| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Reproductive Biology Research (H.U., Y.-H.C., Z.L., S.R., P.Y., E.A., Q.X., G.I., S.T., E.T., J.J.K., S.E.B.), Department of Obstetrics and Gynecology, Feinberg School of Medicine at Northwestern University, Illinois 60611; and Departments of Pathology (T.S., H.S.) and Obstetrics and Gynecology (N.Y.), Tohoku University School of Medicine, 980-8574 Sendai, Japan
Address all correspondence and requests for reprints to: Serdar E. Bulun, Division of Reproductive Biology Research, Feinberg School of Medicine, Northwestern University, 303 Superior Street, Suite 4-123, Chicago, Illinois 60611. E-mail: s-bulun{at}northwestern.edu.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Biologically active estrogen, estradiol, is produced from cholesterol in a series of six enzymatic conversions (4). The two rate-limiting steps in this pathway include the entry of cholesterol into the mitochondrion, which is facilitated by steroidogenic acute regulatory protein (StAR), and the conversion of androstenedione to estrone by aromatase (4, 5). We and others previously demonstrated significantly higher mRNA levels and activities of StAR and aromatase in endometriotic tissue compared with eutopic endometrium (5, 6, 7). The introduction of aromatase inhibitors as potential therapy for endometriosis underscores the importance of aromatase and estrogen overproduction in the development of the disease (8, 9). Based on these observations, it is widely believed that aberrant StAR and aromatase expression accounts for the increase in local biosynthesis of estrogen that promotes the growth of endometriotic lesions.
Steroidogenic factor 1 (SF-1) belongs to the orphan nuclear receptor family and regulates the expression of many steroidogenic genes in the adrenals and gonads by binding to a nuclear receptor half-site in its target gene promoters (10, 11, 12). SF-1 is the key transcription factor that transactivates the promoters of both StAR and aromatase (13). In earlier studies, we reported aberrant SF-1 expression in endometriotic stromal cells compared with eutopic endometrial stromal cells (13). We have also shown previously that treatment of endometrial stromal cells with prostaglandin E2 (PGE2) increases StAR and aromatase expression and activity in endometriotic tissues (6). Conversely, PGE2 did not induce StAR or aromatase in eutopic endometrial tissues. Taken together, these data suggest that stimulation of SF-1 expression in endometriosis by PGE2 mediates increased estrogen formation via induction of the StAR and aromatase promoters.
The mechanism for SF-1 expression in endometriosis is not well understood. The SF-1 proximal promoter region (–110 bp 5'-flanking region) is highly conserved among many mammalian species and contains at least three cis-acting elements that are essential for its activity species (14, 15, 16, 17, 18, 19). The first element is an E-box, which is recognized by the transcription factors upstream stimulatory factor (USF) 1 and 2. These factors are thought to regulate many developmental processes, including muscle differentiation, neurogenesis, hematopoiesis, and sex determination (20, 21). The second element is a CCAAT box recognized by nuclear factors YA, YB, and YC species (14). The third is a GA-rich element, which binds the transcription factor Sp1 (14).
We hypothesized that aberrant SF-1 expression in endometriosis is regulated by changes in transactivation of specific cis-acting elements in the SF-1 proximal promoter region. Here, we identified the key promoter elements and transcription factors involved in SF-1 expression and suggest that the relative availability of these transcription factors regulates the differential expression of SF-1 in eutopic endometrium and endometriotic tissue. Our findings provide further insight into the molecular mechanisms underlying local estradiol production and the pathogenesis of endometriosis.
| RESULTS |
|---|
|
|
|---|
|
|
USF1/USF2/E-Box Binding Activity in Endometriotic and Endometrial Stromal Cells
We performed EMSA to demonstrate binding activities of USF1 and USF2 to the E-box motif. Protein/E-box complexes were detected in both endometriotic and eutopic endometrial stromal nuclear extracts, and these complexes could be competed with the addition of cold probe (Fig. 3
). Addition of USF1 and USF2 antibodies resulted in supershifted complexes using nuclear extracts from both endometriotic and endometrial stromal cells.
|
|
|
USFs mRNA and Protein Are Differentially Expressed in Eutopic Endometrial and Endometriotic Stromal Cells
Real-time RT-PCR and immunoblotting analyses were performed to characterize the expression patterns of USFs in eutopic endometrial and endometriotic stromal cells. As shown in Fig. 6
, A and B, both USF1 and USF2 were strongly expressed in endometriotic stromal cells, whereas USF2 expression was significantly lower in eutopic endometrial stromal cells. These results were reproducibly observed in three independent experiments.
|
|
| DISCUSSION |
|---|
|
|
|---|
We demonstrated that USF1 was expressed in stromal cells of both eutopic endometrium and endometriotic tissue, but USF2 was uniquely expressed in endometriotic stromal cells. In intact endometriotic stromal cells, USF1 binds to the SF-1 promoter, but its knockdown appears to have little effect on expression of SF-1 or the SF-1 target genes StAR and aromatase. On the other hand, USF2 binds to the SF-1 promoter more avidly, and its knockdown significantly reduces mRNA and protein levels of SF-1 and its target genes. These findings are suggestive that USF2 is essential for SF-1 expression in endometriosis and that its homodimers or heterodimers with USF1 may both stimulate SF-1 expression.
We should note that we observed a modest, but consistent, nonspecific stimulatory effect of control siRNA transfection on SF-1 and its target genes StAR and aromatase (Fig. 5
). Nonetheless, when USF-2 siRNA-transfected cells were compared with cells transfected with control siRNA or untransfected cells, we observed that knockdown of USF-2 strikingly and consistently reduced mRNA and/or protein levels of SF-1, StAR, and aromatase.
We recently showed that hypomethylation of SF-1 promoter in endometriosis may in part be responsible for SF-1 expression in endometriosis and its absence in endometrium (31). Methylation, however, does not account for the lack of SF-1 expression in endometrial cells because treatment of endometrial cells with a demethylating agent increased SF-1 expression to a level that represents a small fraction of what is observed in endometriotic cells (31). Neither did demethylation give rise to a significant level of SF-1, which could induce StAR or aromatase in PGE2-treated endometrial stromal cells (31). Thus, although hypomethylation of SF-1 promoter may contribute to its expression in endometriotic cells, this is not sufficient to explain its extremely high levels in endometriosis. The aberrant expression of USF2 in endometriotic cells may be a more important mechanism, because its knockdown effectively down-regulated SF-1 protein and SF-1-target genes that encode the key steroidogenic proteins StAR and aromatase.
Our in vivo findings represented in Figs. 4–8![]()
![]()
![]()
![]()
make the most important point in this manuscript. In vivo expression of USF2 and its binding to the SF-1 promoter in endometriotic stromal cells emerge as a key mechanism for aberrant SF-1 expression in this tissue. The aberrant overexpression of the nuclear receptor SF-1 in endometriosis is arguably the most striking abnormality because its mRNA levels are over 10,000-fold higher in primary endometriotic vs. endometrial cells, and more importantly, SF-1 target genes, e.g. StAR and aromatase, give rise to local estrogen production that makes this tissue independent of circulating estrogen levels. This pertains because postmenopausal endometriosis is dependent for growth on estrogen produced via local aromatase activity, and treatment with an aromatase inhibitor is the only current medical option for postmenopausal endometriosis (8, 32). As discussed above, hypomethylation of the SF-1 promoter in endometriosis accounted for a relatively small aspect of the overall in vivo mechanism indicative of the presence of other factors responsible for SF-1 expression in endometriotic stromal cells. We suggest that differential overexpression of USF2 in endometriosis vs. its normal counterpart endometrium is a key molecular abnormality for local steroidogenesis. This was verified by decreases in SF-1-target steroidogenic genes StAR and aromatase upon USF2 knockdown.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids and Site-Directed Mutagenesis
Three SF-1 promoter-luciferase reporter plasmids (–3200-, –2000-, and –100/+140-bp deletion series) using the pGL3 vector were kindly provided by Dr. Y. Sadovsky (Washington University, St. Louis, MO). Isolation of the mouse SF-1 genomic clone (strain 129Sv) has been reported (33), and construction of the SF-1 promoter-luciferase reporter plasmids was carried out as described previously (14). Constructs containing site mutations within the E-box, CCAAT box, and Sp-1 site were constructed using the QuikChange II site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturers instructions. E-box (–81/–76 bp), CCAAT box (–65/–58 bp), and Sp-1 site (–30/–25) sequences were changed as follows: E-box, 5'-GAGTCACGTGGGG-3' to 5'-GAGTCcatTGGGG-3'; CCAAT box, 5'-ACCAATTGGGCC-3' to 5'-ACCAATctGGCC-3'; and Sp-1 site, 5'-CGAGGGGAGGA –3' to 5'-CGAGGGagGGA-3'. Lowercase nucleotides indicate mutation sites and underlined nucleotides indicate the core element sequence. The mutations and the orientation of insert were confirmed by direct sequencing. Plasmids used in transfection experiments were purified using an EndoFree plasmid isolation kit (QIAGEN, Valencia, CA), and their purity was verified by spectrophotometry and agarose gel electrophoresis.
Cell Culture
Tissues (human eutopic endometrium and endometrial cysts) were cultured using a protocol previously reported by Ryan et al. (34) with minor modifications. The cells were studied at passages 3–5. Tissues were rinsed with sterile phosphate saline solution, minced finely, and digested with collagenase B (1 mg/ml) and deoxyribonuclease I (0.1 mg/ml) at 37 C for 1–2 h. Epithelial cells were separated from stromal cells by filtration through a 25-µm pore size sieve. Stromal cells were then suspended in DMEM/F-12 (GIBCO/BRL, Grand Island, NY) containing 10% fetal bovine serum, penicillin (100 U/ml), streptomycin (100 µg/ml), and amphotericin (250 ng/ml; growth medium). Fresh suspensions of stromal cells were plated in culture dishes and incubated at 5% CO2 and 37 C. Media was changed at 72-h intervals until the cells became 70–80% confluent. Confluent cells were serum deprived for 16 h in serum-free, phenol red-free DMEM/F-12 before being subjected to the following treatments: 1) serum-free, phenol red-free medium as the baseline control and 2) serum-free, phenol red-free medium with PGE2 (0.1 µM) (Sigma-Aldrich Corp., St. Louis, MO). Stromal cells were used in transient transfection and luciferase assays, ChIP assays, isolation of total RNA extracts for real-time RT-PCR, isolation of whole-cell protein extracts for immunoblotting, and isolation of nuclear extracts for EMSA.
Transient Transfection and Luciferase Assay
The day before transfection, cells were plated into six-well tissue culture plates at a density such that the cells reached 70–80% confluence by the time of transfection. Transfections were performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA), following the protocol provided by the manufacturer. Each transfection was performed using 2 µg firefly luciferase reporter construct containing serial deletion and site-directed mutants of the SF-1 promoter and 1 ng of an internal control Renilla luciferase reporter plasmid pRL-TK (Promega Corp., Madison, WI). Four hours after transfection, medium was removed by aspiration, DMEM/F-12 (2 ml) containing 10% fetal bovine serum was added, and the plates were returned to the incubator for 48 h. Then medium was removed, wells were rinsed with PBS to remove detached cells and residual growth medium, 250 µl 1x passive lysis buffer was added per well, and 20 µl of supernatant was separated for use in the dual-luciferase reporter assay system (Promega). Luciferase activities were determined using the Beckman Coulter LD400 luminometer (Beckman Coulter, Inc., Fullerton, CA). Firefly luciferase activities were normalized to Renilla luciferase activity in each well. These measurements were performed in triplicate and repeated in three independent experiments.
Isolation of Total RNA and Real-Time RT-PCR
Total RNA from eutopic endometrial and endometriotic stromal cells were isolated using TRI reagent (Sigma-Aldrich). Concentration and quality of total RNA were determined spectrophotometrically and by electrophoresis on denaturing formaldehyde-agarose gels.
Reverse-transcription reactions were carried out using Superscript III First-Strand Synthesis System for RT-PCR (Invitrogen), according to the manufacturers instructions. The expression levels of mRNA for USF1, USF2, and SF-1 were measured by real-time RT-PCR using a standard TaqMan PCR kit protocol on an Applied Biosystems 7900HT sequence detection system (Applied Biosystems, Foster City, CA). Primers and probes were obtained from the ABI TaqMan Gene Expression Assay catalog (USF1, Hs00273038_m1; USF2, Hs00231528_m1; SF-1, Hs00610436_m1; StAR, Hs00264912_m1; aromatase, Hs00903413]lowen-m1; and β-actin, Hs99999903_m1; Applied Biosystems). The probes contained a 6-carboxy-fluorescein phosphoramidite (FAM dye) label at the 5' end and a minor groove binder and nonfluorescent quencher at the 3' end and were designed to hybridize across exon junctions. For each sample, triplicates were run for each gene in a 384-well format plate. Template cDNA and TaqMan gene expression assays, which contain PCR primers and probes, were added to TaqMan Universal PCR Mastermix (Applied Biosystems) to a final volume of 20 µl. The reactions were incubated at 50 C for 2 min and 95 C for 10 min, followed by 40 cycles of 95 C for 15 sec and 60 C for 1 min. The threshold cycle (CT) is defined as the fractional cycle number at which the fluorescence passes the fixed threshold. TaqMan CT values were converted into absolute copy numbers. All RNA samples were normalized based on the TaqMan gene expression assays for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) endogenous control (Hs99999905_m1; Applied Biosystems).
Immunoblotting
Total protein was extracted from whole cells using M-PER mammalian protein extraction reagent (Pierce, Rockford, IL), following the protocol suggested by the manufacturer. Protein concentration was measured using a BCA protein assay kit (Pierce), according to the manufacturers instructions. The lysate (20 µg total protein) was mixed with 2x Laemmli sample buffer (Bio-Rad Laboratories, Hercules, CA) and fractionated on an SDS-PAGE gel (4% stacking gel, 10% resolving gel) at 40 mA for 1 h. Protein samples were then electroblotted to the PVDF-Plus transfer membrane (0.45 µm) (GE Osmonics Inc., Minnetonka, MN). The membranes were then incubated with antibodies directed against either USF1 (at 1:500 dilution), USF2 (1:500), or SF-1 (1:2000) (Santa Cruz Biotechnology, Santa Cruz, CA) in blocking buffer at 4 C overnight. Donkey antirabbit IgG horseradish peroxidase-linked F(ab')2 fragment (Amersham Pharmacia Biotech Inc., Piscataway, NJ) and goat antirabbit IgG horseradish peroxidase conjugate (Upstate Biotechnology, Waltham, MA) were used as secondary antibodies and were diluted in blocking buffer at 1:160,000 and 1:10,000, respectively. Proteins were detected using an ECL kit (Amersham) following the manufacturers protocol and exposed to BioMax ML x-ray film (Kodak, Rochester, NY) for less than 1 min. Band intensity was quantitated using the Molecular Analyst version 1.5 software (Bio-Rad).
ChIP Assay
The ChIP assay was performed with the acetyl-histone H4 immunoprecipitation (ChIP) assay kit (Upstate Biotechnology). A total of 2 x 107 stromal cells of eutopic endometrium and endometriosis were incubated in a final concentration of 1% formaldehyde for 10 min at 37 C to cross-link histones to DNA. The cells were sheared using Sonic Dismembrator model 100 (Fisher Scientific, Hampton, NH) at 70% maximal amplitude (15 sec on, 60 sec off) for four pulses to obtain DNA fragments in the range of 200-1000 bp. The sonicated cell supernatant was diluted 10-fold in ChIP dilution buffer, and 40 µl was used as input DNA (positive control). Precleared chromatin was used for immunoprecipitation reactions with a rabbit polyclonal antibody directed against human USF1 and USF2, normal rabbit IgG (Upstate Biotechnology), or no antibody (negative control). The reactions were incubated on a rotator overnight at 4 C. Chromatin complexes were precipitated with 80 µl salmon sperm DNA/protein agarose slurry for 30 min at 4 C, washed once in low-salt buffer, once in high-salt buffer, once in LiCl immune complex, and finally twice in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA. Precipitated complexes were removed from the beads by incubating for 30 min in 500 µl elution buffer (1% SDS, 0.1 M NaHCO3, and 10 mM dithiothreitol). The protein-DNA cross-links were reversed by heating samples at 65 C for 6 h. DNA was purified by phenol-chloroform extraction. Real-time PCR amplifications were performed under the following conditions: 40 cycles of 30 sec denaturation at 95 C and 30 sec annealing at 60 C. The primers used were SF-1 forward (–83/–64 bp), GAAGGCGAGAGGCCTGCAGA, and SF-1 reverse (49/–30 bp), CGGAGGCCCAATTGGTCTCT. All buffers used in this protocol contained a 1x protease inhibitor cocktail (Sigma-Aldrich).
EMSA
Nuclear protein was extracted from whole cells using NE-PER nuclear and cytoplasmic extraction reagents (Pierce), following the protocol suggested by the manufacturer. Protein concentration was measured with a BCA protein assay kit (Pierce), according to the manufacturers instructions. EMSA was performed using LightShift chemiluminescent EMSA kit (Pierce) following the protocol suggested by the manufacturer. Biotin end-labeled oligonucleotide probes (see below) were purchased from Sigma-Aldrich and annealed to the complementary oligonucleotides. Twenty femtomoles of labeled probe and 3 µg nuclear extract were incubated for 20 min at room temperature in a reaction mix (total volume, 20 µl) containing 5% (vol/vol) glycerol, 10 mM Tris-HCl, 50 mM NaCl, 1 mM MgCl2, 0.5 mM dithiothreitol, and 2 µg poly(dI-dC). For supershift experiments, 5 µg of antibodies were added, and the incubation was continued for an additional 40 min on ice. For DNA competition EMSA, 4 pmol unlabeled double-stranded oligonucleotide was added simultaneously with labeled probe. Nondenaturing polyacrylamide gels (5%) were pre-electrophoresed and used to resolve protein-DNA complexes with 0.5x Tris-borate-EDTA running buffer at 100 V for 1 h. Protein-DNA was transferred to Biodyne B precut modified nylon membrane (Pierce) at 380 mA for 30 min and cross-linked using a commercial UV-light cross-linker (UVP, Upland, CA). Protein-DNA complexes were detected using a LightShift chemiluminescent EMSA kit (Pierce) and exposed to CL-XPosure Film (Pierce) for less than 20 min.
We used the SF-1 probe 5'-CCTGCAGAGTCACGTGGGGGCAGAGA-3' that represented the –91/–66-bp regulatory region in the SF-1 gene promoter and contained E-box. The underlined nucleotides indicate the transcription factor binding domain (E-box).
siRNA
One day before transfection, endometriotic stromal cells were trypsinized, counted and plated in a six-well plate in growth medium to achieve 50%–60% confluence at the time of transfection. siRNA-Lipofectamine 2000 complexes were prepared as follows: 1 µl 100 µM USF1 siRNA, USF2 siRNA, or control siRNA oligonucleotide (P/N: USF1 121630, USF2 114348; Ambion, Inc., Austin, TX) was added to 249 µl Opti-MEM I reduced serum medium (Invitrogen) and incubated for 10 min. Ten microliters of Lipofectamine 2000 was combined with 240 µl of Opti-MEM, mixed gently and incubated 5 min at room temperature. The diluted oligonucleotides were combined with the diluted Lipofectamine 2000 (total volume, 500 µl), mixed gently, and incubated for 20 min at room temperature to allow siRNA-Lipofectamine 2000 complexes to form. The growth medium was removed, and the cells were washed once with medium without serum. siRNA-Lipofectamine 2000 complexes were added to each well. The cells were then maintained at 37 C in a CO2 incubator for 6 h. Growth medium containing twice the normal concentration of serum (500 µl) was then added to each dish without removing the transfection mixture. After culture for 24 h, the transfected cells were divided and prepared in either TRI reagent for RNA isolation and analysis in real-time RT-PCR or M-PER reagent for total protein isolation and immunoblot analysis.
Immunohistochemistry
Immunohistochemical analyses were performed with the streptavidin-biotin amplification method using a Histofine kit (Nichirei, Tokyo, Japan) for USF1 and USF2. The dilutions of the primary antibodies used in this study were 1:200. The antigen-antibody complexes were visualized with 3,3'-diaminobenzidine solution [1 mmol/liter 3,3'-diaminobenzidine, 50 mmol/liter Tris-HCl buffer (pH 7.6), and 0.006% H2O2] and counterstained with hematoxylin. Normal rabbit IgG was used instead of the primary antibodies for negative controls. Nonspecific immunoreactivity was detected in these tissue sections (not shown). For quantitative evaluation of USF1 and USF2 expression, we determined the labeling index (the percentage of positive cells) according to the report by Sasano et al. (35).
Statistical Analysis
Statistical analysis was performed by Welchs t test using the StatView 5.0 statistical software package (SAS Institute, Cary, NC). P < 0.05 was considered as significant. All values are given as the mean ± SEM.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Disclosure Statement: S.E.B. consulted for Serono and Novartis. He also received lectures fees from Serono. The remaining authors have nothing to disclose.
First Published Online December 28, 2007
Abbreviations: ChIP, Chromatin immunoprecipitation; nt, nucleotides; PGE2, prostaglandin E2; SF-1, steroidogenic factor-1; siRNA, small interfering RNA; StAR, steroidogenic acute regulatory protein; USF, upstream stimulatory factor.
Received for publication July 24, 2006. Accepted for publication December 20, 2007.
| REFERENCES |
|---|
|
|
|---|
NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
M Pino, C Galleguillos, M Torres, H Sovino, A Fuentes, M A Boric, and M C Johnson Association between MMP1 and MMP9 activities and ICAM1 cleavage induced by tumor necrosis factor in stromal cell cultures from eutopic endometria of women with endometriosis Reproduction, November 1, 2009; 138(5): 837 - 847. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Kim, F. M. Barlaskar, J. H. Heaton, T. Else, V. R. Kelly, K. T. Krill, J. O. Scheys, D. P. Simon, A. Trovato, W.-H. Yang, et al. In Search of Adrenocortical Stem and Progenitor Cells Endocr. Rev., May 1, 2009; 30(3): 241 - 263. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yamagata, H. Asada, I. Tamura, L. Lee, R. Maekawa, K. Taniguchi, T. Taketani, A. Matsuoka, H. Tamura, and N. Sugino DNA methyltransferase expression in the human endometrium: down-regulation by progesterone and estrogen Hum. Reprod., May 1, 2009; 24(5): 1126 - 1132. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Attar, H. Tokunaga, G. Imir, M. B. Yilmaz, D. Redwine, M. Putman, B. Gurates, R. Attar, N. Yaegashi, D. B. Hales, et al. Prostaglandin E2 Via Steroidogenic Factor-1 Coordinately Regulates Transcription of Steroidogenic Genes Necessary for Estrogen Synthesis in Endometriosis J. Clin. Endocrinol. Metab., February 1, 2009; 94(2): 623 - 631. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Bulun Endometriosis N. Engl. J. Med., January 15, 2009; 360(3): 268 - 279. [Full Text] [PDF] |
||||
![]() |
S. A. Salama, M. W. Kamel, C. R. Diaz-Arrastia, X. Xu, T. D. Veenstra, S. Salih, S. K. Botting, and R. Kumar Effect of Tumor Necrosis Factor-{alpha} on Estrogen Metabolism and Endometrial Cells: Potential Physiological and Pathological Relevance J. Clin. Endocrinol. Metab., January 1, 2009; 94(1): 285 - 293. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Aghajanova, A. Hamilton, J. Kwintkiewicz, K.C. Vo, and L.C. Giudice Steroidogenic Enzyme and Key Decidualization Marker Dysregulation in Endometrial Stromal Cells from Women with Versus Without Endometriosis Biol Reprod, January 1, 2009; 80(1): 105 - 114. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Hoivik, L. Aumo, R. Aesoy, H. Lillefosse, A. E. Lewis, R. M. Perrett, N. R. Stallings, N. A. Hanley, and M. Bakke Deoxyribonucleic Acid Methylation Controls Cell Type-Specific Expression of Steroidogenic Factor 1 Endocrinology, November 1, 2008; 149(11): 5599 - 5609. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Bukulmez, D. B. Hardy, B. R. Carr, R. J. Auchus, T. Toloubeydokhti, R. A. Word, and C. R. Mendelson Androstenedione Up-Regulation of Endometrial Aromatase Expression via Local Conversion to Estrogen: Potential Relevance to the Pathogenesis of Endometriosis J. Clin. Endocrinol. Metab., September 1, 2008; 93(9): 3471 - 3477. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Barbieri Update in Female Reproduction: A Life-Cycle Approach J. Clin. Endocrinol. Metab., July 1, 2008; 93(7): 2439 - 2446. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |