDI suggests a pathway by which E2-induced NRF-1 and subsequent increased Tfam activates both transcription and mtDNA replication. In addition to the observed increase in the expression of these genes as reported here, microarray analyses of E2-regulated genes in MCF-7 cells have identified increases in mRNAs encoding genes involved in a variety of functions within mitochondria (supplemental Table 1, published as supplemental data on The Endocrine Societys Journals Online web site at http://mend.endojournals.org). In parallel to the increase in mitochondrial gene expression, E2 increased oxygen consumption, which is an index of MRC activity. Whether this increase is due to increased MRC activity or an increase in mitochondrial biogenesis leading to more mitochondria per cell remains to be determined.
Importantly, we add NRF-1 to the list of genes regulated by nonpalindromic, low-affinity ER-ERE binding (6). Despite the low binding affinity of ER for the NRF-1 ERE as measured by EMSA, ChIP revealed that the putative NRF-1 ERE is occupied by both ER
and ERβ in response to E2, similar to the pS2 promoter, an established ER target gene (56). Furthermore, the luciferase assays using the NRF-1 promoter deletion and ERE-mutation constructs demonstrate that the NRF-1 ERE is responsible for E2-induced luciferase reporter activity from the human NRF-1 promoter using endogenous ER in MCF-7 cells.
In summary, we have identified NRF-1 as a primary estrogen target gene regulated by direct ER interaction with an ERE in the promoter. The E2-stimulated increase in NRF-1 was followed in a time-dependent manner by increases in NRF-1 regulated Tfam mRNA transcription and then, in turn, by Tfam-regulated COI and NDI mRNA expression. In concert with these changes in mRNA and protein expression, oxygen consumption and mtDNA copy number were increased by E2, indicating an increase in mitochondrial biogenesis. Together these results suggest a mechanism to explain, in part, an important role for E2 in up-regulating mitochondrial activity in estrogen-responsive cells (Fig. 7
). These data with the work of other investigators may contribute an explanation for the observed E2-mediated decrease in mitochondrial ROS production and the well-established enhanced longevity in females in most mammalian species (1, 2).
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Antibodies
Antibodies were purchased as follows: ER
(HC-20) and ERβ (H-150) from Santa Cruz Biotechnology (Santa Cruz, CA), ERβ (PA1-311 and MA1-23217) from Affinity Bioreagents (Golden, CO), NRF-1 from Rockland Scientific (Gilbertsville, PA), COI and COIV from Mitoscience (Eugene, OR), ER
(AER320) and
-tubulin from NeoMarkers (Freemont, CA), and PDI and β-actin from Sigma-Aldrich.
Cell Culture and Treatment
MCF-7 and H1793 cells were purchased from American Type Culture Collection (Manassas, VA). MCF-7 cells and H1793 cells were maintained as described (38). Before treatment, the cells were placed in phenol red-free media supplemented with 5% dextran-coated charcoal stripped fetal bovine serum (DCC-FBS) for 72–96 h. EtOH was used as the vehicle control for all experiments. Cells were treated with various concentrations of E2 as indicated in the figures. For the indicated experiments, MCF-7 cells were pretreated with 100 nM ICI 182,780 for 6 h before E2 treatment. For other experiments, cells were pretreated for 1 h with 10 µg/ml ActD, 10 µg/ml CHX, 50 µM PD98059, or 50 nM wortmannin before E2 treatment for 4 h.
RNA Isolation, RT-PCR, and QRT-PCR
RNA was extracted using Trizol (Invitrogen, Carlsbad, CA). The high-capacity cDNA archive kit (PE Applied Biosystems, Foster City, CA) was used to reverse transcribe total RNA using random hexamers. TaqMan primers and probes for NRF-1, Tfam, and 18S rRNA were purchased as Assays-on-Demand Gene Expression Products (PE Applied Biosystems). Measurement of COI, NDI, and 18S using SYBR Green (PE Applied Biosystems) was performed as previously described (57). The expression of each target gene was determined in triplicate in three to six separate experiments and normalized using 18S. QRT-PCR for NRF-1 and 18S Assays-on-Demand was performed in the ABI PRISM 7900 Sequence Detection System 2.1 (PE Applied Biosystems) using relative quantification. QRT-PCR for COI and 18S was performed using absolute quantification. Analysis and fold differences were determined using the comparative cycle threshold (CT) method. Fold change was calculated from the 
CT values with the formula 2–
CT, and data are presented as relative to expression in EtOH-treated cells.
Protein Isolation
Whole-cell extracts (WCE) were collected in 300 µl modified radioimmunoprecipitation buffer (as described in Ref. 38), and membrane preparations were prepared as described previously (58, 59). Protein concentrations were determined using DC Protein Assay (Bio-Rad Laboratories, Hercules, CA).
siRNA Knockdown
For silencing of ER
and ERβ, siRNA knockdown was performed in MCF-7 cells using siRNA duplexes obtained from either New England Biolabs (ER
ShortCut siRNA Mix, i.e. a heterogeneous mixture of 21–23 bp siRNA for ER
) or Invitrogen (ESR2 Stealth Select 3 RNAi). Control siRNA from each company was used in parallel with the ER-subtype-specific siRNA. The cells were transfected with the recommended reagent according to the manufacturers protocol. Twenty-four hours after transfection, the medium was replaced with phenol red-free Iscoves MEM (IMEM) with 5% DCC-FBS, and 24 h later (48 h after transfection with siRNA), the cells were treated with 10 nM E2 or EtOH for 4 h, and total RNA or WCE was harvested.
For knockdown of NRF-1, MCF-7 cells were cultured in six-well plates until reaching 60% confluency. The cells were transfected with siRNA targeting NRF-1 (Santa Cruz Biotechnology) according to the manufacturers protocol. Forty-eight hours after transfection, the cells were treated with 10 nM E2 for 48 h, and then cells were harvested for RNA, WCE, and genomic DNA as described above.
Western Blot Analysis
Protein (20–40 µg) was separated on 8–15% polyacrylamide SDS gels and electroblotted onto polyvinylidene difluoride membranes with data quantitated as previously described (38). Un-Scan-It (Silk Scientific, Orem, UT) was used to quantitate the integrated OD (IOD) for each band. The IOD for NRF-1 was divided by the concordant
-tubulin or β-actin IOD in the same blot. The EtOH value was set to 1 for comparisons.
Cloning of Human NRF-1 Promoter and Deletion Constructs for Luciferase Reporter Assays
Primers were designed to the –1100-bp region of the NRF-1 promoter using Primer3 (forward GAGTCTCCTGACGACACTAA, reverse GAAGTTCTACTCAGAGCGGC). The –1100-bp fragment of hNRF-1 (NM_005011) was cloned from human genomic DNA (Roche, Indianpolis, IN) into the pCR-Blunt II-Topo vector (Invitrogen). After sequencing, restriction digestion (XhoI/SacI) was used to subclone the –1100 promoter fragment into the pGL2-basic-luciferase vector (Promega, Madison, WI). Primers were then designed to clone two smaller fragments of the NRF-1 promoter at approximately 300-bp intervals. The primers designed resulted in a –677-bp fragment (forward TATCTGGCACAGCACGAGAC, reverse GAAGTTCTACTCAGAGCGGC) and a –378 fragment (forward CGCCGCTTCTCCGGGGCGTC, reverse GAAGTTCTACTCAGAGCGGC). Primers were also designed to clone the 200-bp region surrounding the putative NRF-1 ERE (forward GAGTCTCCTGACGACACTAA, reverse TAACGGTGGAGACACACGAG). The –677-, –378-, and 200-bp fragments were inserted into the pCR-Blunt II-Topo vector, sequenced, and subsequently digested with XhoI and SacI and placed into the pGL2-basic-luciferase plasmid. The plasmids are named after their corresponding fragments as noted in Fig. 3A
.
The pGL2-NRF-1-(–1100MUT) mutant ERE was generated using the QuikChange Mutagenesis Kit (Stratagene, La Jolla, CA) according to the manufacturers protocol using the following primers: forward CCCCTCTGCCTGGCCTGGAGTCCTGTAAT and reverse GCCTCCCAAAGTGCTGGTATTACAGGA. The primers introduced two base pair changes into the 5' half-site and one base pair change in the 3' half-site, abolishing the putative palindromic ERE present in the NRF-1 promoter. Presence of the correct mutation was confirmed by sequencing.
Luciferase Assays
For luciferase assays, cells were plated in 24-well plates at a density of 1.5 x 104 cells per well in phenol red-free OPTI-MEM I reduced serum medium (Invitrogen) supplemented with 10% DCC-FBS, 1% penicillin/streptomycin. Transient transfection was performed using FuGene6 (Roche). Each well received 250 ng of a pGL2-pro-luciferase reporter (Promega) and 5 ng of a Renilla luciferase reporter (pRL-tk) from Promega. Twenty-four hours after transfection, triplicate wells were treated with EtOH (vehicle control) or 10 nM E2. The cells were harvested 30 h after treatment using Promegas Passive Lysis buffer. Luciferase and Renilla luciferase activities were determined using Promegas Dual Luciferase assay in a Plate Chameleon luminometer (BioScan, Washington, DC) (38). Firefly luciferase was normalized by Renilla luciferase to correct for transfection efficiency. Fold induction was determined by dividing the averaged normalized values from each treatment by the EtOH value for each transfection condition within that experiment. Values were averaged from multiple experiments as indicated in the figure legend.
ChIP Assay
MCF-7 cells were transferred to phenol red-free IMEM with 10% DCC-FBS 72 h before treatment. ChIP assays were performed as described previously (56). In brief, 4 x 106 cells per immunoprecipitation were treated with 2.5 µM
-amanitin for 2 h. The medium was then removed and replaced with medium containing 10 nM E2 or EtOH for 60 min. Chromatin was cross-linked using 1.5% formaldehyde for 5 min at 37 C, and the cells were collected after two washings with PBS. Subsequent incubation and washes were completed as described previously (56). The extracts were incubated with anti-ER
antibody (HC-20), anti-ERβ (H-150) antibody, or normal rabbit IgG (all from Santa Cruz). After elution of the antibody-protein complexes for 30 min in 1% SDS with 0.1 M NaHCO3, the DNA was purified using PCR Clean-Up Kit (QIAGEN, Valencia, CA) and probed for target sequences. Primers for the putative NRF-1 ERE probed the –761- to –1032-bp region, i.e. forward primer GGTCCCAGGACTCAAAACAA and reverse primer CAGGTGCCTGAGAAGTAGGG. As a positive control, primers flanking the established ERE in the human pS2 (Trefoil Factor 1; TFF1) gene promoter (56) were used. As a negative control, primers were designed to a distal region (–3060 to –3208) of the NRF-1 promoter, forward primer ACCCTTGTGGAAACAGCATC and reverse primer AAACGGACTGGGCTTACCTT.
QRT-PCR with ChIP Samples
ChIP was performed as described above. QRT-PCR of 3 µl purified immunoprecipitated DNA was done with the primers for NRF-1 and pS2 listed above using SYBR Green Master Mix. Relative promoter enrichment compared with IgG is plotted (60).
ER
and ERβ Proteins
Recombinant human ER
(61) and Flag-tagged recombinant human ERβ1 (62) were expressed by baculovirus infection of Sf21 cells. The concentrations of ER
and ERβ were determined by quantitating specific [3H]E2 binding in a hydroxyapatite assay (63) and were 150 and 95 fmol/µg protein for ER
and ERβ, respectively.
EMSA and ER-NRF-1-ERE Ki Determination
The DNA oligonucleotide sequences used in EMSA were as follows: putative NRF1-ERE from the human NRF-1 promoter 5'-GGAAGCCGGGCATGGTGTCCTGT-3' and a consensus EREc38 (64). The ERE is underlined with nonconsensus ERE nucleotides in bold. EMSA was performed and quantitated in a Packard Instruments Instant Imager and with Packard Imager for Windows version 2.04 as previously described (65).
To measure the Ki in competition assays, reactions included 1.2 nM ER
or 1.5 nM ERβ, 1.1 nM [32P]EREc38 (5'-CCAGGTCAGAGTGACCTGAGCTAAAATAACACATTCAG-3') (64), 100 nM E2, and 0.5–20,000 nM unlabeled NRF-1-ERE (66). The concentrations of free and ER-bound [32P]EREc38 were fit to the one-site binding model (determination coefficient R2 > 0.93 and 0.98 for ER
and ERβ without ligand and 0.97 and 0.94 with E2). The IC50 was determined from the Pseudo-Hill plot: log %/(100 – %) = nlog{[I] + nlogIC50, where % = percent competition of specific binding and I = competitor. The Ki was calculated from the IC50, using the equation of Cheng and Prusoff (67).
Mitochondrial Biogenesis
Semiquantitative PCR analysis of mtDNA relative to the 18S rRNA gene (nuclear encoded) was one measure of mitochondrial biogenesis in 10 nM E2-treated MCF-7 cells. DNA was purified using the Wizard Genomic DNA Isolation Kit (Promega), and 1 ng total DNA was subjected to PCR for a 282-bp segment of the mtDNA (6115–6396) and a 150-bp segment of the 18S gene for 25 cycles. The products were resolved on a 2% agarose gel, and quantitation was performed as described previously (68).
Oxygen consumption was measured using 5 x 106 cells suspended in a total volume of 0.5 ml IMEM containing 5% DCC-FBS using a Strathkelvin Instruments Electrode. Rates of O2 consumption were calculated using 782 System version 3.0 (Strathkelvin Instruments, Glasgow, UK) from four to six replicates.
Statistics
Statistical analyses were performed using GraphPad Prism (San Diego, CA). Two-tailed Students t tests were used for the pair-wise comparison of experimental groups. Statistical significance was defined at
95% confidence interval or P
0.05. In each figure, asterisks indicate significantly different from EtOH (P < 0.05). Bar graphs represent the mean ± SEM for the number of independent experiments indicated in each figure legend.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Disclosure Statement: The authors have nothing to disclose.
First Published Online November 29, 2007
Abbreviations: ActD, Actinomycin D; ChIP, chromatin immunoprecipitation assay; COI, cytochrome c oxidase subunit I (complex IV, subunit I); COIV, cytochrome c oxidase subunit IV (complex IV, subunit IV); CHX, cycloheximide; CT, cycle threshold; DCC-FBS, dextran-coated charcoal stripped fetal bovine serum; DPN, diarylpropionitrile; E2, estradiol; ER, estrogen receptor; ERE, estrogen receptor element; ERKO, ER
knockout; EtOH, ethanol; IOD, integrated OD; IMEM, Iscoves MEM; MRC, mitochondrial respiratory chain; mtDNA, mitochondrial DNA; NDI, NADH dehydrogenase subunit I; NRF-1, nuclear respiratory factor 1; Ovx, ovariectomized; PDI, protein disulfide isomerase; PI3K, phosphoinositide-3 kinase; PPT, propyl pyrazole triol; QRT-PCR, quantitative real-time PCR; ROS, reactive oxygen species; R,R-THC, R,R-tetrahydrochrysene; siRNA, small interfering RNA; Tfam, mitochondrial transcription factor A; TFBs, mitochondrial transcription factor B types 1 and 2; WCE, whole-cell extracts.
Received for publication January 17, 2007. Accepted for publication November 16, 2007.
| REFERENCES |
|---|
|
|
|---|
and β. Endocrinology 138:863–870
and ERβ at AP1 sites. Science 277:1508–1510
and ERβ expressed in Chinese hamster ovary cells. Mol Endocrinol 13:307–319
knockout and wild-type mice. Am J Physiol Heart Circ Physiol 278:H1640–H1647
and ERβ in human MCF7 cells. Am J Physiol Endocrinol Metab 286:1011–1022[CrossRef]
-subunit in rat liver. FEBS Lett 514:309–314[CrossRef][Medline]
and β in human lung adenocarcinoma cells. Endocr Relat Cancer 13:113–134
is a ubiquitinated protein whose stability is affected differentially by agonists, antagonists, and selective estrogen receptor modulators. J Biol Chem 276:35684–35692
-selective agonists. J Med Chem 43:4934–4947[CrossRef][Medline]
or estrogen receptor-β. Endocrinology 140:800–804
and β mediate distinct pathways of vascular gene expression, including genes involved in mitochondrial electron transport and generation of reactive oxygen species. Mol Endocrinol 21:1281–1296
directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115:751–763[CrossRef][Medline]
in human breast cancer cells. Cancer Res 67:3955–3962
and β by coactivators and corepressors. J Mol Endocrinol 33:387–410
and β binding to DNA. Mol Cell Endocrinol 182:109–119[CrossRef][Medline]NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
N. S. Wickramasinghe, T. T. Manavalan, S. M. Dougherty, K. A. Riggs, Y. Li, and C. M. Klinge Estradiol downregulates miR-21 expression and increases miR-21 target gene expression in MCF-7 breast cancer cells Nucleic Acids Res., May 1, 2009; 37(8): 2584 - 2595. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |