help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2008-0059
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Madak-Erdogan, Z.
Right arrow Articles by Katzenellenbogen, B. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Madak-Erdogan, Z.
Right arrow Articles by Katzenellenbogen, B. S.
Molecular Endocrinology 22 (9): 2116-2127
Copyright © 2008 by The Endocrine Society

Nuclear and Extranuclear Pathway Inputs in the Regulation of Global Gene Expression by Estrogen Receptors

Zeynep Madak-Erdogan, Karen J. Kieser, Sung Hoon Kim, Barry Komm, John A. Katzenellenbogen and Benita S. Katzenellenbogen

Department of Cell and Developmental Biology (Z.M.-E., B.S.K.), Department of Chemistry (K.J.K., S.H.K., J.A.K.), and Department of Molecular and Integrative Physiology (K.J.K., B.S.K.), University of Illinois, Urbana, Illinois 61801; and Women’s Health and Musculoskeletal Biology (B.K.), Wyeth Research, Collegeville, Pennsylvania 19426

Address all correspondence and requests for reprints to: Dr. Benita S. Katzenellenbogen, University of Illinois, Department of Molecular and Integrative Physiology, 524 Burrill Hall, 407 South Goodwin Avenue, Urbana, Illinois 61801-3704. E-mail: katzenel{at}uiuc.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Whereas estrogens exert their effects by binding to nuclear estrogen receptors (ERs) and directly altering target gene transcription, they can also initiate extranuclear signaling through activation of kinase cascades. We have investigated the impact of estrogen-mediated extranuclear-initiated pathways on global gene expression by using estrogen-dendrimer conjugates (EDCs), which because of their charge and size remain outside the nucleus and can only initiate extranuclear signaling. Genome-wide cDNA microarray analysis of MCF-7 breast cancer cells identified a subset of 17β-estradiol (E2)-regulated genes (~25%) as EDC responsive. The EDC and E2-elicited increases in gene expression were due to increases in gene transcription, as observed in nuclear run-on assays and RNA polymerase II recruitment and phosphorylation. Treatment with antiestrogen or ER{alpha} knockdown using small interfering RNA abolished EDC-mediated gene stimulation, whereas GPR30 knockdown or treatment with a GPR30-selective ligand was without effect, indicating ER as the mediator of these gene regulations. Inhibitors of MAPK kinase and c-Src suppressed both E2 and EDC stimulated gene expression. Of note, in chromatin immunoprecipitation assays, EDC was unable to recruit ER{alpha} to estrogen-responsive regions of regulated genes, whereas ER{alpha} recruitment by E2 was very effective. These findings suggest that other transcription factors or kinases that are downstream effectors of EDC-initiated extranuclear signaling cascades are recruited to regulatory regions of EDC-responsive genes in order to elicit gene stimulation. This study thus highlights the importance of inputs from both nuclear and extranuclear ER signaling pathways in regulating patterns of gene expression in breast cancer cells.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
ESTROGENIC HORMONES are important for the regulation of many physiological processes in both reproductive and nonreproductive tissues, and they impact the phenotypic properties of cancers, such as breast cancer, that develop in these tissues. These effects are exerted by binding of estrogens to their receptors [estrogen receptors (ER{alpha} and ERβ)], which are members of the nuclear receptor superfamily of ligand-activated transcription factors (1, 2, 3). Although ERs have long been considered to be nuclear-localized proteins, recent studies have revealed a small population of extranuclear ERs. These extranuclear receptors have been shown to play important roles in certain rapid signaling events, such as intracellular calcium mobilization, nitric oxide synthesis, and activation of various kinases (4, 5). We have only an incomplete understanding, however, of the cross talk between nuclear and extranuclear ERs in mediating the actions of estrogen in regulation of gene expression. Hence, our aim in this study was to examine the impact of extranuclear-initiated estrogen action on gene expression regulation in breast cancer cells.

Based on current thinking, the regulation by 17β-estradiol (E2) of gene expression likely involves both genomic and nongenomic signaling (1, 2, 3, 4, 5). The former, for which there is much evidence, involves direct action of nuclear-localized ER in its function as a ligand-regulated transcription factor or coregulator. By contrast, nongenomic signaling involves extranuclear events mediated by ER or other estrogen binders; these can impact gene expression in the nucleus indirectly, by activation through posttranslational modifications of other transcription or chromatin-modifying factors, or even of ER and its coregulatory partners. This implies that the regulation of gene expression by estrogen has both genomic and nongenomic inputs, and that the balance of these inputs may vary in a cell- and gene-specific manner.

To dissect the nuclear/genomic vs. extranuclear/nongenomic actions of estrogen in the regulation of gene expression, we have used estrogen-dendrimer conjugates (EDCs), which because of their charge and size, remain outside the nucleus. These large, abiotic, nondegradable polyamidoamine dendrimer macromolecules, which are conjugated to multiple estrogen molecules through chemically robust linkages, are capable of activating only extranuclear pathways (6). By comparing the actions of EDC and E2 in genome-wide gene regulation, we show in this report that extranuclear-initiated pathways of estrogen action can alter the transcription of a portion of estrogen target genes, and that they do so in a mechanistically distinct manner that does not result in the recruitment of ER to ER binding sites of target genes. Moreover, we provide evidence that extranuclear estrogen-initiated gene regulation is blocked by some kinase inhibitors and by antiestrogens or knockdown of ER, implying the requirement for ER and certain protein kinases in both nuclear-initiated and extranuclear-initiated gene regulations.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
EDCs Regulate the Expression of a Subset of Estrogen Target Genes in MCF-7 Cells
Extranuclear signaling by estrogen has been shown to activate signaling pathway components, including kinases, by processes that do not involve gene transcription, but little attention has been focused on the effect of estrogen-regulated extranuclear pathways on gene expression. As shown in Fig. 1Go, we investigated the impact of estrogen-mediated extranuclear initiated pathways on global gene expression in MCF-7 breast cancer cells by using an EDC. MCF-7 cells were treated with vehicle control, E2, EDC, or empty dendrimer control, and cDNA microarray analyses were carried out using Affymetrix HG-U133A GeneChips. We used multivariate analysis (LIMMA), which assigns statistical significance to contrasts and controls for multiple testing, to find genes that are differentially regulated by each ligand (Fig. 1AGo). In this manner, we identified a subset of E2-regulated genes that were also EDC responsive (Fig. 1Go, B and C). As shown in the Venn diagram (Fig. 1CGo), 1036 genes were up- or down-regulated by E2 at 4 h, 243 genes were regulated by both E2 and EDC, and 92 genes were classified as being regulated by EDC only. Thus, the genes commonly regulated by E2 and EDC represent 23% of the total E2-regulated genes.


Figure 1
View larger version (30K):
[in this window]
[in a new window]

 
Fig. 1. cDNA Microarray Analysis of Genes Regulated by E2 and EDC

A, Experimental design. MCF-7 cells were treated with vehicle, 10 nM E2, empty dendrimer, or 10 nM E2 equivalent EDC for 4 h. RNA was then hybridized to Affymetrix Hu-U133 GeneChips, and analysis was performed as described in Materials and Methods. B, Cluster diagram of EDC- and E2-regulated genes. C, Venn diagram showing the distribution of genes regulated by E2 only, commonly regulated by E2 and EDC, or regulated by EDC only, and their characterization in functional categories according to GeneSpring and ErmineJ softwares and web-based DAVID functional annotation tool. Ctrl, Control; Dend, empty dendrimer; Veh, vehicle.

 
Functional classification of the gene regulations, using the functional annotation tools DAVID (http:// david.abcc.ncifcrf.gov/), Gene Spring, and ErmineJ all agreed in showing that genes regulated only by E2 encoded mostly transcription factors, growth factors, and mitosis-related genes (Fig. 1CGo; Venn diagram, left), which is consistent with our previous study in which we found that EDC did not stimulate the proliferation of MCF-7 cells (6). Interestingly, genes regulated by both E2 and EDC (commonly regulated genes; Venn diagram, middle) included many genes involved in RNA metabolism and the cytoskeleton. Genes regulated by EDC only were enriched in those associated with RNA metabolism.

Recent reports using chromatin immunoprecipitation (ChIP)-on-chip (7, 8) and ChIP-paired end tag cloning approaches (9, 10) have determined the location of ER{alpha} binding sites in MCF-7 cells. Of the 793 genes that we identified by cDNA microarray as regulated by E2 only, 373 (~47%) of the genes had ER{alpha} binding sites in a window of 100 kb upstream or downstream of the transcriptional start site (TSS). For E2 and EDC commonly regulated genes, 90 of 243 genes (~37%) had ER{alpha} binding sites, and for EDC-only genes, 39 of the 92 genes (~42%) had ER{alpha} binding sites within 100 kb of the gene TSS.

Regarding the 92 genes categorized as being regulated only by EDC, we found that the level of regulation of these genes was low and close to the cutoff used to determine regulation. We further examined 15 genes in this category by quantitative PCR (Q-PCR) and confirmed that all of them were stimulated by both EDC and E2, but slightly more by EDC. Hence, these appear to be genes that are preferentially regulated by EDC. This group of genes is considered further in the Discussion.

Analysis of the Expression of Target Genes Regulated by EDC and Estradiol
To examine gene expression regulation by EDC vs. E2 in detail, we selected several genes that were highly regulated by both E2 and EDC in our cDNA microarray data sets [leucine-rich repeat containing 54 (LRRC54), heat shock protein (HSP)B8, and PMA-induced protein 1 (PMAIP1); Fig. 1BGo]. These genes encode proteins having different cell functions. LRRC54 is a bone morphogenetic protein (BMP) inhibitor shown to inhibit BMP-2/4 action upon direct binding to BMPs and chordin proteins (11). HSPB8 is a small heat shock protein that appears to play important roles in cardiac hypertrophy, cell cycle regulation, apoptosis, and breast carcinogenesis (12, 13). PMAIP1/NOXA is a proapoptotic protein that mediates p53-induced apoptosis together with PUMA, p21, and MDM2 (14). Progesterone receptor (PgR) and pS2, which are stimulated by E2 but not EDC at the concentration used for microarray analysis (10–8 M), were included for comparison as E2-only regulated genes.

In time course experiments, we observed a similar profile of mRNA stimulation by E2 and EDC for the three genes, LRRC54, HSPB8, and PMAIP1, with maximum RNA levels generally being reached by 4 h (Fig. 2Go). By contrast, pS2 and PgR mRNA levels were up-regulated by E2 but not by EDC. Empty (unconjugated) dendrimer (data not shown) elicited no change in expression of any of these genes.


Figure 2
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 2. Time Course of Regulation of Gene Expression by E2 or EDC

MCF-7 cells were treated with 0.1% EtOH vehicle, 10 nM E2 (solid line), empty dendrimer or 10 nM estrogen equivalent EDC (dotted line) for 2, 4, and 8 h, and mRNA levels were monitored by Q-PCR. mRNA levels were normalized relative to 36B4, and fold change was calculated relative to control. Results are the average ± SD of at least three independent experiments.

 
Both E2 and EDC Transcriptionally Increase Expression of the Commonly Regulated Genes
Because changes in mRNA levels for genes could reflect either altered rates of gene transcription and/or changes in mRNA stability, we undertook several experiments to determine whether changes in expression of the E2 and EDC commonly regulated genes represented primary responses, and whether the increases in mRNA reflected increases in gene transcription or changes in mRNA half-life. Moreover, in our functional gene category overrepresentation analyses, RNA metabolism-related genes were one of the highest scoring groups for genes that were regulated by both E2 and EDC.

As shown in Fig. 3AGo, treatment with the protein synthesis inhibitor cycloheximide did not prevent E2- or EDC-stimulated expression of these genes, which suggests that the five selected genes are primary response genes. We also carried out nuclear run-on experiments in which nuclei were isolated from cells treated with E2 or EDC, and the incorporation of labeled nucleotides into RNA was assessed. As shown in Fig. 3BGo, we observed that both E2 and EDC increased transcription rates for the three commonly regulated genes (Fig. 3BGo, left three panels), whereas only E2 increased transcription of the PgR or pS2 genes (Fig. 3BGo, right two panels).


Figure 3
View larger version (34K):
[in this window]
[in a new window]

 
Fig. 3. EDC and E2 Increase Gene Expression by Increasing Gene Transcription and Not Altering mRNA Stability

A, MCF-7 cells were pretreated with 10 µg/ml cycloheximide for 2 h to stop protein translation and were then treated with 10 nM E2 or 10 nM E2 equivalent EDC for 4 h in the continued presence of cycloheximide. Total RNA was isolated and reverse transcribed. Q-PCR was performed. B, Nuclear run-on assays were performed on nuclei isolated from MCF-7 cells after treatment with 0.1% ethanol vehicle, 10 nM E2, empty dendrimer (Dend), or 10 nM E2 equivalent EDC for 2 h. Fold change in transcription is shown. C, MCF-7 cells were treated with 5 µg/ml actinomycin D in the presence or absence of 10 nM E2 or 10 nM E2 equivalent EDC for 2 or 4 h. Total RNA was isolated and reverse transcribed. Q-PCR was performed. D, MCF-7 cells were treated with 10 nM E2 or 10 nM E2 equivalent EDC for 15 min, 1 h, and 2 h. Total Pol II/DNA complexes or phosphor-Ser5-Pol II/DNA complexes were immunoprecipitated overnight using specific anti-Total Pol II antibody, anti-phospho-Ser5_Pol II (CTD4H8), or rabbit IgG (Santa Cruz) as negative control. Immunoprecipitated DNA levels were measured by Q-PCR, and percent input was calculated. Values are the mean ± SD of at least three independent experiments. CHX, Cycloheximide; Pol II, polymerase II; Veh, vehicle.

 
Next, to determine whether E2 or EDC altered the stabilities of these mRNAs, cells were cotreated with the transcription inhibitor, actinomycin D, and with E2 or EDC, and changes in mRNA levels were monitored over time. Neither E2 nor EDC altered the mRNA half-life for the three commonly regulated genes tested, which suggests that E2 and EDC do not alter the stability of these mRNAs (Fig. 3CGo). As another indicator of gene transcription, we used ChIP assays to monitor recruitment of RNA polymerase II (RNA Pol II) to the TSS of the genes of interest. These ChIP studies (Fig. 3DGo) show that E2 and EDC treatment both resulted in enhanced recruitment of total RNA Pol II and of phosphor-Ser5-Pol II at the three commonly regulated genes (LRRC54, HSPB8, and PMAIP1; Fig. 3DGo, left three panels). By contrast, only E2 increased total RNA Pol II and phosphor-Ser5-RNA Pol II recruitment at the PgR and pS2 genes (Fig. 3DGo, right two panels). All of the data in Fig. 3Go suggest that E2 and EDC up-regulate gene expression by enhancing transcription of these genes, without requiring new protein synthesis or affecting mRNA stability.

ER{alpha} Mediates the Actions of EDC and E2 on the Regulation of Gene Expression
Because recent studies have indicated that an extranuclear form of ER{alpha} and/or the G protein GPR30 could be responsible for the nongenomic actions of E2 (4, 15), we used several approaches to examine the involvement of these two proteins in the regulation of gene expression by E2 and EDC. We first used the ER{alpha} antagonist ICI182,780, which we found to completely abrogate EDC- and E2-induced gene regulations (Fig. 4AGo). ER{alpha} knockdown (which reduced ER protein to ~20% of control level; see inset of Fig. 4BGo, right) also greatly reduced E2- and EDC-induced gene stimulations (Fig. 4BGo). We also examined the effect of a GPR30 agonist ligand, G1, which was previously shown to bind to GPR30 but not ER (16). G1 did not alter E2- or EDC-stimulated expression of these genes (Fig. 4CGo) or affect expression of any of the genes when tested alone at a range of G1 concentrations (1–500 nM) (Fig. 4DGo). We also carried out small interfering RNA (siRNA) knockdown of GPR30 and found that its knockdown did not affect gene stimulation by either EDC or E2 (data not shown). Our findings imply that ER{alpha}, not GPR30, is responsible for the regulation of gene expression by EDC and E2.


Figure 4
View larger version (31K):
[in this window]
[in a new window]

 
Fig. 4. ER{alpha} Is the Mediator for EDC Regulation of Gene Expression

A, MCF-7 cells were pretreated with 1 µM ICI182780 for 2 h and then treated with 10 nM E2 or 10 nM E2 equivalent EDC for 4 h. B, MCF-7 cells were transfected with control GL3 siRNA or ER{alpha} siRNA for 48 h and then treated with 10 nM E2 or 10 nM E2 equivalent EDC for 4 h. Western blot inset in panel B right shows the extent of ER knockdown with siRNA to be about 80%. C, MCF-7 cells were cotreated with 10 nM G1 (GPR30 agonist ligand) during 10 nM E2 or 10 nM E2 equivalent EDC treatment. D, MCF-7 cells were treated with the indicated concentrations of G1 ligand for 4 h. Total RNA was isolated, reverse transcribed, and analyzed by Q-PCR. Values are the mean ± SD of at least three independent experiments. Ctrl, Control; siER{alpha}, small interfering siER{alpha}; siGL3, control siRNA.

 
Inhibiting MAPK Kinase (MEK) and c-Src Kinase Activity Impairs EDC-Induced Gene Expression
In our previous studies we showed that E2 and EDC rapidly activated p42/44-MAPK and c-Src kinase (6). Furthermore, we have found that E2 and EDC treatment increased activated p38-MAPK and stress-activated protein kinase/c-Jun N-terminal kinase (JNK)-MAPKs in MCF-7 cells (Madak-Erdogan, Z., and B. S. Katzenellenbogen, unpublished results). We therefore investigated whether activation of these kinase pathways is important for EDC- or E2-mediated gene stimulations by using small molecule inhibitors for each kinase. MCF-7 cells were treated with either the MEK inhibitor PD98059, c-Src inhibitor PP2, p38 MAPK inhibitor SB203580, or JNK inhibitor SP600125 in the presence of EDC or E2, and effects on gene expression were determined (Fig. 5Go). On the three genes regulated by EDC (all except pS2 and PgR), EDC-stimulated gene expression was significantly dampened by PP2 or PD98059. E2-induced gene expression was also reduced by treatment with PP2 on all except the PgR gene, and PD98059 also decreased all gene stimulations by E2. These data imply that both E2 and EDC utilize c-Src and/or MAPK pathways as part of the stimulatory inputs that control the induction of these genes. By contrast, we saw no impact of inhibitors of JNK or p38 MAPK on these gene regulations by E2 or EDC (data not shown).


Figure 5
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 5. Inhibitors of c-Src Kinase or MEK Dampen E2- and EDC-Induced Gene Regulation

MCF-7 cells were pretreated with 1 µM PP2 or 50 µM PD98059 for 2 h and then treated with control vehicle, 10 nM E2, empty dendrimer, or 10 nM E2 equivalent EDC for 4 h. Total RNA was isolated and reverse transcribed. Q-PCR was performed. ***, P < 0.001; or **, P < 0.01; or *, P < 0.05, significantly up-regulated by E2 or EDC over control. #, P < 0.05; or ##, P < 0.01; significantly different from no inhibitor control. Values are the mean ± SD of three or more independent experiments. Veh, Vehicle.

 
EDC Is Ineffective in Recruiting ER{alpha} to Putative Estrogen-Responsive Regions of Target Genes
Because ER{alpha} is known to be recruited to ER binding sites of regulated genes upon exposure to E2, we performed ChIP assays to assess whether ER{alpha} is recruited to the putative regulatory regions of the selected genes upon EDC or E2 treatment of cells. We used ER binding sites for our genes of interest, based on sites reported in Refs. 8 and 10 (Fig. 6Go). ER_7120 is 10 kb upstream of the LRRC54 TSS. The HSPB8 gene has a strong ER binding site (MOPET11) 7.5 kb upstream of the HSPB8 TSS (10). ER_7204 is about 5 kb downstream of the PgR 3'-untranslated region, and ER_10218 is about 300 bp upstream of the pS2 TSS. (PMAIP1 is not shown because no ER binding site is known for this gene.)


Figure 6
View larger version (23K):
[in this window]
[in a new window]

 
Fig. 6. EDC Is Ineffective in Recruiting ER{alpha} to ER Binding Sites of Estrogen Target Genes whereas E2 Elicits a Robust ER{alpha} Recruitment

A, Schematic showing the location of ER{alpha} binding sites for selected genes. B, MCF-7 cells were treated with 10 nM E2 or 10 nM E2 equivalent EDC for 45 min, 2 h, and 3 h. ER{alpha}/DNA complexes were immunoprecipitated using specific ER{alpha} antibody or rabbit IgG as a negative control. Immunoprecipitated DNA levels were measured by Q-PCR, and percent input was calculated. Values are the mean ± SD of three independent experiments. 3'-UTR, 3'-untranslated region, MOPET, maximum overlap paired end tag.

 
Upon E2 treatment, ER{alpha} was found to be highly recruited to the responsive regions of all of the selected genes after 45 min, and then ER{alpha} recruitment decreased after 2 and 3 h of E2 treatment, except for the PgR gene, where significant ER presence at the ER binding site was still observed at the later times (Fig. 6Go). By contrast, EDC did not increase ER{alpha} recruitment to the regulatory regions of any of these genes.

These results indicate that EDC is not effective in recruiting ER{alpha} to responsive regions of the EDC-regulated genes, even though EDC affects the transcription of these genes. This suggests that estrogen action through the extranuclear-initiated pathway may be regulating these genes through transcription factors other than ER. As expected, we did not see any ER{alpha} recruitment by EDC to the estrogen-responsive region of the pS2 or PgR genes, which are well-known direct genomic targets of ER{alpha}, whereas E2 gave robust ER recruitment and stimulation of gene expression.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
There is increasing evidence that estrogens utilize extranuclear as well as nuclear signaling in target cells. Extranuclear signaling has been shown to activate important signaling pathway components, including various protein kinases (e.g. c-Src, phosphatidylinositol-3 kinase, MAPK, etc.), that result in Ca2+ mobilization from the endoplasmic reticulum, rearrangement of the cytoskeleton, and induction of nitric oxide production, with specific activations dependent on the nature of the target cell (4, 5).

Our findings document that estrogen action initiated outside of the nucleus, which can be achieved selectively by EDC treatment, stimulates the transcription and expression of a significant portion (~25%) of the total number of estrogen-regulated genes. This extranuclear-initiated gene regulation by EDC requires ER, but, intriguingly, it seems to occur without direct ER recruitment to the putative ER binding sites of these regulated genes. By contrast, E2 stimulation of these genes is associated with a very robust recruitment of ER to these ER binding sites. Whereas it is possible that EDC might be promoting a less stable binding of ER to the ER binding sites so that they might not be detectable by ChIP assays or that extranuclear action of EDC might promote the binding of ER to sites other than those to which it is recruited when occupied by E2, we believe that it is most likely that EDC regulation of these genes, which does require ER, involves transcription factors other than ER directly binding to chromatin in the nucleus. Future experiments will be needed to distinguish among these possibilities.

Our findings also indicate that protein kinases are involved in gene regulations by both so-called genomic (nuclear-initiated) and nongenomic (extranuclear-initiated) pathways. Hence, we found that in MCF-7 cells, inhibition of the kinases c-Src and/or MEK suppressed the expression of genes up-regulated by both E2 and EDC (LRRC54, HSPB8, and PMAIP1), as well as genes regulated by E2 only (PgR and pS2). This is perhaps to be expected, because the input of extranuclear signaling pathways on elements of the estrogen-regulated nuclear pathway is well established, because phosphorylation state is known to markedly affect the activity and functional properties of ER itself (17, 18), ER coregulator protein partners (19), many other DNA-binding transcription factors, RNA Pol II, histones, and other chromatin-associated proteins (20). Of note, regulation of the genes we investigated was affected only by certain kinases, c-Src and MEK in particular, because we found inhibitors of JNK and p38 MAPK to be without effect. The importance of different kinases is likely to be cell dependent, because different cells possess different complements of various kinases and phosphatases. We also observed some differences in efficacies of various kinase inhibitors in suppression of different genes. In our studies, PD98059 was a generally more complete inhibitor than was PP2, implying the importance of the MAPK pathway in MCF-7 cells. Several publications have shown a rapid activation of MAPK signaling in impacting various aspects of MCF-7 cell functioning (4, 21, 22). Hence, our findings imply that kinase pathways provide important inputs for regulation of both nuclear and extranuclear gene stimulations, and that one cannot assign kinase activity uniquely to nuclear or extranuclear-initiated pathways. Indeed, the observation that MEKK1 colocalizes with progesterone receptor at progesterone receptor binding sites of the mouse mammary tumor virus promoter (23) suggests extensive interrelationships between hormone-regulated transcription factors and protein kinases in regulation of gene expression.

We explored the possibility that the c-Src and MEK inhibitors might suppress transcriptional gene activity by blocking the recruitment of RNA pol II or ER{alpha} to the regulated genes. However, we found that treatment of cells with these inhibitors had little if any impact on the recruitment of RNA pol II to the transcription start site of the gene or of ER{alpha} to the ER binding site, implying that the block in gene regulation is not at the level of ER or pol II recruitment. It is quite possible that these inhibitors might be affecting the state of phosphorylation and activity of other important components of transcription complexes, such as coregulators or mediator components. For example, a recent report has shown that estrogen stimulates ERK phosphorylation of MED1/thyroid hormone receptor-associated protein 220/vitamin D receptor interacting protein 205, a step required for its association with the mediator complex and for its nuclear receptor coactivator activity (24). Likewise, estrogen-regulated MAPK phosphorylation of steroid receptor coactivator 3 regulates its association with ER{alpha} and thereby ER transcriptional activity (25). Moreover, in different systems, MAPK signaling has been shown to activate other kinases, such as MSK1 and RSK2 that would phosphorylate histones and alter the chromatin environment (20). Hence, the suppressive effects of protein kinase inhibitors that we have observed might arise from alterations in the state of phosphorylation of a number of key components of the active transcription complex.

In our classification of E2- and/or EDC-regulated genes, we identified some genes that were regulated preferentially by EDC. Whereas it might be unexpected that genes would be preferentially regulated by EDC compared with E2, it is possible that on these genes the genomic component of E2 action opposes (down-regulates) the stimulating effect of the nongenomic component, so that the combined genomic plus nongenomic output by E2 would be less than that from the nongenomic component stimulated by EDC. Further analysis of such a mechanism would require use of either an agonist agent that would only stimulate the genomic component or the use of an antagonist agent that would block the nongenomic component of E2 action without affecting the genomic component.

Recent studies have also highlighted that ER or other E2 binding proteins (GPR30) located in or close to the cell membrane can initiate signaling cascades from growth factor receptor tyrosine kinases [i.e. epidermal growth factor receptor and HER2/neu], or interact with key signal transduction adaptors and kinases such as Shc, phosphatidylinositol-3 kinase, and c-Src (15, 22, 26, 27, 28). Our findings indicate that ER is the mediator of the extranuclear regulated gene expression we have investigated. This is supported both by use of the antiestrogen ICI 182,780 and by knockdown of ER, which greatly reduced gene regulations by EDC. There are several reports addressing the role of GPR30, a G protein-coupled receptor, which has been proposed by some to be the nonclassical E2 receptor and the effector of some extranuclear signaling induced by estrogen. Upon E2 treatment, GPR30 was reported to stimulate cAMP-dependent signaling, which attenuated the MAPK pathway induced by epidermal growth factor receptor (15, 27). However, Ca2+ mobilization and MAPK activation upon E2 treatment were greatly impaired in endothelial cells from ER{alpha}/ERβ double knockout mice (22). Although the nature of the estrogen binding protein, whether ER and/or GPR30 or other, may depend on the target cell and responses being monitored, our findings are supportive of those of Pedram et al. (22), who also found ER to be the mediator of extranuclear signaling in MCF-7 cells.

One of our most interesting observations is that EDC and E2 both increased gene transcription, but that only gene transcription induced by E2 was accompanied by the recruitment of ER to putative ER binding sites of the regulated genes. We selected ER binding sites to be examined based on datasets from Carroll et al. (8) and Lin et al. (10) in which these high-affinity ER binding sites were identified. In addition, in a genome-wide study which has used ChIA-PET (whole-genome chromatin interaction analysis using paired-end di-tagging) methodology, the ER{alpha} binding sites we examined in the LRRC54 and HSPB8 genes were found to interact through looping events with another site in the coding sequence (LRRC54) or with the transcription start site (HSPB8), suggesting that these are true ER{alpha} binding sites associated with the LRRC54 and HSPB8 genes, and not other genes (Cheung, E., Y. Ruan, and E. T. Liu, personal communication; manuscript submitted). Our findings are consistent with the hypothesis that EDC may elicit these gene up-regulations by activation of other transcription factors, perhaps involving phosphorylations that proceed through extranuclear-initiated signaling cascades. The suppression of gene stimulation by some protein kinase inhibitors would be in keeping with such a mechanism. Future investigations will be focused on the identification of the transcription factors or kinases that are involved in mediating gene regulation through these ER-dependent extranuclear pathways. Our current study highlights the importance of integration of nuclear and extranuclear ER signaling inputs activated by estrogens in regulating patterns of gene expression in breast cancer cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Compounds and Materials
The EDC was prepared as previously described (6). Because the EDC contains 20 molecules of estrogen per dendrimer, we state EDC concentration in terms of E2 equivalents. One EDC equals 20 E2 molecules; therefore 0.5 nM EDC provides 10 nM E2 (6). In all experiments, E2 and EDC were used at equivalent estrogen concentrations. E2, cycloheximide, and actinomycin D were from Sigma Chemical Co. (St. Louis, MO). GPR30 agonist G1, c-Src inhibitor PP2, and MEK inhibitor PD98059 and other protein kinase inhibitors were from Calbiochem (La Jolla, CA).

Cell Culture, RNA Extraction, and Real-Time PCR Analysis of Gene Expression Regulation
MCF-7 human breast cancer cells were maintained in culture as previously described (29). At 6 d before E2 treatment, cells were switched to phenol red-free media containing charcoal-dextran-treated calf serum. Medium was changed on d 2 and d 4 of culture, and cells were then treated with compounds as indicated. After cell treatments, total RNA was isolated, reverse transcribed, and analyzed by real-time PCR exactly as described previously (29). Primers for the genes studied are as follows: LRRC54 forward (f), GGGCTACACGACGTTGGCT; LRRC54 reverse (r), GAGGTCAAGCGACTCCAGGTA; HSPB8f, TGGATACGTGGAGGTGTCTGG; HSPB8r, GATCCACCTCTGCAGGAAGC; PMAIP1f, CGAAAGACCTCAAGCTGCTC; PMAIP1r, CCAATCCATTGCCTTTATGG. Primers for progesterone receptor and pS2 are published elsewhere (29, 30).

Nuclear Run-On Assays
Nuclear run-on assays were carried out as described previously (31). MCF-7 cells were treated with 10 nM E2 or 10 nM E2 equivalent EDC for 2 h. Then cells were washed once with PBS and harvested using HEPES-EDTA. Then 1 ml lysis buffer [0.5% Nonidet P-40, 10 mM KCl, 10 mM MgCl2, 10 mM HEPES (pH 7.9), and 0.5 mM β-mercaptoethanol] was added per plate, and cell suspensions were incubated on ice for 5 min. After centrifugation, the nuclei were washed once with lysis buffer without Nonidet P-40 and then centrifuged again. Finally nuclei from each treatment were resuspended in 100 µl of storage buffer (50 mM Tris-HCl, 5 mM MgCl2, 0.5 mM β-mercaptoethanol, 40% glycerol) and kept frozen at –80 C. For transcription, 100 µl transcription buffer [10 mM Tris-HCl (pH 8.0), 0.3 M MgCl2, 5 mM dithiothreitol, 40 U of ribonuclease inhibitor (Roche, Indianapolis, IN), 1x biotin labeling mix (Roche)] was added to nuclei, and the reaction was incubated at 30 C for 45 min. Then RNA was isolated using Trizol Reagent (Invitrogen, Carlsbad, CA). The final RNA was dissolved in 50 µl of diethylpyrocarbonate water. Streptavidin-conjugated magnetic beads (50 µl) (Invitrogen) resuspended in binding buffer [10 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 100 mM NaCl) was added to each sample, and the mix was incubated at room temperature for 2 h. Beads were washed twice in 500 µl of 2x standard sodium citrate, 15% formamide for 15 min and once in 500 µl of 2x standard sodium citrate for 5 min. Beads were finally dissolved in 12 µl diethylpyrocarbonate water. RNA was reverse transcribed, and quantitative real-time PCRs were carried out. The fold change in transcription of each gene was calculated as described previously (29). The primers used for the nuclear run-on assays were the same as those used for gene expression experiments.

GeneChip Microarrays, Statistical Analysis, and Functional Categorization of Target Genes
MCF-7 cells were treated with 10 nM E2 or 10 nM E2 equivalent EDC for 4 h in three separate experiments (Fig. 1AGo), and total RNA was prepared from each sample, further purified, and used to generate cRNA, which was labeled with biotin. cRNAs were then hybridized on Affymetrix human Hu-133A GeneChips, which contain oligonucleotide probe sets representing approximately 23,000 human genes and expressed sequence tags. After washing, the chips were scanned and data were analyzed as described previously (32). Briefly, the data was analyzed using GeneChip Operating Software (Affymetrix, Santa Clara, CA). CEL files were then analyzed using affy and gcrma package protocols in R/Bioconductor. Probesets with consistently low expression values were discarded after which statistical multivariate analysis was done by the limma package. Next, probesets were also filtered based on best overall significance by the F-test statistic (32). The criteria for genes regulated by E2 or EDC were set so that they have a false discovery rate (FDR) of 1% and a fold change of 1.5 or greater over vehicle-treated samples. The entire data set will be available through the National Center for Biotechnology Information Gene Expression Omnibus. GeneSpring and ErmineJ software and the web-based DAVID functional annotation tool from National Institutes of Health (NIH) were used for functional classification of the genes.

ChIP Assays
Chromatin immunoprecipitation assays were performed as described elsewhere (32, 33). MCF-7 cells were treated with 10 nM E2 or 10 nM E2 equivalent EDC for 45 min, 2 h, or 3 h before harvest. The antibodies used, purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) were ER{alpha} (HC-20), total RNA Pol II (N20), phosphor-Ser5 RNA Pol II (CTD4H8). Controls using rabbit IgG were routinely done in all ChIP assays, as indicated in the figure legends. We also used a control non-ER binding region of the pS2/TFF1 gene as an additional check for specificity of ChIPs (30, 32). Quantitative real-time PCR was used to calculate recruitment to the regions studied, as described previously (32).

siRNA Transfection and ER{alpha} Knockdown
siRNA knockdown of ER{alpha} was done as previously described (30, 32). MCF-7 cells were transfected with siRNA duplex against the F-domain of ER{alpha} or with control GL3 luciferase (no. D-001400–01), both obtained from Dharmacon (Lafayette, CO). Both siRNAs were transfected into cells at a final concentration of 20 nM using the DharmaFECT transfection reagent (Dharmacon) as per the manufacturer’s recommendations at 48 h before ligand treatment. The small interfering ER{alpha} forward sequence is UCAUCGCAUUCCUUGCAAAdTdT, and the reverse sequence is UUUGCAAGGAAUGCGAUGAdTdT. The efficiency of ER{alpha} knockdown was verified at the RNA level by Q-PCR and at the protein level by Western blot.


    ACKNOWLEDGMENTS
 
We thank Edwin Cheung, Yijun Ruan, and Edison Liu of the Genome Institute of Singapore for sharing their unpublished data with us.


    FOOTNOTES
 
This work was supported by grants from the National Institutes of Health (NIH) [NIH CA 18119 (to B.S.K.), DK 15556 (to J.A.K.), T32 ES07326 (to Z.M.E.)] and a grant from The Breast Cancer Research Foundation (to B.S.K.).

Disclosure Statement: Z.M.E., K.J.K., S.H.K., J.A.K, and B.S.K. have nothing to declare. B.K. is employed by Wyeth Research.

First Published Online July 10, 2008

Abbreviations: BMP, Bone morphogenetic protein; ChIP, chromatin immunoprecipitation; EDC, estrogen dendrimer conjugate; E2, 17β-estradiol; ER, estrogen receptor; HSPB8, heat shock protein B8; JNK, c-Jun N-terminal kinase; LRRC54, leucine-rich repeat containing 54; MEK, MAPK kinase; PgR, progesterone receptor; PMAIP1, PMA-induced protein 1; Q-PCR, quantitative PCR; RNA Pol II, RNA polymerase II; siRNA, small interfering RNA; TSS, transcription start site.

Received for publication February 19, 2008. Accepted for publication July 3, 2008.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Katzenellenbogen BS, Katzenellenbogen JA 2000 Estrogen receptor transcription and transactivation: estrogen receptor {alpha} and estrogen receptor β: regulation by selective estrogen receptor modulators and importance in breast cancer. Breast Cancer Res 2:335–344[CrossRef][Medline]
  2. Hall JM, Couse JF, Korach KS 2001 The multifaceted mechanisms of estradiol and estrogen receptor signaling. J Biol Chem 276:36869–36872[Free Full Text]
  3. McDonnell DP, Norris JD 2002 Connections and regulation of the human estrogen receptor. Science 296:1642–1644[Abstract/Free Full Text]
  4. Hammes SR, Levin ER 2007 Extranuclear steroid receptors: nature and actions. Endocr Rev 28:726–741[Abstract/Free Full Text]
  5. Edwards DP 2005 Regulation of signal transduction pathways by estrogen and progesterone. Annu Rev Physiol 67:335–376[CrossRef][Medline]
  6. Harrington WR, Kim SH, Funk CC, Madak-Erdogan Z, Schiff R, Katzenellenbogen JA, Katzenellenbogen BS 2006 Estrogen dendrimer conjugates that preferentially activate extranuclear, nongenomic versus genomic pathways of estrogen action. Mol Endocrinol 20:491–502[Abstract/Free Full Text]
  7. Carroll JS, Liu XS, Brodsky AS, Li W, Meyer CA, Szary AJ, Eeckhoute J, Shao W, Hestermann EV, Geistlinger TR, Fox EA, Silver PA, Brown M 2005 Chromosome-wide mapping of estrogen receptor binding reveals long-range regulation requiring the forkhead protein FoxA1. Cell 122:33–43[CrossRef][Medline]
  8. Carroll JS, Meyer CA, Song J, Li W, Geistlinger TR, Eeckhoute J, Brodsky AS, Keeton EK, Fertuck KC, Hall GF, Wang Q, Bekiranov S, Sementchenko V, Fox EA, Silver PA, Gingeras TR, Liu XS, Brown M 2006 Genome-wide analysis of estrogen receptor binding sites. Nat Genet 38:1289–1297[CrossRef][Medline]
  9. Ng P, Wei CL, Sung WK, Chiu KP, Lipovich L, Ang CC, Gupta S, Shahab A, Ridwan A, Wong CH, Liu ET, Ruan Y 2005 Gene identification signature (GIS) analysis for transcriptome characterization and genome annotation. Nat Methods 2:105–111[CrossRef][Medline]
  10. Lin CY, Vega VB, Thomsen JS, Zhang T, Kong SL, Xie M, Chiu KP, Lipovich L, Barnett DH, Stossi F, Yeo A, George J, Kuznetsov VA, Lee YK, Charn TH, Palanisamy N, Miller LD, Cheung E, Katzenellenbogen BS, Ruan Y, Bourque G, Wei CL, Liu ET 2007 Whole-genome cartography of estrogen receptor {alpha} binding sites. PLoS Genet 3:e87
  11. Ohta K, Lupo G, Kuriyama S, Keynes R, Holt CE, Harris WA, Tanaka H, Ohnuma S 2004 Tsukushi functions as an organizer inducer by inhibition of BMP activity in cooperation with chordin. Dev Cell 7:347–358[CrossRef][Medline]
  12. Shemetov AA, Seit-Nebi AS, Gusev NB 2008 Structure, properties, and functions of the human small heat-shock protein HSP22 (HspB8, H11, E2IG1): a critical review. J Neurosci Res 86:264–269[CrossRef][Medline]
  13. Yang C, Trent S, Ionescu-Tiba V, Lan L, Shioda T, Sgroi D, Schmidt EV 2006 Identification of cyclin D1- and estrogen-regulated genes contributing to breast carcinogenesis and progression. Cancer Res 66:11649–11658[Abstract/Free Full Text]
  14. Lewis JS, Meeke K, Osipo C, Ross EA, Kidawi N, Li T, Bell E, Chandel NS, Jordan VC 2005 Intrinsic mechanism of estradiol-induced apoptosis in breast cancer cells resistant to estrogen deprivation. J Natl Cancer Inst 97:1746–1759[Abstract/Free Full Text]
  15. Revankar CM, Cimino DF, Sklar LA, Arterburn JB, Prossnitz ER 2005 A transmembrane intracellular estrogen receptor mediates rapid cell signaling. Science 307:1625–1630[Abstract/Free Full Text]
  16. Bologa CG, Revankar CM, Young SM, Edwards BS, Arterburn JB, Kiselyov AS, Parker MA, Tkachenko SE, Savchuck NP, Sklar LA, Oprea TI, Prossnitz ER 2006 Virtual and biomolecular screening converge on a selective agonist for GPR30. Nat Chem Biol 2:207–212[CrossRef][Medline]
  17. Weigel NL, Moore NL 2007 Steroid receptor phosphorylation: a key modulator of multiple receptor functions. Mol Endocrinol 21:2311–2319[Abstract/Free Full Text]
  18. Weigel NL, Moore NL 2007 Kinases and protein phosphorylation as regulators of steroid hormone action. Nucl Recept Signal 5:e005
  19. Lonard DM, O'Malley BW 2007 Nuclear receptor coregulators: judges, juries, and executioners of cellular regulation. Mol Cell 27:691–700[CrossRef][Medline]
  20. Turjanski AG, Vaque JP, Gutkind JS 2007 MAP kinases and the control of nuclear events. Oncogene 26:3240–3253[CrossRef][Medline]
  21. Migliaccio A, Di Domenico M, Castoria G, de Falco A, Bontempo P, Nola E, Auricchio F 1996 Tyrosine kinase/p21ras/MAP-kinase pathway activation by estradiol-receptor complex in MCF-7 cells. EMBO J 15:1292–1300[Medline]
  22. Pedram A, Razandi M, Levin ER 2006 Nature of functional estrogen receptors at the plasma membrane. Mol Endocrinol 20:1996–2009[Abstract/Free Full Text]
  23. Vicent GP, Ballare C, Nacht AS, Clausell J, Subtil-Rodriguez A, Quiles I, Jordan A, Beato M 2006 Induction of progesterone target genes requires activation of Erk and Msk kinases and phosphorylation of histone H3. Mol Cell 24:367–381[CrossRef][Medline]
  24. Belakavadi M, Pandey PK, Vijayvargia R, Fondell JD 2008 MED1 phosphorylation promotes its association with Mediator: implications for nuclear receptor signaling. Mol Cell Biol 28:3932–3942[Abstract/Free Full Text]
  25. Amazit L, Pasini L, Szafran AT, Berno V, Wu RC, Mielke M, Jones ED, Mancini MG, Hinojos CA, O'Malley BW, Mancini MA 2007 Regulation of SRC-3 intercompartmental dynamics by estrogen receptor and phosphorylation. Mol Cell Biol 27:6913–6932[Abstract/Free Full Text]
  26. Prossnitz ER, Oprea TI, Sklar LA, Arterburn JB 2008 The ins and outs of GPR30: a transmembrane estrogen receptor. J Steroid Biochem Mol Biol 109:350–353[CrossRef][Medline]
  27. Filardo EJ, Quinn JA, Frackelton Jr AR, Bland KI 2002 Estrogen action via the G protein-coupled receptor, GPR30: stimulation of adenylyl cyclase and cAMP-mediated attenuation of the epidermal growth factor receptor-to-MAPK signaling axis. Mol Endocrinol 16:70–84[Abstract/Free Full Text]
  28. Schiff R, Massarweh SA, Shou J, Bharwani L, Arpino G, Rimawi M, Osborne CK 2005 Advanced concepts in estrogen receptor biology and breast cancer endocrine resistance: implicated role of growth factor signaling and estrogen receptor coregulators. Cancer Chemother Pharmacol 56(Suppl 1):10–20
  29. Frasor J, Danes JM, Komm B, Chang KC, Lyttle CR, Katzenellenbogen BS 2003 Profiling of estrogen up- and down-regulated gene expression in human breast cancer cells: insights into gene networks and pathways underlying estrogenic control of proliferation and cell phenotype. Endocrinology 144:4562–4574[CrossRef][Medline]
  30. Stossi F, Likhite VS, Katzenellenbogen JA, Katzenellenbogen BS 2006 Estrogen-occupied estrogen receptor represses cyclin G2 gene expression and recruits a repressor complex at the cyclin G2 promoter. J Biol Chem 281:16272–16278[Abstract/Free Full Text]
  31. Patrone G, Puppo F, Cusano R, Scaranari M, Ceccherini I, Puliti A, Ravazzolo R 2000 Nuclear run-on assay using biotin labeling, magnetic bead capture and analysis by fluorescence-based RT-PCR. Biotechniques 29:1012–1014, 1016–1017[Medline]
  32. Chang EC, Charn TH, Park SH, Helferich WG, Komm B, Katzenellenbogen JA, Katzenellenbogen BS 2008 Estrogen receptors {alpha} and β as determinants of gene expression: influence of ligand, dose, and chromatin binding. Mol Endocrinol 22:1032–1043[Abstract/Free Full Text]
  33. Barnett DH, Sheng S, Charn TH, Waheed A, Sly WS, Lin CY, Liu ET, Katzenellenbogen BS 2008 Estrogen receptor regulation of carbonic anhydrase XII through a distal enhancer in breast cancer. Cancer Res 68:3505–3515[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   ERα
Ligands:   17β-Estradiol



This article has been cited by other articles:


Home page
EndocrinologyHome page
K. Hashimoto, E. Ishida, S. Matsumoto, S. Okada, M. Yamada, T. Satoh, T. Monden, and M. Mori
Carbohydrate Response Element Binding Protein Gene Expression Is Positively Regulated by Thyroid Hormone
Endocrinology, July 1, 2009; 150(7): 3417 - 3424.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. R. Levin
G Protein-Coupled Receptor 30: Estrogen Receptor or Collaborator?
Endocrinology, April 1, 2009; 150(4): 1563 - 1565.
[Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. Stossi, Z. Madak-Erdogan, and B. S. Katzenellenbogen
Estrogen Receptor Alpha Represses Transcription of Early Target Genes via p300 and CtBP1
Mol. Cell. Biol., April 1, 2009; 29(7): 1749 - 1759.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. D. Noel, K. L. Keen, D. I. Baumann, E. J. Filardo, and E. Terasawa
Involvement of G Protein-Coupled Receptor 30 (GPR30) in Rapid Action of Estrogen in Primate LHRH Neurons
Mol. Endocrinol., March 1, 2009; 23(3): 349 - 359.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. R. Levin
Rapid signaling by steroid receptors
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2008; 295(5): R1425 - R1430.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Madak-Erdogan, Z.
Right arrow Articles by Katzenellenbogen, B. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Madak-Erdogan, Z.
Right arrow Articles by Katzenellenbogen, B. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals